ID: 1190605988

View in Genome Browser
Species Human (GRCh38)
Location X:52143401-52143423
Sequence CTGCTTCTACTGAAGGTAGA AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 588
Summary {0: 1, 1: 0, 2: 5, 3: 95, 4: 487}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1190605984_1190605988 10 Left 1190605984 X:52143368-52143390 CCTCAGGCTGTACAAGAAGCATG 0: 40
1: 648
2: 1019
3: 1145
4: 877
Right 1190605988 X:52143401-52143423 CTGCTTCTACTGAAGGTAGAAGG 0: 1
1: 0
2: 5
3: 95
4: 487

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1190605988 Original CRISPR CTGCTTCTACTGAAGGTAGA AGG Intergenic
900072396 1:781332-781354 CCACTTCTACTCAAGGTAGGAGG - Intergenic
900768417 1:4520813-4520835 CTGTTTGTAATGGAGGTAGAGGG - Intergenic
900768448 1:4520957-4520979 CTGTTTGTAATGGAGGTAGAGGG - Intergenic
900900904 1:5515214-5515236 CTGCTTCCACTCATGGTGGAAGG + Intergenic
901276808 1:7997963-7997985 CTGCTTCCACTCATGGCAGAAGG - Intergenic
902097340 1:13957607-13957629 CTGCTTCTACTCATGGCAGAAGG + Intergenic
902160641 1:14527656-14527678 CTGCTTCCACTTATGGTAGAGGG + Intergenic
902189489 1:14752021-14752043 CTGCTTCCACTCATGGCAGAAGG + Intronic
903002843 1:20278717-20278739 CTGCTTCCACTCATGGCAGAGGG + Intergenic
903046115 1:20565550-20565572 CTGCTTCAAGTGGAGGGAGAGGG - Intergenic
903834625 1:26195389-26195411 CTGCTTCCACTCATGGCAGAAGG + Intronic
904475646 1:30763084-30763106 CTGCATTTACAGAAGGTCGAAGG - Intergenic
905931401 1:41790330-41790352 CTGCTTCCACTCATGGTAGAGGG - Intronic
905966060 1:42096711-42096733 CTGCTTCCACTCATGGCAGAAGG + Intergenic
907499040 1:54865112-54865134 CTGCTTGAACTGAAGGTAGTTGG + Intronic
907523961 1:55043032-55043054 CTGCTTTCACTGATGGCAGAAGG - Intronic
907695633 1:56725068-56725090 CTGCTTCTACTCATGGCAGAAGG - Intronic
908094942 1:60727852-60727874 CTGCTTCCACTTATGGCAGAAGG - Intergenic
909364892 1:74808117-74808139 CTGCTTCCACTCATGGCAGAAGG + Intergenic
909694255 1:78448219-78448241 CTGCTTCCACTCATGGCAGAAGG + Intronic
910072741 1:83238649-83238671 CTGCTTCCACTGATTGTGGAAGG - Intergenic
910270402 1:85387884-85387906 CTGCTTCCACTCATGGCAGAAGG + Intronic
911671840 1:100616355-100616377 CTGCTTCCACTGAAAGGATAGGG + Intergenic
912139398 1:106703574-106703596 CTGATTCTCCTGAAAATAGAAGG - Intergenic
912227359 1:107749967-107749989 CAGCTTCTACTGAAGTTACTAGG + Intronic
912479476 1:109969726-109969748 CTGCTTCCATTCATGGTAGAAGG - Intergenic
913122981 1:115758779-115758801 CTGCTTCCACTCATGGCAGAAGG - Intronic
913240852 1:116828009-116828031 CTGCTTCCACTCATGGTAGAAGG + Intergenic
913352209 1:117874409-117874431 CTGCTTCTACTCATGGTCGAAGG - Intronic
913352487 1:117876333-117876355 CTGCTTCCACTCACGGCAGAAGG - Intronic
914382834 1:147134169-147134191 CTGCTTCCACTCATGGCAGAAGG + Intergenic
915021549 1:152784735-152784757 CTTCATCTACTGAAAGTAGAGGG + Intronic
916537288 1:165715412-165715434 GTACTTCTAGGGAAGGTAGATGG - Intergenic
916899649 1:169207125-169207147 CTGTTTCTACTCATGGTGGAAGG + Intronic
918902947 1:190449472-190449494 ATGCTTTTACTGAAGGGAGAAGG - Intronic
920392989 1:205622290-205622312 CAGCTACTACTTAAGGTATAAGG + Intronic
920398293 1:205661861-205661883 CTGCTTCTCCCGGTGGTAGAGGG + Exonic
921040070 1:211422586-211422608 CTGCTTCCACTCATGGCAGAAGG + Intergenic
921980592 1:221253581-221253603 CTGCTTCCACTCATGGCAGAAGG + Intergenic
922178879 1:223218054-223218076 CTGCTTCCACTCATGGCAGAAGG - Intergenic
922267334 1:223995290-223995312 CCACTTCTACTCAAGGTAGGAGG - Intergenic
922546464 1:226461166-226461188 CTACATCCCCTGAAGGTAGAAGG + Intergenic
922812748 1:228426911-228426933 CTGCTTCTGCTCATGGTGGAAGG - Intergenic
924327389 1:242909460-242909482 CTGCTTCTACTCATGGTGGAAGG - Intergenic
1063347859 10:5327887-5327909 CTGCTTCCACTCATGGCAGATGG + Intergenic
1063943855 10:11158238-11158260 CTGCTTCTACAGCAGGTCTAGGG - Intronic
1064184273 10:13147208-13147230 CTGCTTCCACTCATGGCAGAAGG + Intergenic
1064531178 10:16311794-16311816 TTGCTTCTACTCATGGTGGAAGG + Intergenic
1065385342 10:25128218-25128240 CTGCTTCCACTCATGGTAGAAGG - Intergenic
1065416404 10:25492063-25492085 CTGCTTCCACTCATGGTGGAAGG + Intronic
1066006916 10:31154168-31154190 CTGCTTCCACTCATGGCAGAGGG + Intergenic
1066056521 10:31686074-31686096 CTTGATCCACTGAAGGTAGAGGG + Intergenic
1066501649 10:36000750-36000772 CTGCTTCTACTCATGGCAGAAGG - Intergenic
1066629497 10:37445079-37445101 CTGCTTCAACTCATGGTAGAAGG - Intergenic
1066650444 10:37650324-37650346 CTGCTTCCACTCATGGCAGAAGG + Intergenic
1066726377 10:38400313-38400335 CCACTTCTACTCAAGGTAGGAGG + Intergenic
1067033451 10:42896460-42896482 CTGCTTCCACTCATGGCAGAAGG + Intergenic
1067151873 10:43742560-43742582 CTGCTTCCACTGATGGTGGGAGG + Intergenic
1067468837 10:46521846-46521868 CTGCTTCCACTCATGGCAGAAGG + Intergenic
1067518399 10:46974660-46974682 CTACTTCCACTCATGGTAGAAGG + Intronic
1067643850 10:48077168-48077190 CTACTTCCACTCATGGTAGAAGG - Intergenic
1067799425 10:49348847-49348869 CTGCTTCCACTCATGGCAGAAGG + Intergenic
1068343252 10:55736935-55736957 CTGCTTCCACTCATGGCAGAAGG + Intergenic
1068691575 10:59920908-59920930 CTGCTTCTCCTTATGGCAGAAGG - Intergenic
1068944675 10:62717902-62717924 CTGCTTCCACTCATGGCAGAAGG + Intergenic
1068972152 10:62970454-62970476 AGTCTTCTACTGAAAGTAGATGG + Intergenic
