ID: 1190610175

View in Genome Browser
Species Human (GRCh38)
Location X:52185398-52185420
Sequence CCCCGCCCGGACCTAGCCAA AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 79
Summary {0: 2, 1: 0, 2: 2, 3: 6, 4: 69}

Found 8 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1190610164_1190610175 14 Left 1190610164 X:52185361-52185383 CCGCCTCTAGTGCTCGAGTCTGA 0: 2
1: 0
2: 0
3: 4
4: 56
Right 1190610175 X:52185398-52185420 CCCCGCCCGGACCTAGCCAAAGG 0: 2
1: 0
2: 2
3: 6
4: 69
1190610162_1190610175 23 Left 1190610162 X:52185352-52185374 CCACTCCATCCGCCTCTAGTGCT 0: 2
1: 0
2: 0
3: 12
4: 187
Right 1190610175 X:52185398-52185420 CCCCGCCCGGACCTAGCCAAAGG 0: 2
1: 0
2: 2
3: 6
4: 69
1190610163_1190610175 18 Left 1190610163 X:52185357-52185379 CCATCCGCCTCTAGTGCTCGAGT 0: 2
1: 0
2: 0
3: 3
4: 73
Right 1190610175 X:52185398-52185420 CCCCGCCCGGACCTAGCCAAAGG 0: 2
1: 0
2: 2
3: 6
4: 69
1190610165_1190610175 11 Left 1190610165 X:52185364-52185386 CCTCTAGTGCTCGAGTCTGAGCC 0: 2
1: 0
2: 1
3: 2
4: 59
Right 1190610175 X:52185398-52185420 CCCCGCCCGGACCTAGCCAAAGG 0: 2
1: 0
2: 2
3: 6
4: 69
1190610167_1190610175 -10 Left 1190610167 X:52185385-52185407 CCCCACCTAGGCCCCCCGCCCGG 0: 2
1: 0
2: 0
3: 26
4: 311
Right 1190610175 X:52185398-52185420 CCCCGCCCGGACCTAGCCAAAGG 0: 2
1: 0
2: 2
3: 6
4: 69
1190610159_1190610175 26 Left 1190610159 X:52185349-52185371 CCCCCACTCCATCCGCCTCTAGT 0: 2
1: 0
2: 0
3: 16
4: 174
Right 1190610175 X:52185398-52185420 CCCCGCCCGGACCTAGCCAAAGG 0: 2
1: 0
2: 2
3: 6
4: 69
1190610160_1190610175 25 Left 1190610160 X:52185350-52185372 CCCCACTCCATCCGCCTCTAGTG 0: 2
1: 0
2: 1
3: 16
4: 129
Right 1190610175 X:52185398-52185420 CCCCGCCCGGACCTAGCCAAAGG 0: 2
1: 0
2: 2
3: 6
4: 69
1190610161_1190610175 24 Left 1190610161 X:52185351-52185373 CCCACTCCATCCGCCTCTAGTGC 0: 2
1: 0
2: 0
3: 6
4: 132
Right 1190610175 X:52185398-52185420 CCCCGCCCGGACCTAGCCAAAGG 0: 2
1: 0
2: 2
3: 6
4: 69

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1190610175 Original CRISPR CCCCGCCCGGACCTAGCCAA AGG Intronic
900140552 1:1137812-1137834 CCGCCCCAGGACCCAGCCAAGGG - Intergenic
900314485 1:2050254-2050276 CCCCGCCCGCGCCTCGCCATTGG + Intergenic
901686946 1:10948345-10948367 GCCCGCCAGGGCCTCGCCAATGG + Exonic
902218023 1:14946955-14946977 TCCCGCCCGGAGCTAGACACGGG + Intronic
903930602 1:26859867-26859889 CCAAGCCAGGACTTAGCCAAAGG - Intergenic
905442780 1:38005561-38005583 CCCCGCCCGGACCCCGCCCCCGG + Intronic
906246994 1:44283278-44283300 CCCAGCCCTGGCCTAGCCACTGG + Intronic
