ID: 1190617667

View in Genome Browser
Species Human (GRCh38)
Location X:52252833-52252855
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 1187
Summary {0: 1, 1: 15, 2: 126, 3: 412, 4: 633}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1190617667 Original CRISPR ACAAATGTACTACTCTGGGG GGG (reversed) Intergenic
900079675 1:846485-846507 ACAAATGCATCACTCTGGTGGGG + Intergenic
901750142 1:11401514-11401536 ACAAATGCACCACTCTGATGGGG - Intergenic
902424923 1:16312706-16312728 ACACATGTACCACTCTGGTGGGG + Intronic
903727732 1:25463955-25463977 ACAAATGTACCACTCTGGTGGGG - Intronic
904327867 1:29739194-29739216 ACAAATGGACTCCTATGGGTGGG - Intergenic
904521328 1:31098389-31098411 ACAAATGTACCACTCTGATGGGG - Intergenic
905020019 1:34803217-34803239 ACAAATGTACCTCTCTGGTGGGG - Intronic
905578778 1:39067483-39067505 ACAAATGTACCACTGTAGTGTGG - Intergenic
906452758 1:45965838-45965860 ACAAATGTAGCACTCTGGTAGGG - Intronic
906806373 1:48782719-48782741 ACAGATATACCACTCTGGTGGGG - Intronic
907149373 1:52269043-52269065 ACAAGTGTACCACTCTGGTAGGG - Intronic
907170291 1:52456904-52456926 AAAAATGTACCACTCTGGTGGGG + Intronic
907669747 1:56464109-56464131 ACAAATGAACTCATCTGGGTGGG + Intergenic
908279227 1:62513012-62513034 ACAAATGCACTACTCTGATGGGG + Intronic
908585893 1:65567860-65567882 ACAAATGTACCACTCTGAGGGGG - Intronic
908608430 1:65826711-65826733 AAAAATGTTCTACTCTGGGAAGG + Intronic
908793722 1:67810449-67810471 ATAAATGTACCACTCTGGTGTGG + Intronic
908846924 1:68334145-68334167 AGGAATGTACTCCTCTGGTGGGG - Intergenic
908917288 1:69143463-69143485 ACAAATGAACCACTCTGGTGGGG + Intergenic
909111592 1:71485387-71485409 ACAAATGTACCACTCTGGTGGGG - Intronic
909162740 1:72174286-72174308 GCAAATGCACCACTCTGGTGGGG - Intronic
909186317 1:72491061-72491083 ACAAATGTACAGCTCTGATGAGG + Intergenic
909279029 1:73725221-73725243 ACTATTGGACTACTCAGGGGTGG + Intergenic
909509165 1:76431782-76431804 ACAAATGTACCACTCTGGGCGGG - Intronic
909529182 1:76662454-76662476 ACAAATGTACCATTCTGGTAGGG + Intergenic
909768918 1:79395174-79395196 GCAAATGTACTACTTTGGTGGGG + Intergenic
910067013 1:83166303-83166325 ACAAAAGTATCACTCTGGTGAGG - Intergenic
910084848 1:83387978-83388000 ACAAATTTGATACTCTGGTGAGG + Intergenic
910097427 1:83539346-83539368 ACAAATGTACCACTCTGGTGGGG + Intergenic
910732143 1:90409689-90409711 GCAAAGGTACCACTCTGGTGGGG - Intergenic
910978409 1:92932973-92932995 ACATATGTACCACTCTGGTGAGG + Intronic
911234392 1:95395524-95395546 AGAAATGTACTACCCAGGAGTGG + Intergenic
911295941 1:96114958-96114980 ACAAATGTACCATGCTGGTGAGG + Intergenic
911390625 1:97236790-97236812 ACAAATGTATCACTCTAGTGGGG + Intronic
911425530 1:97706366-97706388 TCAAATGTACCACTATGGAGAGG - Intronic
911723384 1:101215546-101215568 ACAAGTGTGCCACTCTGGTGTGG + Intergenic
911813738 1:102315808-102315830 ACAAATGTACCACTCTTGTGAGG + Intergenic
911970562 1:104430254-104430276 ACAAATGTATTACTCTGATGAGG + Intergenic
912086184 1:106007967-106007989 ACAAAAGTACTACTGTGGTAAGG + Intergenic
912330791 1:108818406-108818428 ACTAATGAAATACTCTGGGCAGG + Intronic
912367577 1:109147651-109147673 ACGAATGTACCACTCTGGTGGGG + Intronic
912660662 1:111526627-111526649 ATAAATGTACCACTGTGGTGGGG - Intronic
912997402 1:114544626-114544648 ACAAATATACCACTCTGGTGTGG - Intergenic
913092690 1:115490282-115490304 ACAAATGTACCACTCTGATGTGG + Intergenic
913204551 1:116525016-116525038 AAAAATGTACCACTCTGGTGAGG - Intronic
913236979 1:116793684-116793706 ACGAATGTACCACTCTGGTGGGG - Intergenic
913240897 1:116828333-116828355 ACAAATGTACCACTCTGGTGGGG + Intergenic
913462835 1:119106265-119106287 ACAAATGTACCACTATGGTGTGG - Intronic
913571137 1:120121044-120121066 AAAAATGTACCACTCTGTGTGGG - Intergenic
914243139 1:145866100-145866122 ACAAATAAACCACTCTGGTGAGG + Intergenic
914291947 1:146282022-146282044 AAAAATGTACCACTCTGTGTGGG - Intergenic
914395198 1:147260108-147260130 ACAACTGTGCCACTCTGGTGGGG - Intronic
914552991 1:148732805-148732827 AAAAATGTACCACTCTGTGTGGG - Intergenic
914993991 1:152524306-152524328 ACAAATGTACCACTCTGGTGGGG - Intronic