1069045341 10:63737320-63737342 CTGCTTCCACTCATGGCAGAAGG - Intergenic
1069054379 10:63829608-63829630 CTGCTTCCACTCATGGCAGAAGG + Intergenic
1069269382 10:66506023-66506045 CTGCTTCCACTCATGGCAGAAGG + Intronic
1071225467 10:83523698-83523720 CTGCTTCCACTCATGGCAGATGG + Intergenic
1071344057 10:84674589-84674611 CTGCTTCTACTCACGGTGGAAGG + Intergenic
1074620225 10:115111473-115111495 CTGCGTCTACTCATGGCAGAAGG + Intronic
1074722628 10:116275455-116275477 CAGTTTCTACTGAATGTATATGG - Intergenic
1074982669 10:118632291-118632313 CTGCTTCCACTCATGGAAGAAGG - Intergenic
1075009844 10:118858157-118858179 CTGCTTCCACTCATGGTGGAAGG - Intergenic
1075417700 10:122277573-122277595 CTGCTTGTACTCATGGTGGAAGG + Intronic
1075685809 10:124364507-124364529 CTGCTGCTGCAGGAGGTAGATGG - Intergenic
1075818338 10:125283833-125283855 CTGCTTCTTCTGAAACCAGAAGG - Intergenic
1078359173 11:10655093-10655115 CTGATTCTACTAAAGGAAGTTGG + Intronic
1078443246 11:11385053-11385075 CTGCTTCCACTCATGGTGGAAGG + Intronic
1078651609 11:13200052-13200074 GAGCTTCTACTCAAAGTAGAAGG + Intergenic
1080654429 11:34247346-34247368 CTGCTGCTACTGAATGTGTATGG - Intronic
1081638075 11:44734137-44734159 CTGCTTCCACTCAGGGCAGAAGG - Intronic
1082283341 11:50295917-50295939 CTGCTTCTACTTGAGGTAGGAGG + Intergenic
1082958508 11:58897100-58897122 ATGCCTTTACTGAAGGTAAAAGG - Intronic
1083635082 11:64116521-64116543 CTGGTTGTTCTGCAGGTAGAGGG - Exonic
1084767145 11:71319877-71319899 CTCCTTCTCCTGAAAGCAGAAGG - Intergenic
1085068374 11:73518958-73518980 CTGCTTCCACTCATGGCAGAAGG - Intronic
1085110918 11:73887017-73887039 CTGCTTCCACTCATGGCAGAAGG - Intronic
1085147106 11:74210688-74210710 CTGCTTCCACTCATGGTGGAAGG - Intronic
1085506130 11:77060772-77060794 CTGCTTCCACTCATGGTGGAAGG - Intergenic
1085671735 11:78472115-78472137 CTGCCTCTAATGAAGGTATTGGG - Intronic
1085943184 11:81230707-81230729 CTCCTTCTACAGAAAGAAGAAGG + Intergenic
1085986533 11:81794140-81794162 CTGCTTCTGCTGAGGGCACAGGG - Intergenic
1086445520 11:86866875-86866897 CTGCTTCCACTCATGGCAGAAGG - Intronic
1087409315 11:97770710-97770732 CTGCTTCTACTCATGGCAGAAGG + Intergenic
1088057019 11:105595989-105596011 CTGCTTCCACTCATGGCAGAAGG - Intergenic
1088269567 11:108019876-108019898 CTGCTTCTACTCATGGCAGAAGG + Intronic
1089349981 11:117816700-117816722 CTGCGTCTAGTGAAGGAAGTGGG - Intronic
1090385231 11:126354656-126354678 CTGCTTCTGCTGAAGCTGGAGGG - Intergenic
1090585436 11:128206890-128206912 CTGCTTCCACTCATGGCAGAAGG - Intergenic
1090697959 11:129267808-129267830 CTGCTTCTACTCATGGCAGAAGG + Intronic
1090822694 11:130357875-130357897 CTGCTTCCACTCATGGTGGAAGG - Intergenic
1090979772 11:131709240-131709262 CTGCTTTTACTCTAGGTAAAAGG + Intronic
1091628197 12:2138698-2138720 CTGCTTCCACTCATGGCAGAAGG - Intronic
1091772518 12:3162220-3162242 CTGCTTCTGCTCATGGTGGAAGG - Intronic
1092730923 12:11533680-11533702 CTGCTTCCACTCATGGCAGAAGG + Intergenic
1092962109 12:13606298-13606320 CTGCTTCCACTCATGGTGGAAGG + Intronic
1092962475 12:13609325-13609347 CTGTTTATACTGATGCTAGATGG + Intronic
1092984350 12:13831148-13831170 CTGCTTCCTCTGAAGGTGGAAGG - Intronic
1093411706 12:18876124-18876146 CTGCTTCCACTCATGGTAGAAGG + Intergenic
1093713330 12:22352967-22352989 CTGCTTCCACTCAAGGTGGAAGG - Intronic
1094156931 12:27347013-27347035 CTGCATCCACTCAAGGTGGAAGG - Intronic
1094497780 12:30999616-30999638 CGGTTTCTACTGAATGTATATGG + Intergenic
1095304709 12:40625982-40626004 CTGCTTCCACTCATGGTGGAAGG + Intergenic
1095536497 12:43254517-43254539 CTGATTTTAATGAAGGTAGCAGG - Intergenic
1097043791 12:56172420-56172442 CTGCTTCTCCTGGAGGTAATTGG - Exonic
1097120526 12:56728104-56728126 CTGGTCCTTCTGAAGGTAAATGG - Intronic
1097708763 12:62895788-62895810 CTGCTTCCACTCATGGTGGAAGG - Intronic
1097710729 12:62914278-62914300 CTGCTTCCACTCATGGTTGAAGG - Intronic
1098194287 12:67983490-67983512 CTGCTTCCACTTATGGCAGAAGG - Intergenic
1098761191 12:74427411-74427433 CTGCTTCCACTCATGGTGGAAGG - Intergenic
1098931439 12:76419434-76419456 CTGCTTATAATAAAGGCAGAGGG + Intronic
1100124387 12:91406118-91406140 CTGCTTCAACTCATGGCAGAAGG + Intergenic
1100131871 12:91504292-91504314 CTCTTTCTACTGCAGGTAGTGGG + Intergenic
1100368837 12:93946590-93946612 CTGCTTCAACTCATGGTGGAAGG + Intergenic
1100453585 12:94730875-94730897 CTGCTTCTACCCATGGTGGAAGG + Intergenic
1100466547 12:94850598-94850620 CTGCTTCTACTCATGGCAGAAGG + Intergenic
1100576324 12:95894650-95894672 CTGCTTCCACTCATGGCAGAAGG - Intronic
1101594549 12:106152482-106152504 ATGCTTCTGCTGAAGGAACAAGG - Intergenic
1102905210 12:116669389-116669411 CTGCTCACACTGATGGTAGATGG - Intergenic
1104168975 12:126261382-126261404 CTGCTTCTACTTCTGGTGGAAGG - Intergenic
1104407795 12:128532970-128532992 CTGCTTCTTCTAAAGGAAGGGGG - Intronic
1106130409 13:26934762-26934784 CTGCTTCTACTCATGGCAGAAGG - Intergenic
1106213740 13:27675206-27675228 CTGCTTCCACTCATGGCAGAAGG - Intergenic
1106509100 13:30397815-30397837 CTCCTTCTACAGAGGGAAGATGG + Intergenic
1106667761 13:31870557-31870579 CTGCTTCCACTCATGGTGGAAGG + Intergenic
1106793883 13:33184368-33184390 CTGCTGCTGCTGATGGTTGATGG + Intronic
1107777722 13:43864463-43864485 CTGCTTCTACTCATGGTAGAAGG + Intronic
1108041190 13:46340680-46340702 CTGCTTCCACTCATGGTGGAGGG + Intergenic
