ID: 1190604978 |
View in Genome Browser |
| Species | Human (GRCh38) |
| Location | X:52131794-52131816 |
| Sequence | GTTTTTATGGCTATTGTGAA TGG (reversed) |
| Strand | - |
| Crispr in exon? | No |
| Crispr in intron? | No |
| Off-Target Counts | All | Exonic | Intronic | Intergenic |
|---|---|---|---|---|
| Total | 4340 | |||
| Summary | {0: 1, 1: 13, 2: 227, 3: 1091, 4: 3008} |
Found 1 Related Crispr Pairs
Show Crispr Pairs| ID | Spacer | Status | Summary | ID | Location | Sequence | Summary | |
|---|---|---|---|---|---|---|---|---|
| 1190604978_1190604980 | 9 | Left | 1190604978 | X:52131794-52131816 | CCATTCACAATAGCCATAAAAAC | 0: 1 1: 13 2: 227 3: 1091 4: 3008 |
||
| Right | 1190604980 | X:52131826-52131848 | CATAGAAATACAGCTAGCCATGG | 0: 1 1: 3 2: 108 3: 782 4: 2214 |
Note: the row highlighted in blue is the original CRISPR
| WGE ID | Location | Sequence | Mismatches | Strand | Type |
|---|---|---|---|---|---|
| 1190604978 | Original CRISPR | GTTTTTATGGCTATTGTGAA TGG (reversed) | Intergenic | ||
| Too many off-targets to display for this crispr | |||||