915527404 1:156484592-156484614 ACAAATGACATACACTGGGGAGG + Intronic
915803680 1:158821262-158821284 ACAAATGTACCCCTCTGGTGGGG - Intergenic
915982784 1:160431918-160431940 ACAAATGTACCACTCTGGTGGGG + Intergenic
916004202 1:160644944-160644966 ACAAATGTACCATCCTGGTGGGG + Intronic
916332994 1:163639106-163639128 ACAAATGCACCACTCTGGTGGGG - Intergenic
916602745 1:166308810-166308832 AAAAATGTACCACTGTGGTGTGG - Intergenic
916837378 1:168561063-168561085 ACAAATGCACCACTCTGGTAAGG + Intergenic
916949063 1:169760293-169760315 ATAAATGTACCACTCTGGTGCGG - Intronic
917063150 1:171062915-171062937 ATAAATGTACTACTCTGGTGGGG - Intronic
917554332 1:176068016-176068038 CAAAATGTACCACTCTGGTGGGG + Intronic
917616361 1:176749396-176749418 ACAAATGTACCACTCTGGTGGGG - Intronic
917875683 1:179285001-179285023 ACAAATGTACCAGTCAGGTGGGG + Intergenic
917993049 1:180403078-180403100 ACATATGTACTCCTCTGTGTAGG - Intronic
918241779 1:182626624-182626646 ACAAATGTACCCCTCTGCTGGGG - Intergenic
918334862 1:183498708-183498730 ACAAATGTACCACTCTGGTGGGG - Intronic
918534822 1:185562241-185562263 ACAACTGTACCACTCTGGTGGGG + Intergenic
918557613 1:185822247-185822269 ACAAATGTACCACTCTGGTGGGG + Intronic
918646540 1:186912260-186912282 ACAAATGTACCACTCTGGTGTGG - Intronic
918650153 1:186952514-186952536 ACAAATGTACCACTCTGGTGTGG - Intronic
918833932 1:189435265-189435287 ACAAATGTACAACTCCAGTGAGG + Intergenic
918950991 1:191137285-191137307 ACAAATGTAACACTCTGGTGGGG + Intergenic
919039930 1:192372807-192372829 ACAAATATACTACTCTGTTGGGG + Intergenic
919153292 1:193727806-193727828 AACCATGTACCACTCTGGGGGGG + Intergenic
919261851 1:195206978-195207000 ACAAATGTGCTACTCTAGTGAGG - Intergenic
919563659 1:199156945-199156967 ACAAATGTATCACTCTGTTGTGG + Intergenic
919633474 1:199981634-199981656 ACAAATGTACCACTCTGGTGGGG - Intergenic
920507747 1:206528600-206528622 ACAAATGTACCACTCTGGTGGGG + Intronic
921093015 1:211860713-211860735 ACAAATGTACTACTTTGGTGTGG - Intergenic
921243521 1:213212031-213212053 ATAAATGTACCACTCTGGTGGGG - Intronic
921254091 1:213323817-213323839 AAAAATGTATCACTCTGGTGGGG - Intergenic
921289508 1:213644320-213644342 ACAAATGTACCTCTCTGGTGGGG - Intergenic
921582494 1:216911634-216911656 ACAAATGTACCACTCTGGTAGGG + Intronic
921587723 1:216967191-216967213 GCAAATGTACCCCTCTGGTGGGG - Intronic
921826636 1:219679348-219679370 ACAAATGTACCACTCTGGTAGGG + Intergenic
921914768 1:220595042-220595064 ACAAATGTACCTCTCTGGTTTGG + Intronic
922181324 1:223235310-223235332 ACAAATGCACCACTCTGGTGGGG - Intronic
922862538 1:228831374-228831396 ACACGTGTCCTCCTCTGGGGAGG + Intergenic
922948300 1:229536044-229536066 TCAAATGTACCACTCTGCGGGGG + Intronic
923022903 1:230178719-230178741 ACAAATGTACCACTCTGTTGGGG - Intronic
923085503 1:230700514-230700536 AGAAATGGACCACTCTGGGTGGG + Intergenic
923417028 1:233772960-233772982 ACAAATGTACCATTCTGGTGGGG - Intergenic
923456004 1:234166265-234166287 ACAAATGGACCGCTCTGGTGGGG - Intronic
923649473 1:235860298-235860320 ACAAATGTACCAGTTTAGGGGGG - Intronic
923827670 1:237517742-237517764 ATAAATGTACCACTCTGTTGAGG - Intronic
923940755 1:238823113-238823135 ACAAATGTATCACTCTAGTGGGG + Intergenic
924124485 1:240836121-240836143 ACAAATGTACCGCTCTGGTGGGG + Intronic
924138944 1:241002018-241002040 ACAAATGTACTACTCTGGTTGGG + Intronic
924240852 1:242038892-242038914 ACAAATGTACTACTCTGGTGGGG - Intergenic
924451864 1:244185827-244185849 ACAAATGTACCATTCTGGTCTGG + Intergenic
924932245 1:248742145-248742167 AAAAATGTACCTCTCTGGTGGGG + Intronic
1062778327 10:175143-175165 ACAAATGTATTGCTCTGGTGTGG + Intronic
1063631049 10:7734245-7734267 ACAAATGCACCACTCTGATGTGG + Intronic
1063650994 10:7936632-7936654 ATAAATGTGCCACTCTGGTGGGG - Intronic
1064789933 10:18946021-18946043 ATAAATGTACTACCCTAGTGGGG - Intergenic
1064889215 10:20150046-20150068 ACAAATGTACCATTCTGGTGGGG - Intronic
1064933814 10:20657493-20657515 ACAAATACACTACTCTGGTTGGG - Intergenic
1064994137 10:21281622-21281644 ACAAATGTCCCACACTGGTGTGG - Intergenic
1065360643 10:24886176-24886198 ACAAATGTTCAACTCTGGCAGGG + Intronic