1108083285 13:46759441-46759463 CTGCTTCCACTTATGGTGGAAGG - Intergenic
1108299208 13:49057251-49057273 GTCCTTCTGTTGAAGGTAGAAGG + Intronic
1108461278 13:50669911-50669933 CTGCTTCTGCTCAAGGCTGAAGG - Intronic
1108588321 13:51890463-51890485 CTGCTTCCACTCATGGCAGAAGG - Intergenic
1109604984 13:64681525-64681547 TTTCTTCTCCTGAAGTTAGAAGG + Intergenic
1109978383 13:69872162-69872184 CTGCTTCCACTCATGGCAGAAGG + Intronic
1110182661 13:72635941-72635963 CTGCCTCTACTCATGGTGGAAGG - Intergenic
1110276450 13:73646770-73646792 CTGCTTCCATTCATGGTAGAAGG - Intergenic
1110849517 13:80229153-80229175 CTGTTTCTACTCATGGTAGAAGG + Intergenic
1110884505 13:80616573-80616595 CTGCTTCCACTCATGGCAGAAGG - Intergenic
1110884719 13:80618524-80618546 CTGCTTCCACTCATGGCAGAAGG - Intergenic
1111013659 13:82347655-82347677 CTGCTTCCACTCATGGCAGAAGG + Intergenic
1111226712 13:85283034-85283056 CTGCTTCCACTCATGGCAGAAGG - Intergenic
1111290673 13:86166139-86166161 CTACTTCCACTCAAGGCAGATGG + Intergenic
1112317308 13:98374811-98374833 CTGCTTCCACTCGTGGTAGAAGG + Intronic
1112553500 13:100445056-100445078 CTGCTTTTATTCATGGTAGAAGG + Intronic
1113758703 13:112832801-112832823 GTGCGTCCACTGAAGATAGAGGG - Intronic
1114391101 14:22309502-22309524 CTGCTCCTGCTGATGGAAGAGGG + Intergenic
1114764234 14:25352063-25352085 CTGCTTCTACTCATGGTGGAAGG + Intergenic
1116505902 14:45681051-45681073 CTGCTTTTACTTAAGGTGGAAGG + Intergenic
1117149529 14:52871531-52871553 CTGGTTCTTCTGCAGGTAGATGG - Intronic
1117761195 14:59030724-59030746 CTGTTTCTACTCATGGTGGAAGG - Intergenic
1118922422 14:70161551-70161573 CTACTGCCACTGAAGGCAGAAGG + Intronic
1118927347 14:70204842-70204864 CAGCCTCTTCTGCAGGTAGAAGG - Intergenic
1120592803 14:86395364-86395386 CTGCTGCTACTCATGGCAGAAGG + Intergenic
1120658682 14:87227507-87227529 CTGCTTCTACTCATGACAGAAGG + Intergenic
1121210407 14:92204111-92204133 CTGCTTCTACTCATGGTGGAAGG - Intergenic
1121215400 14:92243944-92243966 CTGCTTCCACTCATGGTGGAAGG + Intergenic
1121215701 14:92246069-92246091 CTGCTTCCACTCATGGCAGATGG + Intergenic
1121526677 14:94624174-94624196 CTGCTGCAGCTGAAGGCAGAAGG - Intronic
1122852828 14:104546175-104546197 CTGCTTCAGCTGCAGGAAGACGG - Intronic
1123823389 15:24055348-24055370 CTGCTACTAGGGTAGGTAGAGGG - Intergenic
1124073311 15:26415745-26415767 CTGCTTCCACTCATGGTGGAAGG - Intergenic
1124117086 15:26854714-26854736 CTGCTTCCACTCAAGGTGGGAGG - Intronic
1124561904 15:30782039-30782061 CTGCTTCCACTCATGGCAGAAGG + Intergenic
1124717405 15:32077752-32077774 CTGCTTCTACTCATAGCAGAAGG + Intronic
1125081902 15:35684586-35684608 GTGCTTTTACTTAAGGCAGAAGG + Intergenic
1125780078 15:42257403-42257425 CTGTTTCTACTCATGGTGGAAGG - Intronic
1125843080 15:42823970-42823992 CTGCTTCCATTCATGGTAGAAGG + Intronic
1125908551 15:43415731-43415753 CTGCTGCTACTGGAGGCAGTAGG + Exonic
1127078188 15:55348667-55348689 CTGCTTCCACTCATGGCAGAAGG - Intronic
1128462057 15:67877789-67877811 CTGCTTCTCCAGAAAGCAGATGG + Intergenic
1128579118 15:68796546-68796568 CAGCATCCACTGAAGGTAGGAGG - Intronic
1129323686 15:74788587-74788609 TTGCTACTACTTAAGGGAGATGG - Intronic
1130169251 15:81494892-81494914 CTGCTTCTACTTAAGTTTTATGG - Intergenic
1130277469 15:82488971-82488993 CTGCTTCTGCTTGAGGGAGAAGG - Intergenic
1130349118 15:83075008-83075030 CTGCTTCTACTCATGGTGGAAGG + Intergenic
1130815765 15:87430722-87430744 CTGCTTCCACTCATGGTGGAAGG - Intergenic
1131920043 15:97316424-97316446 CTGCTTCCACTCATGGTAGAAGG + Intergenic
1132813416 16:1813284-1813306 CTGCTTCTGCTCATGGCAGAAGG - Intronic
1133778905 16:8921582-8921604 CTGCTTCTACTGCCGATATAGGG + Intronic
1134560279 16:15203123-15203145 CTGCTTCCACTCATGGTGGAAGG + Intergenic
1134920821 16:18114737-18114759 CTGCTTCCACTCATGGTGGAAGG + Intergenic
1135020775 16:18961249-18961271 CTTCTTCTACTCATGGTGGAAGG + Intergenic
1135196067 16:20395864-20395886 CTGCTTCTACTCATGGTGGAAGG - Intronic
1135202315 16:20448911-20448933 ATGCTTCTATTCATGGTAGAAGG - Intergenic
1135216789 16:20578955-20578977 ATGCTTCTATTCATGGTAGAAGG + Intergenic
1135397499 16:22142352-22142374 CTGCTTCCACTCATGGTGGAAGG + Intronic
1137069976 16:35895871-35895893 CTGCTTCCACTCAGGGCAGAAGG - Intergenic
1138603797 16:58074251-58074273 CTGCTTCCACTTATGGCAGAAGG + Intergenic
1139032030 16:62895689-62895711 CTGCTTCCACTCATGGCAGAAGG - Intergenic
1139144430 16:64307237-64307259 CTGCTTCCACTCATGGCAGAAGG - Intergenic
1141236538 16:82222940-82222962 CTGCTTCCACTCATGGTGGAAGG - Intergenic
1141718686 16:85742457-85742479 CTGCTTCCACTCAAGGCGGAAGG - Intronic
1146828458 17:36045655-36045677 TTTCAGCTACTGAAGGTAGAGGG - Intergenic
1148344100 17:46891833-46891855 CTGTTTCTAGTGAAGGTTAATGG + Intergenic
1148881035 17:50727350-50727372 CTGCTTCCACTCATGGCAGAAGG + Intronic
1149372904 17:56013071-56013093 CTGCTTCCATTCATGGTAGAAGG + Intergenic
1150034976 17:61784808-61784830 CTGCTTCCACTGATGGCAAAAGG - Intronic
1152337343 17:79706338-79706360 CTGCTTGGACGGAAGGTGGATGG - Intergenic
1152920699 17:83065121-83065143 CTGGTTCTGCTGAAGCTGGAGGG - Intergenic
1153082835 18:1248320-1248342 CTGCTTCTACTCATGGCAGAAGG + Intergenic
1153206816 18:2711984-2712006 CTGCTTCCACTCATGGTGGAAGG - Intronic
1153591404 18:6677290-6677312 CTGCTTCCACTAATGGCAGAAGG + Intergenic