915593587 1:156884091-156884113 CCCCGCCCTGACATACCCCAGGG + Intergenic
920103197 1:203531240-203531262 ACCCGCCCAGAGCTAGCCCAGGG + Intergenic
923278042 1:232415538-232415560 CCCCTCCCGGACACAGCCACAGG - Exonic
1062774647 10:135355-135377 CCCCGCCCGGACCCCGCCGCCGG - Intronic
1067093230 10:43282283-43282305 CCCCACCCGGACCTATTCAAAGG + Intergenic
1069602478 10:69716912-69716934 CCCTGCACGGTCCCAGCCAAAGG + Intergenic
1074424377 10:113338221-113338243 CCCCACCCCTACCCAGCCAAGGG - Intergenic
1076978959 11:195275-195297 CCCCGCCCTGACCTAGCCCATGG - Intronic
1083656886 11:64234317-64234339 CCCGGCCCCGGCCTCGCCAAGGG + Intergenic
1084124283 11:67088695-67088717 CCACGCCCGGACCAGGACAAAGG + Intergenic
1089660102 11:119980180-119980202 CCCCACCCGGAACAAGGCAAGGG - Intergenic
1090334834 11:125955226-125955248 CCAGGCCCTGACCTATCCAAAGG + Intergenic
1096367357 12:51040024-51040046 CCGCGCCCAGCCCTGGCCAAGGG - Intergenic
1098840066 12:75467344-75467366 GCCCTCCCTGCCCTAGCCAAGGG - Intergenic
1107604001 13:42040729-42040751 CCCCGCCCGGGGCCAGCCACCGG - Intronic
1113943384 13:114029991-114030013 CCCCGCCCTGCCCTGGCCAATGG + Intronic
1119219147 14:72892750-72892772 CCCCGCCCGGACGAAGCCGCAGG - Intronic
1125671783 15:41478891-41478913 CCCAGCCAGGCCCTAGCTAAGGG - Intronic
1125674680 15:41495666-41495688 CCGCCCCCCGACCTAGGCAAGGG - Intronic
1128438422 15:67679094-67679116 CCCAGCCAGATCCTAGCCAAGGG + Intronic
1128455556 15:67829603-67829625 CCCCGATCCGGCCTAGCCAAAGG - Intronic
1131676156 15:94672777-94672799 CCCTGCCCCGACCTGGCCACAGG - Intergenic
1132778841 16:1612223-1612245 GCCCGCCCAGCGCTAGCCAATGG + Intergenic
1132932936 16:2468019-2468041 CCCCGCCTGGACCTGGCCCAGGG + Intergenic
1132975099 16:2707045-2707067 CCCCTCCCAGACCCACCCAAAGG - Intronic
1140458249 16:75116806-75116828 CCCACCCCTGGCCTAGCCAATGG - Intergenic
1142466449 17:140093-140115 CCCCGCCCTGACCTAGCCCATGG - Intergenic
1143059201 17:4185847-4185869 CCCCGCCCGGACCTAAGCCCCGG + Intronic
1143434566 17:6914164-6914186 CCACGCCTGGCCCTGGCCAAGGG - Intronic
1146445316 17:32928175-32928197 CCGCGCCCGGACTTTGCCATCGG + Exonic
1147760423 17:42794647-42794669 CCCCTCCCAGACCCATCCAATGG + Exonic
1152632677 17:81417557-81417579 CCCCCCCCCGCCCTAGCCAAAGG + Intronic
1161578356 19:5067144-5067166 CCCCGCCCAGACATACCCCAGGG + Intronic
1162798706 19:13099487-13099509 CCCCTCCCGGGCCTCGCAAACGG - Exonic
1162817690 19:13206392-13206414 CCCAGGCAGCACCTAGCCAAGGG + Intergenic
1163584410 19:18156130-18156152 CCCGGCCCGGCCCTCGCCCACGG + Exonic