1065554159 10:26897575-26897597 ACAATTGCAATTCTCTGGGGAGG - Intergenic
1065602951 10:27388357-27388379 ACAAAAGTACCACTCTAGTGTGG - Intergenic
1065613587 10:27497827-27497849 ACAAATATAACACTCTGAGGGGG - Intergenic
1065818637 10:29505717-29505739 GCAAATGTGCCACTCTGGAGGGG + Intronic
1065954283 10:30678679-30678701 GCAAATGTGCCACTCTGGAGGGG - Intergenic
1066343038 10:34555156-34555178 ACAAATGTTCCACTGTGGTGGGG + Intronic
1066518707 10:36192599-36192621 ACAAATGTACCACTCTGGTGGGG - Intergenic
1066626758 10:37415077-37415099 ACAAATGCACCACTCTGGTGGGG + Intergenic
1067070454 10:43127077-43127099 ATAAATATACAAATCTGGGGAGG + Intronic
1067347977 10:45451656-45451678 ATAAATGCACCACTGTGGGGGGG + Intergenic
1067865768 10:49904505-49904527 GCAAATGAACCACTCTGGTGGGG + Intronic
1067899729 10:50226580-50226602 AGGAATGTACTACTCTGGTTGGG + Intronic
1068590914 10:58852208-58852230 AGAAATGTACCACTCTGGTGAGG + Intergenic
1068696613 10:59974622-59974644 GGAAATGTACCACTCTGGTGGGG - Intergenic
1069098884 10:64293378-64293400 GTAAATGTACAACTCTGGTGGGG - Intergenic
1069127556 10:64655172-64655194 GCAAATGTACTATTCTGGTGAGG - Intergenic
1069299553 10:66889412-66889434 ACAAGTGTACCACTCTGGTAGGG + Intronic
1069796539 10:71056277-71056299 ACAAATGTACCACTCTGGAGTGG + Intergenic
1070204300 10:74241326-74241348 TCAAATGTACCACTCTGGTGGGG - Intronic
1070412863 10:76160065-76160087 ACAATTGTGCCACTCTGGTGGGG + Intronic
1070852590 10:79579239-79579261 CTAAATGTACTAATCTGGTGGGG + Intergenic
1071056090 10:81509591-81509613 ACAAATGTACCATTCTGGTTAGG - Intergenic
1071093607 10:81948304-81948326 TCAAATGAACCACTCTGGTGAGG - Intronic
1071221977 10:83478110-83478132 ACAAATGTACCACTCTTTGCTGG - Intergenic
1071850288 10:89561805-89561827 ACAAATGTACTACTCAGGTGGGG + Intergenic
1071910129 10:90222222-90222244 ACAAATGTATCACTCTGGTGGGG - Intergenic
1071984223 10:91034705-91034727 ACACATGCACTGCTCTGGTGGGG + Intergenic
1072079032 10:92009713-92009735 ACAAAAGTACTTCTGTGGAGAGG - Intronic
1072173306 10:92889425-92889447 AAAAATCTACTACTGTGGTGAGG - Intronic
1072262113 10:93688544-93688566 ACAAATGTACCCCTCTGGTGTGG + Intronic
1072528123 10:96292758-96292780 ACAAATGTACCACTCTGGTGGGG - Intergenic
1072622095 10:97086947-97086969 ACAAATGTACGGCTCTGGTGGGG + Intronic
1072942265 10:99776732-99776754 ACAAATGTACCACTCTGGTGGGG - Intergenic
1073723927 10:106207985-106208007 ACAAATGTACCACTCTCATGGGG - Intergenic
1073728608 10:106265032-106265054 ACAAATGTACTACTCTGGTGTGG + Intergenic
1074054473 10:109909903-109909925 ACAAATGTACTACTCTGGTTGGG - Intronic
1074150148 10:110751994-110752016 ACAAAAGTACCAGTCTGGTGGGG - Intronic
1074821259 10:117180600-117180622 ACAAATGTACCACTCAAGTGTGG - Intergenic
1075107114 10:119547561-119547583 ACAAAGGTACCTCTCTGGTGTGG - Intergenic
1075329461 10:121562823-121562845 ACAGATGTACCATTCTGGTGGGG + Intronic
1075447431 10:122523478-122523500 ACTAATGTACCACTCTGGTGAGG + Intergenic
1075496900 10:122929336-122929358 ACAAATGTACCACTCTAGTGAGG + Intergenic
1076014259 10:127015236-127015258 ACAGATGTATTACTCAGGGTAGG - Intronic
1076575712 10:131465379-131465401 ACAAATGCCCCACTCTGGGAGGG - Intergenic
1077576176 11:3385570-3385592 AGCAATGTACTGCTCTGGTGTGG - Intergenic
1078947645 11:16088243-16088265 ACAAATATACCACTCAGGTGGGG - Intronic
1079501619 11:21107095-21107117 ACAAATGTTCCACTCAGGTGAGG - Intronic
1080395218 11:31883642-31883664 ACAAATGGACTACTCTGGTGGGG + Intronic
1080631650 11:34082605-34082627 ACAAATGTACCACTCTGGTTGGG - Intronic
1081129498 11:39361066-39361088 CCAAATGTACGACTTTGGTGAGG - Intergenic
1081349487 11:42032443-42032465 AGAAATGAACTACTCTTAGGAGG + Intergenic
1081704717 11:45175088-45175110 ACAAATGTTCCACTTTGGTGTGG - Intronic
1081839949 11:46192862-46192884 ATAAATGTACCACTCTGGTGTGG + Intergenic
1081880909 11:46450912-46450934 GCAAATGTACCACACTGGTGTGG + Intronic
1082721925 11:56688777-56688799 ATAAATGTAACACTCTGGTGGGG + Intergenic
1083093848 11:60229074-60229096 ACAAATGTCCCACTCTGGTGGGG + Intronic
1083594034 11:63910595-63910617 AAAAATGTACAACTCAGGTGAGG - Exonic