1155097075 18:22566658-22566680 CAGCCACTACTGAAGGTAAAAGG + Intergenic
1155735363 18:29215981-29216003 CTGCTTCTATTCATGGTGGAAGG + Intergenic
1155917222 18:31568610-31568632 CTGCTTCCACTCATGGCAGAAGG - Intergenic
1156116760 18:33794855-33794877 CTGCTTCTACTCATGGCAGAAGG - Intergenic
1156985381 18:43344970-43344992 TTGCTTCTACTCATGGCAGAAGG + Intergenic
1157656626 18:49396088-49396110 CTGCTTCCACTCATGGCAGAAGG - Intronic
1157908362 18:51590952-51590974 CTGCTTCCACTCATGGTGGAAGG + Intergenic
1157942062 18:51939945-51939967 CTGCTTCAATTCATGGTAGAAGG - Intergenic
1158809930 18:61020693-61020715 CTGCTTCTAATGATGATTGATGG - Intergenic
1159262025 18:66026448-66026470 CTGTTTCTACTCATGGTGGAAGG - Intergenic
1159420176 18:68208394-68208416 CTGCTTCCACTCATGGCAGAAGG + Intergenic
1159628867 18:70726287-70726309 CTGCTTCAACTCATGGTAGAAGG + Intergenic
1159814508 18:73056086-73056108 CTGCTTCCACTGATGGTGGAGGG + Intergenic
1160144675 18:76353714-76353736 CTGCTTCCACTCATGGTGGAAGG - Intergenic
1160629958 18:80239939-80239961 CTGCTTCTACTCACAGTGGAAGG + Intronic
1160799757 19:962327-962349 CTGCTGCTGCTGAGGGGAGAGGG - Intronic
1162868424 19:13566807-13566829 CTGCTTCTACTCATAGTGGAAGG - Intronic
1163323957 19:16591261-16591283 CTCCTTCTACTGAGGAGAGAAGG - Intronic
1166175583 19:41066797-41066819 CTGCTTCTACTCATAGCAGAAGG - Intergenic
1166680329 19:44762275-44762297 CTGCTTCTACTCATGGCAGAAGG + Intergenic
1167515910 19:49923100-49923122 CTGCTTCTACTGAAGGGACAAGG + Intronic
1167629157 19:50613209-50613231 CTGCTTCTACTCTTGGTGGAAGG - Intergenic
1167790214 19:51672430-51672452 CCGCTTCTACTCATGGCAGAAGG + Intergenic
926050538 2:9741623-9741645 CTGCTTCCACTCATGGCAGAAGG - Intergenic
926612602 2:14961491-14961513 CTGCTTCCACTCATGGCAGAAGG - Intergenic
927715913 2:25352734-25352756 CTGCTTCTCCAGAGGGAAGAGGG + Intergenic
928181534 2:29071822-29071844 CTGCTTCTGCTTTAGGCAGAGGG + Exonic
928977659 2:37105496-37105518 CTGCTTCCACTCATGGTGGAAGG - Exonic
929052431 2:37849454-37849476 CTACTTCTACTCATGGTAGATGG - Intergenic
929250093 2:39743707-39743729 CTGCTTCTAGTCATGGCAGAAGG - Intronic
929379023 2:41327104-41327126 CTGCTTCTACTCATGGCAGAAGG - Intergenic
929710170 2:44258467-44258489 CTGCTTCTGCTCATGGTGGAAGG - Intergenic
929731996 2:44504941-44504963 CTGCTTCCACTCATGGCAGAAGG + Intronic
930722635 2:54652657-54652679 CAGCTCCTACAGAAGGTAAATGG - Intronic
930984867 2:57573158-57573180 CTGCTTCTACTCATTGTAGAAGG - Intergenic
932022771 2:68104606-68104628 CTGCTTCCACTTATGGCAGAAGG + Intronic
932616621 2:73235483-73235505 CCGCTTGTACCCAAGGTAGAAGG + Intronic
934936162 2:98467054-98467076 CTGCTTCTACTCGTGGTGGAAGG + Intronic
935264784 2:101384956-101384978 CTGCTTCCACTCATGGTGGAAGG - Intronic
936723162 2:115278577-115278599 CTGCTTCTACTTATGGTGGAAGG + Intronic
936972945 2:118192153-118192175 CTGGTTCCACTGAAAGTGGAAGG + Intergenic
937260686 2:120585282-120585304 CTGCTTCCACTCATGGCAGAAGG + Intergenic
937802832 2:126100459-126100481 CTGCTTCCACTCATGGTGGAAGG - Intergenic
939049140 2:137286568-137286590 TTGCTTCTGATGTAGGTAGATGG - Intronic
939421109 2:141970449-141970471 CTGCTTATACTAAAGCTATATGG + Intronic
939888311 2:147705768-147705790 CTGCTTCCACTCATGGTGGAAGG + Intergenic
940132644 2:150401063-150401085 CTGCTTCCACTCATGGCAGAAGG - Intergenic
940332827 2:152493706-152493728 CTGCTTCCACTTATGGCAGAAGG - Intronic
940471561 2:154107100-154107122 CTGCTTCCACTCAAAGTCGAAGG - Intronic
940487491 2:154314585-154314607 CTGCTTCCACTCACGGTGGAAGG + Intronic
941164092 2:162066750-162066772 CTGCTTCTACTTATAGCAGAAGG + Intronic
941197185 2:162467527-162467549 CTGCTTCCACTCATGGTGGAAGG - Intronic
941302815 2:163825427-163825449 CTTCCTCTAGTGAAGGTGGAAGG + Intergenic
941364101 2:164589475-164589497 CTGCTTCCACTAATGGTGGAAGG + Intronic
941589690 2:167404107-167404129 CTGCTTCCACTCATGGTGGAAGG + Intergenic
942855891 2:180547111-180547133 CTGCTTCCACTCACGGTGGAAGG - Intergenic
943152075 2:184126395-184126417 CTGCTTCCACTCATGGTGGAAGG + Intergenic
943705298 2:191027625-191027647 CTGCTTCTACTCATGGCAGAAGG - Intergenic
945145402 2:206733086-206733108 CAGCTTCTACTCATGGTGGAAGG + Intergenic
946340899 2:219067786-219067808 CGGCTTCTACTGAATACAGATGG + Intergenic
947783076 2:232787837-232787859 CTCCTTCTTCTAAAGTTAGAAGG - Intronic
948384636 2:237573938-237573960 CTGCTTCCACTCATGGCAGAAGG - Intergenic
1168944311 20:1738883-1738905 TTGCTTCCACTCAAGGCAGAAGG - Intergenic
1169334309 20:4742737-4742759 CTGCTTCTACTCATGGTGGAAGG - Intergenic
1169885145 20:10390537-10390559 CTGCTTCTACTCATGGCAGAAGG + Intergenic
1170062195 20:12271029-12271051 CTGCTTCCACTAATGGTGGAAGG + Intergenic
1170385252 20:15809469-15809491 CTGCTTCTACTCACTGCAGAAGG + Intronic
1173317546 20:41958661-41958683 CTGCTTCTACTCATGATGGAAGG - Intergenic
1173584103 20:44169046-44169068 CTGCTTCCACTCATGGCAGAAGG - Intronic
1173812945 20:45967626-45967648 CTGCTGCTACTGGAAGTGGAGGG + Exonic
1174077273 20:47946561-47946583 CTGCTTCCACTCATGGTGGAAGG - Intergenic
1175400667 20:58698337-58698359 CAGCTACAACTGAAGGTAGGTGG - Intronic
1177182600 21:17758979-17759001 CTGCTTCTACTCACGGCAGAAGG - Intergenic
1177334375 21:19704284-19704306 TTGCTTCCACTCATGGTAGATGG - Intergenic
1177340012 21:19786137-19786159 CTGCTTCTTCTCATGGCAGAAGG - Intergenic
