ID: 1190604980

View in Genome Browser
Species Human (GRCh38)
Location X:52131826-52131848
Sequence CATAGAAATACAGCTAGCCA TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 3108
Summary {0: 1, 1: 3, 2: 108, 3: 782, 4: 2214}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1190604975_1190604980 28 Left 1190604975 X:52131775-52131797 CCAAATCAAGAACACAACCCCAT 0: 8
1: 142
2: 376
3: 855
4: 1290
Right 1190604980 X:52131826-52131848 CATAGAAATACAGCTAGCCATGG 0: 1
1: 3
2: 108
3: 782
4: 2214
1190604978_1190604980 9 Left 1190604978 X:52131794-52131816 CCATTCACAATAGCCATAAAAAC 0: 1
1: 13
2: 227
3: 1091
4: 3008
Right 1190604980 X:52131826-52131848 CATAGAAATACAGCTAGCCATGG 0: 1
1: 3
2: 108
3: 782
4: 2214
1190604976_1190604980 11 Left 1190604976 X:52131792-52131814 CCCCATTCACAATAGCCATAAAA 0: 1
1: 15
2: 55
3: 162
4: 647
Right 1190604980 X:52131826-52131848 CATAGAAATACAGCTAGCCATGG 0: 1
1: 3
2: 108
3: 782
4: 2214
1190604979_1190604980 -4 Left 1190604979 X:52131807-52131829 CCATAAAAACAACAAAATGCATA 0: 1
1: 0
2: 4
3: 88
4: 1135
Right 1190604980 X:52131826-52131848 CATAGAAATACAGCTAGCCATGG 0: 1
1: 3
2: 108
3: 782
4: 2214
1190604977_1190604980 10 Left 1190604977 X:52131793-52131815 CCCATTCACAATAGCCATAAAAA 0: 9
1: 174
2: 848
3: 2038
4: 5943
Right 1190604980 X:52131826-52131848 CATAGAAATACAGCTAGCCATGG 0: 1
1: 3
2: 108
3: 782
4: 2214

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1190604980 Original CRISPR CATAGAAATACAGCTAGCCA TGG Intergenic
Too many off-targets to display for this crispr