1164039996 19:21485807-21485829 CCCTGCCCTGGCCTAGCCCATGG + Intronic
1168337753 19:55605846-55605868 TCCCGCCGGGCCCTTGCCAAGGG + Intronic
925311240 2:2883755-2883777 CCCCCACCGCACCCAGCCAATGG + Intergenic
926010208 2:9400925-9400947 CCCCGCCCTGCCCCAGCCAGGGG - Intronic
927276000 2:21262903-21262925 TCCCTCCCAGACCTAGCCCAAGG - Intergenic
927647349 2:24886455-24886477 CTCCACCCGGACCTTGCAAAGGG + Intronic
1173246273 20:41340030-41340052 CCCGGCCCGGGCCTTGCCCAAGG + Intergenic
1176429473 21:6567152-6567174 CCCTGCCAAGGCCTAGCCAAAGG - Intergenic
1178719538 21:34996181-34996203 CACCGCCCTGACCTATCCCAGGG + Intronic
1179704867 21:43174614-43174636 CCCTGCCAAGGCCTAGCCAAAGG - Intergenic
1181056972 22:20264914-20264936 CCCCGCCCGGCCCTGGCACAGGG - Intronic
1184765521 22:46570150-46570172 CCCCGCCAGGCCCTAGGCTAGGG - Intergenic
954778858 3:53045315-53045337 CCCCGCCCGGAGCGAGCCCGGGG + Intronic
961508740 3:127388476-127388498 CCCAGCCTGGGCCTGGCCAAGGG + Intergenic
979514086 4:121586971-121586993 CCATGCCCGGATCTAGCCATAGG - Intergenic
984878593 4:184390958-184390980 CACAGCCCGGCCCTGGCCAAGGG - Intronic
1002339201 5:178503886-178503908 TCCCCTCCGGACCTAGCCCAGGG - Intronic
1002838784 6:887930-887952 CAGCACCAGGACCTAGCCAAGGG + Intergenic
1003040733 6:2685256-2685278 CCCCTCCCTGACCTCCCCAAGGG - Intronic
1003898269 6:10628728-10628750 CCACGCCCGGCCCAAGCCAGAGG - Exonic
1013156042 6:107491283-107491305 CCCCGCCCGCACCTCACCACTGG + Intronic
1027233018 7:76282879-76282901 GCCCGCCCGGACCGGGCCGACGG + Intronic
1049169938 8:141153571-141153593 CCCTGGCCGGGCCCAGCCAACGG - Intronic
1057550665 9:96049319-96049341 CCCCGCCCCACCCGAGCCAAAGG + Intergenic
1060596011 9:124849406-124849428 CCCCACCCGGACCTTTCCTAAGG + Intergenic
1061162263 9:128902212-128902234 CCCCCGCTGGACCTAGCCAAGGG + Intronic
1062042027 9:134408599-134408621 CCTTGCCCAGACCCAGCCAAGGG - Intronic
1062288913 9:135785943-135785965 CCCTGCCCGGGCCTGGTCAAGGG - Intronic
1062395032 9:136349411-136349433 CCTCTCCCGGCCCCAGCCAAGGG + Intronic
1186337387 X:8605216-8605238 CCCCTCCCTAACCTGGCCAAAGG + Intronic
1189349704 X:40267306-40267328 CCTAGCCCGGAGCCAGCCAAAGG - Intergenic
1190598649 X:52068675-52068697 CCCCGCCCGGACCTAGCCAAAGG - Intronic
1190610175 X:52185398-52185420 CCCCGCCCGGACCTAGCCAAAGG + Intronic
1191103804 X:56759921-56759943 CCCAGCTTGGACCCAGCCAATGG + Intergenic
1198005521 X:132489487-132489509 CCCCGCCCGGCCTTTGCCAAAGG + Intronic
1198110850 X:133501604-133501626 CCCCGCCCAGAGTGAGCCAAGGG + Intergenic