1178110693 21:29367164-29367186 CTGCTTCCACTCATGGTGGAAGG - Intronic
1178349255 21:31860577-31860599 CTGCTTCCACTCAAGGTGGAAGG + Intergenic
1178851653 21:36217227-36217249 CAGCTTCTCATGAAGTTAGAGGG + Intronic
1179718569 21:43302688-43302710 CTGCGTCCACTCAAGGGAGATGG + Intergenic
1180677358 22:17596489-17596511 CTGCTTCCACTCATGGCAGAAGG - Intronic
1180919412 22:19512917-19512939 CTGCTTCCACTCATGGCAGAAGG + Intronic
1181012042 22:20046984-20047006 AAGCTTCTACTGATGGTGGAAGG + Intronic
1181082380 22:20424029-20424051 CTGCTACTGCGGAAGGTTGAGGG - Intergenic
1181625216 22:24118464-24118486 CTGCTACTACAGTAGGGAGAGGG + Intronic
1182001212 22:26921345-26921367 CTGCTTCCACTCATGGTGGAAGG - Intergenic
1182206239 22:28630152-28630174 CTGCTTCCACTCATGGCAGAAGG - Intronic
1182334569 22:29575123-29575145 CTGCTTCCCCTGGAGGGAGATGG + Intronic
1182497715 22:30721593-30721615 CTGCTTCAAGTGAAGCTTGATGG + Intronic
1183613941 22:38930506-38930528 CTGCTTCCACTCAGGGTAGAAGG + Intergenic
1184440135 22:44506168-44506190 CTGCTTCTGGTGAGGGCAGAAGG - Intergenic
1185283591 22:49988700-49988722 CTGCTTTTACTCATGGCAGAAGG - Intergenic
949768013 3:7548341-7548363 CTGCTTCCACTCAGGGCAGAAGG - Intronic
950307488 3:11927773-11927795 CTGCTTCCACTCATGGCAGAAGG + Intergenic
951229799 3:20165139-20165161 CTGCTTCCACTCATGGTAGAAGG + Intronic
952366808 3:32682144-32682166 CTGCTGATACGGAAAGTAGAGGG + Intergenic
952835930 3:37601906-37601928 CTGATTCTACTCATGGTGGAAGG + Intronic
952911958 3:38198086-38198108 ATGCTCCTACTAAAGGTTGAAGG - Intronic
953356156 3:42257791-42257813 CTGCGTCTACTGAGGGCAAAGGG - Intergenic
953607497 3:44421206-44421228 GTGCTTCCAGGGAAGGTAGATGG + Intergenic
953693398 3:45138964-45138986 CTGCTTCCACTCACGGCAGAGGG + Intronic
954456583 3:50602945-50602967 CTACTTCTCCTGGAGGAAGAGGG + Intergenic
954528415 3:51295243-51295265 CTGCTTCCACTCATGGCAGAAGG + Intronic
955104332 3:55882267-55882289 CTGCTTCCACTTACGGCAGAAGG - Intronic
955385849 3:58479243-58479265 CTGCTTCTACTCATGGCAGAAGG + Intergenic
955456063 3:59123007-59123029 CTGCTTCCACTCATGGCAGAAGG + Intergenic
955857531 3:63289425-63289447 CTGCTTCCACTCATGGCAGAAGG + Intronic
955879224 3:63525972-63525994 CAGCTTCTACTCATGGTAGAAGG + Intronic
955892379 3:63663707-63663729 CTGCTTCCACTCATGGTAGAAGG - Intronic
956339982 3:68211702-68211724 CTGCTTCCACTCATGGCAGAAGG + Intronic
956467165 3:69530461-69530483 CTGTTTCCACTTATGGTAGAAGG - Intronic
956482776 3:69689513-69689535 CTGCTTCCACTTATGGCAGAAGG + Intergenic
956496912 3:69837217-69837239 CCCCTTCTAATGAATGTAGAGGG - Intronic
956524941 3:70148578-70148600 CTGCTTCCACTCATGGCAGAAGG + Intergenic
956586966 3:70875276-70875298 CTGCTTCTACTCATGGCAGAAGG - Intergenic
956694965 3:71910543-71910565 CTGCTTCCACTCATGGCAGAAGG - Intergenic
956717139 3:72088447-72088469 CTGCCTCTACTAAAGATACAAGG + Intergenic
956921991 3:73939551-73939573 CTGCTTCCACTCATGGCAGAAGG - Intergenic
957219753 3:77366697-77366719 CTGCTTCCACTTATGGCAGAAGG + Intronic
957309495 3:78501197-78501219 CTGCTTCCACTCACGGCAGAAGG - Intergenic
957491223 3:80929948-80929970 CTGCTACTACTAAATGTTGATGG - Intergenic
958011853 3:87889157-87889179 CTGCTTCCACTCATGGTAGAAGG - Intergenic
958036092 3:88172140-88172162 TTGCTTCCACTCAAGGCAGAAGG + Intergenic
958720142 3:97833899-97833921 CTGCTTCCACTCATGGTGGAAGG + Intronic
959206529 3:103314261-103314283 CTGCTGCTACTGCAAGTAGCAGG - Intergenic
959216581 3:103457345-103457367 CTGCTTTCACTCATGGTAGAAGG - Intergenic
959394723 3:105823177-105823199 CTGCTTCTACTGAAAATAGATGG + Intronic
959843718 3:111008668-111008690 CTGCTTCTAGTCATGGCAGAAGG - Intergenic
960080994 3:113540081-113540103 CTGCTTCCACTCACGGCAGAAGG + Intronic
960207695 3:114922686-114922708 CTGCTTCCACTCATGGCAGAAGG + Intronic
960514447 3:118588291-118588313 CTGCTTCCACTCATGGTGGAGGG - Intergenic
960524336 3:118692226-118692248 ATGCTTCTACTCATGGTAGAAGG - Intergenic
961479346 3:127169819-127169841 CTGCTTCCACTCATGGCAGAAGG - Intergenic
961927410 3:130495945-130495967 CTGCTACCACTCATGGTAGAAGG + Intergenic
962012020 3:131401110-131401132 CTGCTTCCACTCATGGCAGAAGG + Intergenic
962183397 3:133232414-133232436 CTGCTTCCACTGGTGGTGGAAGG - Intronic
962492078 3:135904077-135904099 CTGCTTCCACTCATGGCAGAAGG + Intergenic
962587821 3:136860592-136860614 CTGCTTCTACTCATGCCAGAAGG + Intergenic
962771198 3:138611815-138611837 TTGCTTCTACTCATGGCAGAAGG - Intronic
963061230 3:141228840-141228862 CTGCTTTTAATGAATGTTGAGGG + Intronic
963834505 3:150043066-150043088 CTGCTTCCACTCATGGCAGAAGG - Intronic
963946146 3:151147519-151147541 CTGCGGCTACTGAAGGCAAATGG - Intronic
964445520 3:156753380-156753402 TTGCTTCTACTCATGGTGGAAGG - Intergenic
966101204 3:176270467-176270489 CTTCATCTACTCAAGGTGGAAGG - Intergenic
966400380 3:179541688-179541710 CTGCTTCCACTCATGGCAGAAGG + Intergenic
966566884 3:181392943-181392965 CTGCTTCCACTCATGGTAGAAGG + Intergenic
966823977 3:183948068-183948090 CTGCTGCTACTGAAGGAGCATGG + Intronic
966970302 3:185039408-185039430 CTGCCTCCACTCAAGGCAGAAGG + Intronic
967071420 3:185965700-185965722 CTGCTTCCACTCACGGTGGAAGG + Intergenic
967115259 3:186331920-186331942 CTGCTTCTACAGATGTTAAATGG - Intronic
967651940 3:191996414-191996436 CTGCTTCCACTCATGGTGGAAGG - Intergenic
