ID: 1190616446

View in Genome Browser
Species Human (GRCh38)
Location X:52238542-52238564
Sequence TGAGCTTCTTGGACCCATGT GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 116
Summary {0: 1, 1: 0, 2: 1, 3: 10, 4: 104}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1190616443_1190616446 -7 Left 1190616443 X:52238526-52238548 CCTGTTTGATGTTTTCTGAGCTT 0: 1
1: 5
2: 39
3: 172
4: 564
Right 1190616446 X:52238542-52238564 TGAGCTTCTTGGACCCATGTGGG 0: 1
1: 0
2: 1
3: 10
4: 104

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1190616446 Original CRISPR TGAGCTTCTTGGACCCATGT GGG Intergenic
904224025 1:28999673-28999695 TGAGCTTCTAGGGCCCACGTTGG + Intronic
913659300 1:120992478-120992500 TGAGCTTCTCGGACCCCTAATGG - Intergenic
913666796 1:121056341-121056363 TGACCTTACTGGTCCCATGTTGG + Intergenic
914010663 1:143775602-143775624 TGAGCTTCTTGGACCCCTAATGG - Intergenic
914018540 1:143843777-143843799 TGACCTTACTGGTCCCATGTTGG + Intergenic
914167163 1:145185513-145185535 TGAGCTTCTCGGACCCCTAATGG + Intergenic
914649286 1:149684259-149684281 TGAGCTTCTCGGACCCCTAATGG - Intergenic
914657095 1:149751980-149752002 TGACCTTACTGGTCCCATGTTGG + Intergenic
914675939 1:149907582-149907604 TGAGATCCCTGGACCCCTGTGGG - Intronic
914945268 1:152059976-152059998 TGAGCTTCTGGACCCTATGTTGG + Intergenic
916313739 1:163425043-163425065 TGAGTTTCTTGGACACATAAGGG - Intergenic
917480647 1:175408924-175408946 TGAGATCCTTGGAGCAATGTGGG + Intronic
922548319 1:226474971-226474993 TGAGCTTGCTGGACTCATGTTGG + Intergenic
922981435 1:229830284-229830306 TGAGCTCCTTGCACTAATGTAGG - Intergenic
923735645 1:236604476-236604498 TGGGCTCCTTGGTACCATGTGGG - Exonic
1066005529 10:31143323-31143345 TGAGCTTCTTTGAACCAAGCTGG + Intergenic
1067985229 10:51136316-51136338 TGAGCTTCAGGTACCTATGTAGG + Intronic
1068876696 10:62004462-62004484 TGAGCTTGTAAGACCAATGTGGG + Intronic
1078184034 11:9036461-9036483 TGAGCTCCTTAGAGCCATGAAGG - Intronic
1078577617 11:12515373-12515395 TGAGCTTCATGTACTCTTGTAGG + Intronic
1081886328 11:46499983-46500005 TAAGCTTCTTGGATCTTTGTTGG - Intronic
1082808562 11:57464837-57464859 CGAGTTTCTTAGACCCACGTGGG - Intronic
1083835230 11:65262229-65262251 TGGGCTTCTTGGGCGCAGGTCGG + Exonic
1083994180 11:66264063-66264085 TGAGCTGCTTGGCCACATCTGGG - Exonic
1085629955 11:78106628-78106650 TGAGATTCTTGGACCCATGAAGG - Intronic
1086130194 11:83393378-83393400 TTTGCATCATGGACCCATGTGGG + Intergenic
1086425953 11:86682546-86682568 TGAGGGTCTTGCACCCATGAGGG + Intergenic
1087156932 11:94913990-94914012 AGAGGTTCTTGCAGCCATGTAGG + Intergenic
1089447884 11:118568121-118568143 TGAGCTTCTGAGATCCAAGTTGG + Intronic
1092150142 12:6242275-6242297 TAAGCTTCTTGGGCACAAGTTGG + Intergenic
1093198860 12:16162685-16162707 TCAGCTTCTTGGATATATGTTGG - Intergenic
1093718320 12:22409372-22409394 TGAGCTTCTTGAAAACATGATGG + Intronic
1095542825 12:43330412-43330434 TGGGCCTCTAGAACCCATGTGGG - Intergenic