1084283443 11:68115431-68115453 ACAAATGTCCCATTCTGGTGGGG + Intronic
1084646013 11:70458532-70458554 AGAAATGGACCACTCTGGTGGGG - Intergenic
1084924201 11:72498855-72498877 ACAAATGTACCACTCTGGTGGGG - Intergenic
1084991260 11:72927429-72927451 ACAAATGTGCCACTCTGATGGGG + Intronic
1085113673 11:73911079-73911101 ATAAATGTACCACTCTGGTGGGG - Intronic
1085452840 11:76646856-76646878 ACAAATGTTCTACTCTTCTGTGG + Intergenic
1085753402 11:79183589-79183611 ACAAATGTACCACTCTGGTTTGG + Intronic
1085938377 11:81178317-81178339 ACAGATGTACCACTCTGGTAGGG - Intergenic
1086066737 11:82753669-82753691 GCAAATGCACCACTCTGGTGGGG + Intergenic
1086073233 11:82821917-82821939 ACAAATGCACAACTCTCAGGTGG - Intergenic
1086246097 11:84754828-84754850 ACAAATTTACCATTCTGGTGGGG + Intronic
1086266223 11:85001802-85001824 ACAAATGTACCACTCAGGTGAGG + Intronic
1086361316 11:86062594-86062616 ACAAATGTACCACTTTCGTGGGG + Intronic
1086392255 11:86376755-86376777 ACACATGTACCACTCCGGTGAGG - Intronic
1087073133 11:94101555-94101577 ACAAATGTACTACTCTGGTGGGG - Intronic
1087097655 11:94335128-94335150 ACAAATGTATCACTCTGGTGGGG - Intergenic
1087803799 11:102533872-102533894 ACAAATGTACCTCTCTGGTGAGG + Intergenic
1087987559 11:104703480-104703502 ACAAATGGACCACTCTGGTGGGG - Intergenic
1088110534 11:106256038-106256060 AAAAATGTACCACTCTGGTGAGG + Intergenic
1088207692 11:107413165-107413187 ACAAATGTACTCCTCTGGTAGGG + Intronic
1088445139 11:109918246-109918268 ACAAATGTACAACCGTGGTGGGG - Intergenic
1088704122 11:112446245-112446267 ACAAATGTACCACTCTGGTGAGG - Intergenic
1088929751 11:114339794-114339816 GCAAATGCACCACTCTGGTGGGG + Intergenic
1089223217 11:116893245-116893267 ACAAACATACCACTCTGGTGGGG + Intronic
1089394630 11:118128293-118128315 ACCCATGTACCACTCTGGTGGGG - Intergenic
1089438979 11:118498676-118498698 ACAAATGCACCACTCTGGTGGGG - Intronic
1090615670 11:128512538-128512560 ACAAATGTACTGGGCTGTGGCGG - Intronic
1090683473 11:129087777-129087799 ACAAATGTACCACTGTGGTGTGG + Intronic
1090921731 11:131212486-131212508 ACAAATGTGCCACTCTGGTGGGG - Intergenic
1091464614 12:673100-673122 ACAAATGTACCACTCTGGTGTGG - Intergenic
1092908742 12:13126111-13126133 ACAAATGTATCACTCTGGCTTGG - Intronic
1093073363 12:14731137-14731159 ACAAATGTATGACTCTGGTGTGG - Intergenic
1093301008 12:17454977-17454999 AGAACTGTACTACTTTGGGGAGG - Intergenic
1093540956 12:20284319-20284341 ACAAATGGCCCACTCTGGTGGGG - Intergenic
1093925572 12:24905060-24905082 ACAAAAGAACTTCTCTGAGGAGG + Intronic
1094311168 12:29085636-29085658 ACAAATGGACTGCTCTGGTGTGG + Intergenic
1095325780 12:40890296-40890318 ACAACTGTACCACTTTGGTGCGG - Intronic
1095521999 12:43077662-43077684 ACAAATGTACCACTCTGGTGGGG + Intergenic
1095825736 12:46529582-46529604 ACAAATGTACCACTCTGCTGGGG + Intergenic
1095862463 12:46933291-46933313 ACAAATGTACCACCCTGGTGGGG + Intergenic
1096564343 12:52464946-52464968 ACAAATGTACCACTCTGGTGGGG + Intergenic
1096625240 12:52891293-52891315 ACAAATGTATCCCTCTGAGGTGG + Intergenic
1096625245 12:52891334-52891356 ACAAATGTAGCCCTCTGGTGTGG + Intergenic
1096891080 12:54771976-54771998 ACAAATGCACCACTCTAGTGGGG - Intergenic
1097034528 12:56114535-56114557 ACAAATGTACCACTCTGGCAGGG + Intergenic
1097765243 12:63518867-63518889 ACAAATGTTCCACTCTGATGTGG - Intergenic
1097912388 12:64984455-64984477 ACAAATGTACCTCTCTGGTGGGG + Intergenic
1098069363 12:66655430-66655452 ACAAATGTACCACACTGGTGTGG - Intronic
1098285283 12:68900994-68901016 ACAAATGTACCACTCTGGTGGGG + Intronic
1098373152 12:69781327-69781349 AGAAATGTACCACTCTGGTAGGG - Intronic
1098488202 12:71046148-71046170 ACAAATACACAACTCTGGGCTGG + Intergenic
1098656665 12:73039606-73039628 GCAAATGTAGAAGTCTGGGGTGG - Intergenic
1098833220 12:75388827-75388849 GTAAATGTACTACTCTGTTGTGG + Intronic
1099242399 12:80153501-80153523 ACAAATGTGCCACTCTGGTGGGG - Intergenic
1099527799 12:83736788-83736810 ACAAATGTACCACTCTGGTAAGG + Intergenic
1099572101 12:84335536-84335558 ACAATTGTACCACTCTGGTGGGG + Intergenic
1099783186 12:87226761-87226783 ACACATGTAGTACTCTGACGTGG + Intergenic