970142194 4:12994929-12994951 CTGCTTCCACTCATGGCAGAAGG + Intergenic
970181214 4:13397339-13397361 CAGTTACTTCTGAAGGTAGAAGG + Intronic
970230947 4:13910479-13910501 TTGCTTATACTGAAGTGAGAAGG - Intergenic
970577245 4:17439365-17439387 CTGCTTCTACTCATGGTAGAAGG + Intergenic
970809224 4:20072024-20072046 CTGCTTCCACTCATGGTGGAAGG + Intergenic
972866717 4:43242116-43242138 TTCCTTCTACTAATGGTAGAAGG - Intergenic
972980686 4:44696987-44697009 CTGCCTCTACTGAATGTGGATGG - Intronic
973007618 4:45032206-45032228 ATGCTTCTACTGGAGCTTGAAGG - Intergenic
973026456 4:45279214-45279236 CTGCTTTTAGTGAAGGTTTATGG + Intergenic
973110907 4:46396680-46396702 CTGCTTCCACTCATGGCAGAAGG - Intronic
974223287 4:59003960-59003982 CTACTTCTACTGCATGTATATGG - Intergenic
974353390 4:60779589-60779611 TTTTTTCTACTGAAGCTAGAAGG - Intergenic
974477184 4:62398435-62398457 CTGCTTTCACTTATGGTAGAAGG + Intergenic
974733023 4:65895023-65895045 CTGCTACTGCTGAAGGGAGGTGG + Intergenic
975455509 4:74585490-74585512 CTGCTTCCACTCATGGCAGAAGG - Intergenic
975667127 4:76743114-76743136 GTGCTTCTCCTGAAGGGAAATGG + Intronic
975788437 4:77920693-77920715 CTTCTTCTTCTAAAGGAAGAAGG + Intronic
976826323 4:89264330-89264352 CTGCTTCCACTCATGGTAGAAGG - Intronic
976876006 4:89854577-89854599 CTGCTTCCACTCATGGCAGAAGG + Intergenic
976994046 4:91407641-91407663 CTGCTTCCACTCATGGTAGAAGG + Intronic
977411107 4:96665318-96665340 CTACTTTTACTGGAGGTGGAGGG - Intergenic
977437682 4:97020043-97020065 CTGCTTCCACTCATGGCAGAAGG + Intergenic
977871540 4:102096195-102096217 CTACTTCCACTCATGGTAGAAGG - Intergenic
977941329 4:102862934-102862956 CTGCTTACACTGAGGGCAGAAGG + Intronic
978063819 4:104371410-104371432 CTGCTTCCACTCACGGCAGAAGG + Intergenic
979029153 4:115618384-115618406 CTGCTTCTACTCAGGGTGGAAGG + Intergenic
979335603 4:119457371-119457393 CCACTTCTACTCAAGGTAGGAGG - Intergenic
979446870 4:120824019-120824041 CTCCTTCTACTCATGGTGGAAGG - Intronic
980626696 4:135382085-135382107 CTTCTTCTGGTGAAGGCAGAGGG - Intergenic
981132857 4:141177338-141177360 ATGTTTCTACTGAGGATAGATGG + Intronic
982461819 4:155679439-155679461 CTGCTTCCACTCATGGCAGAAGG + Intronic
982534287 4:156589262-156589284 CTGCTTCTACTCATGATGGAAGG - Intergenic
982660446 4:158200323-158200345 CTGCTTCCACTCATGGCAGAAGG - Intergenic
982694270 4:158581896-158581918 CTGCTTCCACTCATGGCAGAAGG + Intronic
983259038 4:165435027-165435049 CTGCTTCCACTCATGGCAGAAGG - Intronic
984147720 4:176084267-176084289 CTGCCTCCACTCATGGTAGAAGG + Intronic
984208065 4:176811353-176811375 CTGATTCTACAGAAGTAAGAAGG - Intergenic
986121895 5:4847079-4847101 CTGCTTCAAATGAAGGAATAAGG - Intergenic
987228027 5:15863849-15863871 CTGCTTCCACTCATGGTGGAAGG - Intronic
987505759 5:18769373-18769395 CTGCTTCTGCTGATGGCAGAAGG + Intergenic
987666287 5:20945308-20945330 CTGTTTCCACTCATGGTAGAAGG - Intergenic
987975742 5:25012757-25012779 CTGCTTCTGCTCAAGGCAGAAGG + Intergenic
988156529 5:27458854-27458876 CTGCTTCTACTCATGGCAGAAGG + Intergenic
988606558 5:32683605-32683627 CTGCTTCCACTCATGGTGGAAGG - Intergenic
988756389 5:34256757-34256779 CTGCTTCCACTCATGGTAGAAGG + Intergenic
989185867 5:38625472-38625494 CTGCTTCCACTCATGGCAGAAGG + Intergenic
989539904 5:42606432-42606454 CTGTTTCCACTCATGGTAGAAGG + Intronic
989619663 5:43371944-43371966 CTGCTTCCACTAATGGTGGAGGG + Intergenic
990130375 5:52574856-52574878 CTGCTTCTACTAATGGTGGAAGG - Intergenic
990225005 5:53640497-53640519 CTGATTCTACTCATGGCAGAAGG + Intronic
990238497 5:53793700-53793722 TTGCTTCTTCTGAAGCTAGATGG - Intergenic
991116665 5:62963100-62963122 CTGCTTCTACTCATGATAGAAGG + Intergenic
991288618 5:65009092-65009114 CTGCTTCCACTCATGGTAGAAGG + Intronic
991513926 5:67412973-67412995 CGGTTTCTACTGAAGGCATATGG + Intergenic
992000382 5:72430425-72430447 CTGCTTCCACTCATGGTGGAAGG - Intergenic
992353277 5:75953097-75953119 CTGCTTCTACTCATGGCAGAAGG + Intergenic
992947985 5:81828271-81828293 CTGCTTCCACTCATGGCAGAAGG - Intergenic
993338054 5:86686319-86686341 TTGCTTTTACTGAAGGCAGCTGG - Intergenic
993437409 5:87915017-87915039 CTGCTTCCACTCATGGTGGAAGG + Intergenic
994117522 5:96077732-96077754 CTGCTTCCACTCATGGTAGAAGG - Intergenic
994631178 5:102290124-102290146 CTGCTTCCACTCAGGGCAGAAGG + Intronic
994932883 5:106211983-106212005 CTCTTTCTACTGGAAGTAGAAGG - Intergenic
995007421 5:107216862-107216884 CTGCTTCCACTCGTGGTAGAAGG - Intergenic
995205103 5:109470544-109470566 CTGCTTCCACTCATGGCAGAAGG - Intergenic
995242023 5:109896117-109896139 CTGCTTCCACTTATGGTTGAAGG + Intergenic
995463720 5:112429346-112429368 CTCCTTCTACTCATGGTGGAAGG + Intergenic
995467851 5:112469238-112469260 CTGCTTCCACTCATGGCAGATGG + Intergenic
995535402 5:113130759-113130781 CTGCTTCTACTCATGGCAGAAGG - Intronic
995581227 5:113605249-113605271 CTGCTTCCACTCATGGCAGAAGG - Intergenic
996828481 5:127712480-127712502 CTGCTTCCACTAATGGTGGAAGG - Intergenic
1000046155 5:157523597-157523619 CTGCTTCCACTCATGGCAGAAGG - Intronic
1000265417 5:159631719-159631741 CTGCTTCCACTAATGGTAGAAGG + Intergenic
1000610534 5:163368669-163368691 CTGCTTCCACTCATGGTAGAAGG - Intergenic
1000882443 5:166713860-166713882 CTGCTTCCTCTCAAGGCAGAAGG + Intergenic
1001457598 5:171876876-171876898 CTACTTCTACTCATGGCAGAAGG - Intronic