1095709369 12:45271732-45271754 TGAGCTTCCTGGCCACTTGTAGG - Intronic
1098574449 12:72025120-72025142 TGATAGTCCTGGACCCATGTAGG + Intronic
1099523381 12:83690641-83690663 TGAGCTTCTTGATAGCATGTTGG + Intergenic
1108136858 13:47373790-47373812 TGTGGGTCTTGGCCCCATGTGGG + Intergenic
1110304581 13:73970508-73970530 TGAGCTTCCTCGAGCCATTTTGG + Intronic
1112473251 13:99708482-99708504 TTAGCCCCTTGGACCCATGAGGG + Intronic
1113146754 13:107216494-107216516 TGAGCTTCTTGATCCCTTGTGGG + Intronic
1113947051 13:114050236-114050258 TGGGCTTCATGGAGCCTTGTCGG - Intronic
1115155449 14:30333756-30333778 TGAGCTTTTTTGACCCATACAGG - Intergenic
1115390385 14:32847756-32847778 GGACCTTCTTAGGCCCATGTTGG - Intergenic
1121242808 14:92442123-92442145 TGAGCTTCCTGCAGCCATGAAGG - Exonic
1121993687 14:98585081-98585103 TGAGATTCTGGGACACATGCTGG + Intergenic
1122071925 14:99210568-99210590 TGAGCTGCTTGGGCTCCTGTGGG - Intronic
1122359281 14:101150137-101150159 TGAGCTCCTTGGATCCAGGTGGG - Intergenic
1124244912 15:28060426-28060448 TAATCTTCTTGCACCCTTGTGGG + Intronic
1125246288 15:37645007-37645029 GTAGCTTCTTGGACCAATGCAGG - Intergenic
1126113011 15:45186712-45186734 TCAGCTGCTTAGCCCCATGTGGG + Intronic
1130230887 15:82095809-82095831 AGAGCTCCTTGGACTCATCTTGG - Intergenic
1131226159 15:90625967-90625989 GGAGCTTCTTATACCCAGGTGGG - Exonic
1131885047 15:96903541-96903563 TGAGCTTCTTAGACTATTGTTGG - Intergenic
1132973766 16:2701498-2701520 TTAGCTGCTTGGGCCCATGCCGG + Intronic
1135431265 16:22385563-22385585 TGGGCTTGTTGGACACAGGTGGG - Intronic
1138680576 16:58680959-58680981 AGCTCTTCTTGGAGCCATGTAGG + Intronic
1139125235 16:64069856-64069878 TGTGCTTGTTGGCCACATGTAGG + Intergenic
1147494772 17:40905267-40905289 TGAGCTTCTTGCCCCCATTCGGG - Intergenic
1148404611 17:47399510-47399532 TGAGCTTCTCTGACCAAAGTGGG + Intronic
1154290154 18:13099308-13099330 TGAACTTGTGGGAGCCATGTGGG + Intronic
1158393859 18:57064587-57064609 TGTGGTTCTTGGAGCCATCTTGG + Intergenic
1159889871 18:73943380-73943402 TGAGCTTCCTGGACCCTCATGGG + Intergenic
1161535749 19:4817687-4817709 AGAGCTTGCTGGGCCCATGTGGG + Exonic
1166782407 19:45349446-45349468 TGAGCTGCTTGGCCACATCTGGG - Exonic
1168307439 19:55443061-55443083 TGAGCTGCGTGGGCCCAAGTTGG + Intergenic
926191793 2:10733885-10733907 TCAGCTCCATGGAACCATGTGGG - Intronic
926679171 2:15650920-15650942 TCACCTTCTTGTGCCCATGTAGG + Intergenic
927421288 2:22933825-22933847 TGAGCTTCTTAGCGCCCTGTAGG - Intergenic
928265124 2:29804718-29804740 TCTGTTTCTTAGACCCATGTTGG + Intronic
930303891 2:49653271-49653293 TCAGCTACTTGTCCCCATGTAGG + Intergenic
936728264 2:115349175-115349197 TGATCTTATTGGACTCATGTTGG + Intronic
947652603 2:231799577-231799599 TTAGCTTCTTGGACAGATGTAGG + Intronic
948654542 2:239468688-239468710 TGAGCACCTTGGTCCTATGTGGG + Intergenic
1170515573 20:17126452-17126474 TGAACTTCTTGGATTGATGTAGG + Intergenic