1100076429 12:90790167-90790189 ACAGATGTACCACTCTGGTGGGG + Intergenic
1100082818 12:90873982-90874004 ACAAATGTACCACTCTGGTGGGG + Intergenic
1100141751 12:91627325-91627347 ACAAATGTACTTCTCTGGTGAGG - Intergenic
1100258778 12:92911675-92911697 ACAAATGTACCACTCTAGTGGGG + Intronic
1100610951 12:96192162-96192184 ACAAAGGTACCACTCTGGTGGGG - Intergenic
1100697246 12:97108449-97108471 ACAAAAGTACCACTGTGTGGGGG + Intergenic
1100852826 12:98731268-98731290 ACAAATGCACATCTCTGGTGGGG - Intronic
1100879245 12:98997775-98997797 ACAAATGTAGCTCTCTGAGGTGG - Intronic
1100911757 12:99372170-99372192 ACACATGTACCACTCTAGTGGGG + Intronic
1100925080 12:99536266-99536288 ACAAATGTAGCACTCTGGTGGGG + Intronic
1101053724 12:100890743-100890765 ATAATTGTACCACTCTGGTGTGG - Intronic
1101279002 12:103231257-103231279 ATAAATGTACCACTCTGGTGGGG - Intergenic
1101356906 12:103987727-103987749 GCCAATTAACTACTCTGGGGTGG + Exonic
1101649441 12:106661494-106661516 ACAAATGTACTACTCTGGTGAGG - Intronic
1101821338 12:108186310-108186332 ACAAAGGGACCACTCTGGTGCGG - Intronic
1102480033 12:113216577-113216599 ACAAATGCACCACTCTGGTGGGG + Intronic
1102971007 12:117166382-117166404 ACAAATGCACTGCTCTGGTGAGG + Intronic
1102982427 12:117252600-117252622 ACAAACGCACCACTCTGGTGTGG + Intronic
1103171301 12:118822468-118822490 ACAAATGAACTAGATTGGGGAGG - Intergenic
1103227532 12:119301008-119301030 ACAAATGGACCACTCTGTGTGGG - Intergenic
1103238789 12:119397086-119397108 AGAAATGAACAACTCTGGAGGGG - Intronic
1103364809 12:120374094-120374116 ACAAATGTACCACTCTGGTGGGG - Intergenic
1103404460 12:120665598-120665620 ACAAATGCACCACTCTGTGTGGG + Intronic
1104148953 12:126063459-126063481 ACAAATGTGTCACTCTGGTGAGG - Intergenic
1104236269 12:126940516-126940538 ACAAACGAACCACTCTGGTGAGG + Intergenic
1104260794 12:127180299-127180321 ACAAGTAGACTACTCTGGTGAGG - Intergenic
1105269964 13:18863782-18863804 ACAAATGTACCACACTCTGGTGG + Intergenic
1105464158 13:20621694-20621716 ACAAATGTACCATACTGGGATGG - Intronic
1105815231 13:24030131-24030153 ACAAATGCACCACGCTGTGGGGG - Intronic
1106300179 13:28457041-28457063 ACAAATGTACCATTCTGGTGGGG + Intronic
1106771270 13:32962917-32962939 ATGAATGTACCACTCTGGTGGGG - Intergenic
1106970155 13:35130104-35130126 ACAAATGTACCACTCTGGTGAGG + Intronic
1107431842 13:40347343-40347365 TCAAATGTACTGCTCTGGTGTGG + Intergenic
1107628984 13:42323784-42323806 ACAAATGTCCCACTCTGTTGTGG - Intergenic
1107961154 13:45560413-45560435 ACAAATGTACCACTCTCAGGTGG - Intronic
1108075157 13:46671871-46671893 ACAAATGAACCACTCTGGTGGGG - Intronic
1108097217 13:46915722-46915744 AATAATGTACCACTCTGGTGGGG - Intergenic
1108103382 13:46982478-46982500 ACAAATGTACCACACGGGTGGGG - Intergenic
1108243225 13:48488594-48488616 ACAAATGCACCACTCTGGTGGGG + Intergenic
1108316123 13:49239334-49239356 ACAAATGCACCACTCTGGTGGGG + Intergenic
1108457163 13:50628033-50628055 ACAAATGTACCACCCTCGTGGGG + Intronic
1108552797 13:51563436-51563458 ACAAATGTACCACTGTGGTGGGG + Intergenic
1109501518 13:63241936-63241958 ACAAATATACTACTCTGGTGGGG + Intergenic
1110202963 13:72874876-72874898 ACAAATGTAGCACTCTGGTGGGG - Intronic
1110247649 13:73344462-73344484 ACAAAGTTACTACTGTGGGTAGG + Intergenic
1110458604 13:75718591-75718613 ACCAATGTACCCCTCTGGTGGGG - Intronic
1110534630 13:76637101-76637123 ACAAATGTAGCACCCTGGTGGGG - Intergenic
1110542935 13:76726433-76726455 ACAAATGTACCAATCTGGTGGGG - Intergenic
1110624604 13:77638812-77638834 ACAAACTTGCTACTCTGGGAGGG - Intronic
1110753440 13:79143123-79143145 ACAAATGTCCCACTCAGGTGTGG - Intergenic
1110782283 13:79480701-79480723 ACACATGTACCACTCTGAGGGGG + Intergenic
1110873502 13:80480417-80480439 CCAAGTGTACCACTCTGGTGGGG - Intergenic
1110939607 13:81332369-81332391 ACAAACATACTGCTCTGGTGGGG + Intergenic
1111454466 13:88462235-88462257 ACAAATGTAGCACTTTGGTGTGG - Intergenic
1111594346 13:90391392-90391414 ACAAATGTACTGCTGTGGAGTGG + Intergenic
1111599964 13:90460402-90460424 TCAACTGTACCACTCTGGTGGGG - Intergenic
1111603646 13:90507214-90507236 ACAAATGTACTATTATAGAGGGG + Intergenic