1001879244 5:175228963-175228985 CTGCTTCTACCCATGGCAGAAGG + Intergenic
1002758382 6:182789-182811 CTCCTGCTACTGAAGTTTGAGGG + Intergenic
1002845651 6:942192-942214 CTGCTTCTACTCATGGTGGAGGG + Intergenic
1003063934 6:2886172-2886194 CTGCTTCCACTGATGGCAAAAGG + Intergenic
1003321036 6:5051810-5051832 CTGCTTCCACTCATGGCAGAAGG + Intergenic
1003493851 6:6646824-6646846 CTGATGCTACTGAAGGTCAATGG - Intronic
1003682704 6:8271766-8271788 CTGCTTCCACTCATGGCAGAAGG + Intergenic
1003754539 6:9102023-9102045 CTGCTTCCACTCGAGGCAGAAGG + Intergenic
1004772103 6:18795737-18795759 CTGCTTCCACTCAAGGTAGACGG + Intergenic
1004945417 6:20607099-20607121 CTGCTTTTTCTGAAGGTAGTAGG + Intronic
1005222418 6:23601845-23601867 CTGCTTCCACTCATGGTGGAAGG + Intergenic
1005849073 6:29805404-29805426 CTGCTTCCACTCATGGCAGAAGG - Intergenic
1006110508 6:31741853-31741875 CTGCTTCAACTCATGGAAGAAGG + Intronic
1006666545 6:35698734-35698756 CTGCTTCTAATCATGGCAGAAGG + Intronic
1006938780 6:37737704-37737726 CTGCTTCCACTCATGGTGGAAGG + Intergenic
1006957896 6:37892540-37892562 CTTTTTCTAGTGAAGGTAGAAGG - Intronic
1007083848 6:39128728-39128750 CTGCTTCCACTCATGGTGGAAGG + Intergenic
1007652725 6:43433212-43433234 CTGCTGGTACAGCAGGTAGAGGG - Exonic
1008045207 6:46844777-46844799 CTGCTTCCTTTGCAGGTAGATGG + Intergenic
1009314746 6:62204049-62204071 CTGCTTCCACTCATGGTGGAAGG - Intronic
1010254903 6:73746503-73746525 CTGTTCCTACTCAAAGTAGAAGG - Intronic
1010531881 6:76978434-76978456 CTGCTTCCACTTATGGCAGAGGG - Intergenic
1011013893 6:82733616-82733638 TTGATTCTACTGGAGGGAGATGG + Intergenic
1014021375 6:116594033-116594055 CTGCTTCCACTCATGGTAGAAGG + Exonic
1014687106 6:124515340-124515362 CTGCTTCCACTCATGGCAGAAGG + Intronic
1015104156 6:129516910-129516932 CTTTTTATGCTGAAGGTAGAGGG + Intergenic
1016252330 6:142058983-142059005 ATGCTTCTACTGTAGCTGGAAGG - Intronic
1016309364 6:142716433-142716455 CTGCTTCCACTCATGGTATAAGG - Intergenic
1016836561 6:148483184-148483206 CTGCTTCCACTTATGGTGGAAGG + Intronic
1016848557 6:148593477-148593499 CTGCTTCTGCTGCATGGAGAGGG + Intergenic
1016861689 6:148726514-148726536 CTGCTTCCACTCATGGTGGAAGG + Intergenic
1017065053 6:150520771-150520793 CTGCTTCTACTCATGGCAGAAGG - Intergenic
1018158713 6:161015615-161015637 AAGCTTCCACTCAAGGTAGAAGG + Intronic
1018417658 6:163615076-163615098 CTGCTTCTACTCATGGCTGAAGG - Intergenic
1018436438 6:163763514-163763536 CTGCTTCTATTGAGGATAGGAGG + Intergenic
1019885812 7:3903969-3903991 CTGCTTCCACTCATGGTGGAAGG - Intronic
1020380447 7:7539273-7539295 CTGCTTCTACTCATGGCAGAAGG + Intergenic
1020656244 7:10931052-10931074 CTGCTTCCACTCATGATAGAAGG - Intergenic
1020754761 7:12188988-12189010 CTTCTTCTACTCATGGTGGAAGG - Intergenic
1020881192 7:13764946-13764968 CTGCTTCCACTCATGGCAGAAGG - Intergenic
1021797562 7:24272455-24272477 CTGCTTCTACTCATGGCAGAAGG + Intergenic
1021808539 7:24380109-24380131 CTGCTTCCACTCATGGCAGAAGG - Intergenic
1022260200 7:28696483-28696505 TTTCTTCTACTGAAGTGAGAAGG + Intronic
1022381079 7:29860481-29860503 CTGATTCCACTTATGGTAGAAGG - Intronic
1022512469 7:30949023-30949045 CTGCTTCCACTCATGGCAGAAGG - Intronic
1023005612 7:35862956-35862978 TTGCTTCTACTCGAGGTAGGAGG - Intronic
1023312377 7:38901428-38901450 CTGCTTCTACTCATGGCAGTAGG + Intronic
1023854543 7:44174325-44174347 CTGCTTCCACTCATGGCAGAAGG - Intronic
1024068485 7:45766395-45766417 CCGCTTCTACTCAAGGTAGGAGG + Intergenic
1024466848 7:49720454-49720476 CTGCTTCCACTCATGGTAGAAGG + Intergenic
1024694524 7:51841149-51841171 CTGCTTCTACTAGTGGTGGAAGG + Intergenic
1027290469 7:76703803-76703825 CTGCTTCCACTGATTGTGGAAGG - Intergenic
1027687896 7:81300602-81300624 CTGCTTGTGCTGAAGCTAAAAGG + Intergenic
1028516046 7:91679316-91679338 CTGCTTCCACTAATGGTGGAAGG - Intergenic
1028535389 7:91886034-91886056 CTGCTTCTACTCACAGTAAAAGG + Intergenic
1028700640 7:93775063-93775085 CCCCTTCTGCTGAAGGTAGTGGG - Intronic
1029099236 7:98114634-98114656 CTGCATCTGGTGAAGGGAGACGG + Intronic
1029677366 7:102079654-102079676 CTCCTGCTACTGAAGTTACAGGG - Intronic
1030171054 7:106603250-106603272 CTGCTTCCACTCATGGCAGAAGG + Intergenic
1030359314 7:108579074-108579096 CTGCTTCCACTCATGGCAGAAGG - Intergenic
1033302283 7:140197159-140197181 CTGCTTCCACTCATGGCAGAAGG + Intergenic
1033923363 7:146424388-146424410 CTTCTTCTACTGGAGTCAGACGG + Intronic
1035288410 7:157821153-157821175 CTGCCTCTGCTGAATGTAGGTGG + Intronic
1035724376 8:1815413-1815435 CTGCTTCCACTCACGGTGGAAGG + Intergenic
1036509102 8:9383929-9383951 CTGCTTCCACTCAAGTTGGAAGG - Intergenic
1036720587 8:11171644-11171666 CTGCTTCCACTCATGGCAGAAGG - Intronic
1037186852 8:16074911-16074933 CTACTTCCACTCAAGGAAGAAGG + Intergenic
1037313733 8:17581715-17581737 CTGCTTCCACTCAGGGCAGAGGG - Intronic
1037503415 8:19506782-19506804 CTGCTTCCACTCATGGTGGAAGG - Intronic
1037557871 8:20043034-20043056 CTGCTTCAACTCATGGTGGAAGG - Intergenic
1037717935 8:21415434-21415456 CTGCTTCCACTCAAGGTGGGAGG - Intergenic
1038606261 8:29007976-29007998 CTGCTTTTTCTGATGCTAGAGGG + Intronic
1038701713 8:29855298-29855320 CTGCTTCCACTCATGGTGGAAGG - Intergenic
1038750627 8:30292161-30292183 CTGCCTCTGCTCATGGTAGAAGG + Intergenic
1039111269 8:34042978-34043000 CTGCTTCCACTCATAGTAGAAGG + Intergenic
