ID: 1190604978

View in Genome Browser
Species Human (GRCh38)
Location X:52131794-52131816
Sequence GTTTTTATGGCTATTGTGAA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 4340
Summary {0: 1, 1: 13, 2: 227, 3: 1091, 4: 3008}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1190604978_1190604980 9 Left 1190604978 X:52131794-52131816 CCATTCACAATAGCCATAAAAAC 0: 1
1: 13
2: 227
3: 1091
4: 3008
Right 1190604980 X:52131826-52131848 CATAGAAATACAGCTAGCCATGG 0: 1
1: 3
2: 108
3: 782
4: 2214

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1190604978 Original CRISPR GTTTTTATGGCTATTGTGAA TGG (reversed) Intergenic
Too many off-targets to display for this crispr