1111620020 13:90713325-90713347 ACAAATGTGCCACTCAGGTGGGG + Intergenic
1111729741 13:92058458-92058480 AAAAATGTACCACTCTGGTGTGG - Intronic
1111872792 13:93854982-93855004 ACACATGTGCCACTCTGGTGGGG - Intronic
1112407012 13:99130197-99130219 GCAAATGTACCACTCTGGTAGGG + Intergenic
1112500424 13:99938938-99938960 ACAAATGCCCCACTCTGGTGGGG + Intergenic
1112627142 13:101118120-101118142 ACAAATGTACCACTCTGATGGGG + Intronic
1112681425 13:101769998-101770020 ACAAATGCACCACTCTGGTGGGG + Intronic
1112732321 13:102378239-102378261 ACAAATGCACCACTCCGGTGTGG + Intronic
1112833329 13:103480218-103480240 ATAAATGTACCACTCTGGTGGGG + Intergenic
1113183650 13:107660816-107660838 ACAAATGGACCACTCTGATGAGG + Intronic
1113237594 13:108297765-108297787 ACAAATGTATCACTCTGGTGGGG - Intronic
1113237627 13:108298157-108298179 ATAAATGTATCACTCTGGTGGGG + Intronic
1113279295 13:108771444-108771466 ACAAATGAACTACTCTGGTGGGG - Intronic
1113971284 13:114192269-114192291 ACAAACATACCACTCTGGAGGGG + Intergenic
1114239424 14:20852630-20852652 ACAACTGTATCACTCTGGTGGGG + Intergenic
1114293065 14:21304694-21304716 ACAAATGCACCACTCTGGTACGG - Intronic
1114568747 14:23651015-23651037 ACAAATTAACTTCTCTGGAGTGG - Intergenic
1114752176 14:25217386-25217408 ACATATGTACCACTCTGTTGGGG + Intergenic
1114819699 14:26003614-26003636 ATACATGTACCACTCTGGTGTGG + Intergenic
1114846055 14:26323390-26323412 ACAAATGCACCACTCTGGTGAGG - Intergenic
1115064898 14:29246261-29246283 ACAAATGTACTACTGTGGTGTGG - Intergenic
1115093855 14:29611187-29611209 ACAAATGTACCACTGTGGTGGGG + Intronic
1115330972 14:32197816-32197838 ACTAATGTACTACTTTGTAGGGG + Intergenic
1115733024 14:36292475-36292497 ACACATGTACCACTCTGATGAGG - Intergenic
1115776635 14:36722473-36722495 ACAAATGGACTGCTCTGATGGGG + Intronic
1115793657 14:36908260-36908282 ACAAATGTACTACTCCGGTATGG + Intronic
1116034282 14:39609483-39609505 ACAAATGCACTCTTCTGTGGAGG + Intergenic
1116315564 14:43386998-43387020 AAAAATGTACCATTCTGGTGGGG + Intergenic
1116465101 14:45222694-45222716 ACATATGTACAACTCCTGGGTGG + Intronic
1116574966 14:46562035-46562057 ATAAATGTACCACTCTGGTTGGG + Intergenic
1116686924 14:48051776-48051798 ACAAATGTGTTACTCTGTTGTGG + Intergenic
1116839943 14:49809939-49809961 ACAAATGTACCGTTCTGGTGGGG + Intronic
1117017895 14:51536979-51537001 ACCAATGTACCACTCTGGTGGGG - Intronic
1117226371 14:53664510-53664532 ACAAATATACCACTCTGCTGGGG + Intergenic
1117421700 14:55553003-55553025 ACAAGTGTACTACTCTGGTATGG + Intergenic
1117651360 14:57909233-57909255 ACAAATATACCACTATGGGGTGG - Intronic
1117698614 14:58391614-58391636 ACAAATGTATCACTCAGGTGAGG + Intergenic
1117769258 14:59116336-59116358 ATAAATGTACCACTCTGGAAGGG + Intergenic
1117801909 14:59453272-59453294 ACAAATGTACCTCTCTGGTGGGG + Intronic
1118066166 14:62193079-62193101 ACAAATGCACCACTCTGCTGGGG - Intergenic
1118131721 14:62973049-62973071 ACAGATGTACCACTCTGGTGTGG + Intronic
1118304321 14:64642032-64642054 ACAAAAGTACCACTCTGGTGTGG - Intergenic
1118608402 14:67520136-67520158 ACAAATATACGACTCTGGTGGGG - Intronic
1118717018 14:68567433-68567455 ACAAATGTACCACTCTGGTGTGG - Intronic
1119028949 14:71176435-71176457 ACATATGTACCAGTCTGGTGGGG - Intergenic
1119160387 14:72447355-72447377 ACAACTCTACTAGTCTGGTGAGG - Intronic
1119303440 14:73589037-73589059 ACAAATGTACCATTCTGGTGGGG - Intergenic
1119630001 14:76222022-76222044 ACAAATGTATCACTCTGGTGAGG + Intronic
1120011733 14:79423213-79423235 ACATATCAACTACTCTGGGTTGG + Intronic
1120118293 14:80646236-80646258 ACTAATGTACCACTTTGGTGGGG + Intronic
1120515897 14:85469784-85469806 ATAAATGTATCACTCTGGTGGGG + Intergenic
1120554640 14:85914623-85914645 ACAAGTGTACCACTCTGATGGGG - Intergenic
1120658498 14:87224809-87224831 ACAAATGTACCACCCTGGTGGGG + Intergenic
1120753774 14:88222587-88222609 ACAAATGTACCAGTCTGGTGCGG + Intronic
1120837512 14:89054743-89054765 ACAAATGTACCACTCTGGCGGGG + Intergenic
1120952567 14:90055629-90055651 ACAAATGTACCGCTCTGTTGGGG + Intergenic
1121150529 14:91629562-91629584 ACAAATGTACCACTTTGGTGTGG + Intronic