1039486047 8:37910621-37910643 CTGCTTCCACTCATGGCAGAAGG - Intergenic
1039691335 8:39867925-39867947 CTGCTTCCACTCATGGCAGAAGG + Intergenic
1039830484 8:41209792-41209814 CTGCTTCCACTCATGGCAGAAGG - Intergenic
1040904900 8:52457849-52457871 CTGCTTCTACTCATGGCAGAAGG - Intronic
1043037955 8:75222125-75222147 CTGCTTCCACTCATGGCAGAAGG + Intergenic
1043637350 8:82402901-82402923 TTGCTTTTATTGAAGATAGAAGG + Intergenic
1044459853 8:92430763-92430785 CTGCTTCCACTCATGGCAGACGG - Intergenic
1044748376 8:95393359-95393381 CTGCATATTCTGAAGGTATAAGG - Intergenic
1044801100 8:95957256-95957278 CTGCTTCCACTCATGGTGGAAGG - Intergenic
1046201316 8:110931766-110931788 CTGCTTTTACTCATGGTGGAAGG + Intergenic
1046527870 8:115404435-115404457 CTGCTTCCACTCATGGCAGAAGG - Intergenic
1048217394 8:132508988-132509010 CTGCTTCTACTCATGGTGGAAGG + Intergenic
1048251585 8:132870708-132870730 CTGCTTCCACTCATGGTACAAGG + Intronic
1048355211 8:133648058-133648080 CTGCTTCCACTGATGGTGGAAGG - Intergenic
1048398938 8:134045097-134045119 CTGCCTTTATTGAAGGTAGGTGG + Intergenic
1048521623 8:135160603-135160625 CTGTTTCCACTGAAGTTAAATGG + Intergenic
1048578878 8:135714692-135714714 CTGCTTCCACTCATGGTGGAAGG + Intergenic
1048833919 8:138500384-138500406 CTGGTTCTGCTGCAGGTGGAAGG + Intergenic
1050002717 9:1095672-1095694 CTGCTTCTCTTGAAGGTGTAAGG + Intergenic
1050402992 9:5276231-5276253 CTGCTTCCACTCATGGCAGAAGG - Intergenic
1050459016 9:5861364-5861386 CTCTTTCTACTCAAGGTACAGGG + Intergenic
1050698180 9:8302853-8302875 TTGCTTCTACTCATGGCAGAAGG - Intergenic
1053449660 9:38182422-38182444 CTGCTTCCACTCATGGCAGAAGG + Intergenic
1053652357 9:40181962-40181984 CTGCTTCCTTTGCAGGTAGATGG - Intergenic
1053902753 9:42811274-42811296 CTGCTTCCTTTGCAGGTAGATGG - Intergenic
1054532225 9:66194253-66194275 CTGCTTCCTTTGCAGGTAGATGG + Intergenic
1055434071 9:76274888-76274910 CTGCTTCCACTCATGGTGGAAGG + Intronic
1055595910 9:77864082-77864104 CTGCTTCTGCTCAAGGCAGAAGG + Intronic
1055798061 9:79997680-79997702 CTGCTTCCACTCATGGCAGACGG - Intergenic
1056004276 9:82250484-82250506 CTGCTTCTACTCATGGCAGAAGG - Intergenic
1056861567 9:90189446-90189468 CTGCTTCTATTTATGGCAGAAGG + Intergenic
1056996007 9:91460118-91460140 CTGACTCTACTCAAGGCAGAAGG - Intergenic
1057014274 9:91637129-91637151 CCTCATATACTGAAGGTAGAAGG - Intronic
1057113504 9:92497963-92497985 CTGCTTCCACTCATGGTGGAAGG - Intronic
1058139273 9:101340844-101340866 CGGCTTCCACTCATGGTAGAAGG + Intergenic
1058341639 9:103904603-103904625 CTTCTTCCACTCATGGTAGAAGG - Intergenic
1058910297 9:109514727-109514749 TTCCTTCCACTGGAGGTAGATGG + Intergenic
1059499528 9:114739126-114739148 CTGCTTCTAGGGAAGAGAGATGG + Intergenic
1059938563 9:119335839-119335861 CTGTACCTCCTGAAGGTAGAAGG - Intronic
1060833746 9:126739285-126739307 TTGCTTCTACTCATGGCAGAAGG - Intergenic
1061033098 9:128098703-128098725 CTGCTTCCACTGGCGGTAGGTGG - Intronic
1061830201 9:133287060-133287082 CTGCTTCCACTCAAGGCGGAAGG + Intergenic
1186261889 X:7789009-7789031 CTGCTTATACTCATGGTAGAAGG - Intergenic
1186690886 X:11974393-11974415 CTGCTTCCACTCATGGCAGAAGG - Intergenic
1187034122 X:15519735-15519757 CTGCTTCCACTCATGGCAGAAGG + Intronic
1187103251 X:16216552-16216574 CTGCTTTCACTCAAGGCAGAAGG + Intergenic
1188475726 X:30589608-30589630 CTGCTTCTACTCGTGATAGAAGG + Intergenic
1188558807 X:31444125-31444147 CTGCTTCCACTCATGGCAGAAGG - Intronic
1188803388 X:34558838-34558860 CTGCTTCTACTCATTGCAGAAGG - Intergenic
1188844272 X:35054059-35054081 CTGCTTCCACTTATGGCAGAAGG - Intergenic
1189502754 X:41579003-41579025 CTTGTTCAAATGAAGGTAGACGG + Intronic
1189858739 X:45250840-45250862 CTGCTTCCACTCATGGTAGAAGG + Intergenic
1190032317 X:46986088-46986110 CTGCTTCTACTCATGGTGGAAGG - Intronic
1190605988 X:52143401-52143423 CTGCTTCTACTGAAGGTAGAAGG + Intergenic
1191711918 X:64158849-64158871 CTGCTTCCACTTATGGCAGATGG - Intergenic
1192399704 X:70822745-70822767 CTGCTTCCACTCATGGTAGAAGG + Intronic
1192412347 X:70945124-70945146 CTGCTTCCACTCATGGCAGAAGG - Intergenic
1193326524 X:80184201-80184223 CTGCTTCCACTCATGGTGGAAGG - Intergenic
1193394934 X:80972182-80972204 CTGCTTCCACTCATGGCAGAAGG - Intergenic
1193740696 X:85214236-85214258 CTGCTTCCACTCATGGTAGAAGG + Intergenic
1194465337 X:94228315-94228337 CTGCTTCCACTCATGGTAGAAGG + Intergenic
1195214356 X:102683748-102683770 CTGCTTCTACTCATGGCAGATGG + Intergenic
1196076696 X:111585675-111585697 CTGCTTCTATTCATGGCAGAAGG - Intergenic
1196081000 X:111630872-111630894 CTGCTTCCACTCATGGCAGAAGG - Intergenic
1196343577 X:114625530-114625552 CTGCTTCCACTCATGGTGGAAGG - Intronic
1196776459 X:119342662-119342684 CTGCTTCCACTCATGGTGGAAGG + Intergenic
1196780862 X:119382980-119383002 GTGCTTCCACTCATGGTAGAAGG - Intergenic
1197831653 X:130649149-130649171 CTGCTTCCACTCATGGCAGAAGG - Intronic
1198522353 X:137465674-137465696 CTGTTTCTACTGAATGCATATGG + Intergenic
1198984334 X:142431895-142431917 CTGCTTCCACTCATGGTAGAAGG - Intergenic
1199733424 X:150660756-150660778 CTGCTTCCACTCATGGCAGAAGG + Intronic
1199741563 X:150740779-150740801 CTGCTTCCACTCATGGTGGAAGG + Intronic
1201224806 Y:11808373-11808395 CTGCTTCTACTCATGGTGGAAGG - Intergenic
1201351649 Y:13050031-13050053 CTGCTTCCACTCATGGCAGAAGG - Intergenic