1173643887 20:44621871-44621893 GGAGGTTCTTGGAGGCATGTGGG - Intronic
1179019388 21:37624681-37624703 TGAGGTGCTTGCCCCCATGTGGG - Exonic
1179667917 21:42925251-42925273 TAGCCTTCTTGGACCCATGTTGG + Intergenic
1181492440 22:23268977-23268999 TGTGCTCTGTGGACCCATGTGGG + Intronic
950719248 3:14870730-14870752 TGAGCTTCTTGGTGCCCTTTAGG + Intronic
951243831 3:20317288-20317310 TCAGCTTCTAGGACCCTTCTGGG + Intergenic
952856381 3:37774064-37774086 AGAACTTCTTGAATCCATGTTGG + Intronic
953046449 3:39297605-39297627 TGATCTGCCTGGACCCATGGAGG - Intergenic
956293376 3:67685555-67685577 TGAGCTTCTTTTTCCCATGGAGG + Intergenic
964119978 3:153173441-153173463 TGAGCTTCTTTCACCCAGGCTGG + Intergenic
966258714 3:177949959-177949981 AAAGCTTCTTGAAACCATGTGGG - Intergenic
967555635 3:190854544-190854566 TGTTCTTCTTGGAGTCATGTTGG + Exonic
970737482 4:19191446-19191468 TGAGCTACATGGATCCATGCAGG + Intergenic
972253114 4:37326220-37326242 TGTGCTTCTTGGACCCTTCCTGG + Intronic
974218634 4:58934874-58934896 TGCAGGTCTTGGACCCATGTGGG - Intergenic
976326351 4:83776155-83776177 TGAGCTTCCTGAACCCGTGAAGG + Intergenic
978032049 4:103947311-103947333 TGACCACCTTGGACACATGTTGG + Intergenic
980017149 4:127662797-127662819 TAATCTTCTTAGAGCCATGTTGG + Intronic
983914492 4:173277450-173277472 TGAGCTTCTGGAACTCTTGTTGG - Intronic
989998101 5:50859703-50859725 TGAGGTCCATGGACCCATGTTGG + Intergenic
990329153 5:54708185-54708207 TCAGCTGCTGGGAGCCATGTGGG - Intergenic
991636187 5:68708274-68708296 TGTGCTTCATGGGCCCATATAGG + Intergenic
1004004745 6:11628432-11628454 GGACCCTCTTGGACCCAGGTTGG + Intergenic
1004308050 6:14518988-14519010 TGCGTTTCTTGGTCCCATGGGGG - Intergenic
1005233834 6:23736703-23736725 TGAGCCTCTTGGCCCCCTTTGGG + Intergenic
1007310192 6:40939269-40939291 TGAGCCTCTGGGCCCCATGAGGG - Intergenic
1015898319 6:138038520-138038542 TGAGCTTCTTGGAGCAAAATTGG - Intergenic
1017502099 6:155035035-155035057 AAAGCTTCGTGGACCCATATAGG - Intronic
1018572392 6:165225075-165225097 TGAGCTTTTTGGATCCATTCAGG + Intergenic
1018739555 6:166717044-166717066 TGGGCTGCTGGGACACATGTGGG + Intronic
1019951715 7:4378478-4378500 TGAGCTTCCTGGAAGCATGGTGG + Intergenic
1022333081 7:29398406-29398428 TGAGCTTCTTGGAGGCGTGGAGG + Exonic
1024263185 7:47587112-47587134 AGACCTTCCTGGAGCCATGTGGG + Intergenic
1029480138 7:100807317-100807339 TGAGCTTCTTAGGGCCAGGTGGG - Intronic
1031868876 7:127070567-127070589 TGAGCTTCTGGGACACATCATGG - Intronic
1037094014 8:14961310-14961332 TGAACTTCTTGGAAACATCTTGG + Intronic
1044323331 8:90831130-90831152 TGAGCTTCTAGTAACCATCTTGG - Intronic
1055189774 9:73503730-73503752 TGTACTTCTTGGACACTTGTTGG + Intergenic
1056778437 9:89531584-89531606 GAAGCTTCCTGGACCCATGAGGG - Intergenic
1189464311 X:41266758-41266780 TGAGCTGCGTGGACTCATGATGG - Intergenic
1190616446 X:52238542-52238564 TGAGCTTCTTGGACCCATGTGGG + Intergenic
1196758666 X:119180050-119180072 TCAGCTTCTTGGACCTCTGTCGG - Intergenic