1121561195 14:94877253-94877275 ACAAATGTTCCACTCTGGCCTGG - Intergenic
1122892130 14:104737040-104737062 ACAAATGCACCGCTCTGGTGGGG - Intronic
1202829405 14_GL000009v2_random:10183-10205 ACAAATGGACCACTCTCTGGTGG - Intergenic
1202894454 14_KI270722v1_random:190894-190916 ACAAAGGTACTACTATGGTGGGG - Intergenic
1123482901 15:20651043-20651065 ACAAATATACTACTCTGGTGAGG - Intergenic
1123969957 15:25498810-25498832 ACAAATGTACCATCCTGGTGGGG + Intergenic
1123972775 15:25524450-25524472 ACAAATGTGCTGCTCTGGTAGGG + Intergenic
1124166601 15:27331750-27331772 ACAAATGGACCACTCTGGTGGGG + Intronic
1124530996 15:30506428-30506450 ACAAATGTACCACTCTGGTGTGG + Intergenic
1124681109 15:31731742-31731764 ACAACTGGACCACTCTGGTGGGG + Intronic
1124713623 15:32035874-32035896 ACAAATATACTACTCTAGTGGGG - Intronic
1124767659 15:32501267-32501289 ACAAATGTACCACTCTGGTGTGG - Intergenic
1125060339 15:35413025-35413047 ACAAATGTACAACTCTAGCAGGG + Intronic
1125119912 15:36143536-36143558 ACAAATGTACCACTCTGATATGG + Intergenic
1125194182 15:37027890-37027912 ACAAATGTGCTACTCCGGTAGGG - Intronic
1125330766 15:38580080-38580102 ACAAATGCACCAGTCTGGTGGGG + Intergenic
1125991162 15:44109593-44109615 ACAAATGTACCACCGTAGGGTGG - Intronic
1126017421 15:44365879-44365901 ACAAATGTACCACTTTGGTAGGG + Intronic
1126279682 15:46930388-46930410 ACAATTGTACCATTCTGGTGGGG - Intergenic
1126408343 15:48345947-48345969 ACAAATATACCACCCTGGTGGGG - Intergenic
1126596257 15:50386983-50387005 ACAAATGTACCGCTCTGGTGGGG + Intergenic
1126632735 15:50754224-50754246 ACAAATGTACCACTCTGCTGTGG - Intronic
1126981253 15:54246259-54246281 ACATATAGACTACACTGGGGAGG - Intronic
1127068035 15:55260969-55260991 ACAAACGTACCACTCTGGTATGG + Intronic
1127373542 15:58361891-58361913 ACAAATGTACCACTCTAGTGTGG + Intronic
1127565638 15:60185452-60185474 ACAAATGTACCACTCTGTGCAGG + Intergenic
1127641741 15:60922359-60922381 ACAAATGTGCCACTCTGGTGGGG + Intronic
1128023176 15:64411350-64411372 ACAAATGTACCACTCTGGTGAGG + Intronic
1128546120 15:68569089-68569111 ACAAATGTACCACTTTGGTGGGG - Intergenic
1128739698 15:70075239-70075261 ACAAATGTACCACTCTGGTGAGG + Intronic
1129632613 15:77278048-77278070 GCAAATGTACCATTCTGGTGGGG + Intronic
1130041527 15:80409025-80409047 ACACATGTACTACTCTGCTGGGG - Intronic
1130194656 15:81768160-81768182 ACAAATGTACCATTCTGGTGGGG + Intergenic
1130249196 15:82285883-82285905 ACAAATGTACCACTCTGGCTGGG + Intergenic
1130276452 15:82478877-82478899 AGAAATTTACTAGTTTGGGGGGG + Intergenic
1130449839 15:84040276-84040298 ACAAATGTACCATTCTGGTGGGG - Intergenic
1130450813 15:84049992-84050014 ACAAATGTACCACTCTGGCTGGG - Intergenic
1130475193 15:84259811-84259833 AGAAATTTACTAGTTTGGGGGGG - Intergenic
1130482609 15:84373864-84373886 AGAAATTTACTAGTTTGGGGGGG - Intergenic
1130736164 15:86552177-86552199 ACAAACCTACCACTCTGGTGAGG + Intronic
1130807973 15:87347002-87347024 AATAATGTATTATTCTGGGGAGG + Intergenic
1130878963 15:88038577-88038599 ACAAATGCACCACTCTGCGGAGG + Intronic
1131235647 15:90694507-90694529 ATAAATGTAGCACTCTGGTGGGG - Intergenic
1131451574 15:92544652-92544674 ACACATATACCACTCTGGTGAGG + Intergenic
1131790269 15:95957244-95957266 ACAAATGTACCACTCTGATGAGG + Intergenic
1131795515 15:96012046-96012068 ACAAATGTACCCCTTTGGTGGGG - Intergenic
1132123162 15:99195769-99195791 ACAAATGTATGACTCTGGTGAGG + Intronic
1132208272 15:100001566-100001588 ACGAATGTAGCACTCTGGCGGGG + Intronic
1132401764 15:101513498-101513520 ACAAATGTACCACCATGGTGGGG - Intronic
1134009109 16:10838217-10838239 ACAAATGTTCCACTCTGGAGAGG + Intergenic
1134396652 16:13871323-13871345 ACAAATGAACCACTCTGGGCCGG + Intergenic
1135351097 16:21729447-21729469 ACAAATGTACAACTTTGGTGGGG - Intronic
1135433627 16:22409050-22409072 ACAAAGGTAACACTCTGGTGGGG - Intronic
1135449574 16:22545574-22545596 ACAAATGTACAACTTTGGGGGGG - Intergenic
1135529012 16:23236632-23236654 ACTAATGTACCACTCTGGTGGGG + Intergenic
1135662018 16:24305152-24305174 ACAAATGTGCCATTCTGGTGGGG + Intronic
1135778212 16:25275774-25275796 ACAACTGTACCACTCTGGTGGGG + Intergenic
1135847894 16:25935268-25935290 ACCAACGTACCACTCTGGTGGGG - Intronic
1137238641 16:46636252-46636274 ACAAATGTATCACTCTGGTGGGG + Intergenic
1137426052 16:48381898-48381920 ACAAACGTACCACTTTGGCGGGG + Intronic
1137692620 16:50440144-50440166 GCAAATGTACCACTCTGGTGGGG + Intergenic
1138398413 16:56725840-56725862 AGAAATGTACCACTCTGGTGGGG - Intronic
1138671911 16:58622315-58622337 AAAAATGTACCACTCTAGTGGGG + Intronic
1138841493 16:60513870-60513892 ACAAATATACTACTCTGGTATGG - Intergenic
1138897129 16:61220471-61220493 ACAATTGTACCACTCTTGTGGGG + Intergenic
1138978527 16:62238526-62238548 ACAAATGTACCACTTTGATGAGG + Intergenic
1138983743 16:62301532-62301554 ATAAATGTACCACTCTGGTGTGG - Intergenic
1139121793 16:64027783-64027805 ACAAATGTACCACTCGGGTGGGG - Intergenic
1139837481 16:69850913-69850935 ACAAATGTACCACTCTGGTGGGG - Intronic
1140314073 16:73876902-73876924 GCAAATGTACAACTCTGCGTGGG - Intergenic
1140998769 16:80288185-80288207 ACAAAGGTACCACTTTGGTGGGG + Intergenic
1141284273 16:82656527-82656549 ACAAATGTACCATTCTGATGTGG - Intronic
1141336488 16:83160228-83160250 TCAAATGTACCACTCTGGTGGGG + Intronic
1142785498 17:2218866-2218888 ACAAATGTCCCACTCTGGTGTGG + Intronic
1144008541 17:11123469-11123491 AGCAATGTGCTACTCTTGGGAGG + Intergenic
1144018370 17:11218957-11218979 ACATATGTACTACTCAAGCGTGG + Intergenic
1144102038 17:11950185-11950207 AGAAAAGTACCACTCTGGTGGGG - Intronic
1144102802 17:11958609-11958631 ACAAAGGTACCGCTCTGGTGGGG + Intronic
1144679937 17:17186558-17186580 AAAAATCTACTTCTCTGAGGTGG + Exonic
1148023172 17:44567023-44567045 AAAAAAGTACTCCTCTGGTGAGG - Intergenic
1148222664 17:45874902-45874924 AGAAATGTACCACTCTGGTGGGG - Intergenic
1148387790 17:47247393-47247415 GCAAATGTACCACTCTGGTGGGG + Intergenic
1148617633 17:49013229-49013251 ACAAATGTCCTACTCTGCATGGG + Intronic
1149146657 17:53501836-53501858 ACAAATTTACAACCCTGGAGGGG - Intergenic
1149391372 17:56194779-56194801 ACAAATGCACCACTCTGGTGAGG + Intronic
1149725855 17:58893651-58893673 ACAAATGTACCACTCTGTTATGG + Intronic
1149780174 17:59391282-59391304 ACAAATGTTCTAATCTGGTGTGG + Intronic
1149938504 17:60836133-60836155 ACAAATGTACCACTCTAGTGGGG - Intronic
1149961790 17:61117810-61117832 GCAAATATACTACTCTGGTGGGG - Intronic
1149999367 17:61423905-61423927 ACAAATGTACCCCTCTGGTTGGG + Intergenic
1150680981 17:67284306-67284328 ACAAAGGTACCACTCGGGCGGGG + Intergenic
1150688195 17:67337684-67337706 AAAAATGTGCCACTCTGTGGGGG + Intergenic
1150865848 17:68849345-68849367 ACAAATGGGCCACTCTGGTGGGG + Intergenic
1150878573 17:68997748-68997770 ACAAATGTACTGCTTTGTTGGGG - Intronic
1151516039 17:74596533-74596555 ACAGATGTCCCACTCTGGTGGGG - Intergenic
1151753998 17:76060715-76060737 ACAAATGCACCCCTCTGGTGGGG + Intronic
1151835966 17:76583077-76583099 AAAAATGTATTACTCGGGGCTGG + Intronic
1153152385 18:2110113-2110135 ACAAATGTACCACTCTTGGCTGG + Intergenic
1153169469 18:2299285-2299307 ACAGATGTACCACTCTGGTGAGG + Intergenic
1153444177 18:5153847-5153869 ACAAATGAACCACTCTGTGGGGG + Intronic
1153592610 18:6689518-6689540 GCAAATGTACTCCTGTGGTGGGG + Intergenic
1154319288 18:13332360-13332382 ACAAATGTACCACTGTGGTGTGG - Intronic
1154418078 18:14196195-14196217 ACAAATGTACCACACTCTGGTGG - Intergenic
1154944431 18:21147681-21147703 ACAAATGTGCCATTCTGGTGTGG - Intergenic
1154951118 18:21210783-21210805 ACAAATGCACCGCTCTGGTGGGG - Intergenic
1155302036 18:24439067-24439089 AAAAATGTCCTCTTCTGGGGAGG + Intronic
1155383015 18:25245373-25245395 GCAAATGTACCATTCTGGTGGGG - Intronic
1155417042 18:25610092-25610114 ATAAATGAACTACTGTGGTGGGG + Intergenic
1155630198 18:27884104-27884126 ACAAATATACCACTCTAGTGTGG + Intergenic
1155856007 18:30835441-30835463 AAAAATGTACCACTGTGGTGGGG + Intergenic
1156131663 18:33983374-33983396 ACAAATGTACCATTCTGGTGAGG + Intronic
1156248556 18:35328228-35328250 ACAAATATACCACTCTGGTGGGG - Intergenic
1156950570 18:42891932-42891954 ACAAATGGACTATTCTAGTGAGG + Intronic
1157044694 18:44087166-44087188 ATAAATGTTCTACTCTGGTGTGG + Intergenic
1157226871 18:45874200-45874222 ACAAATGTATCACCCTGGTGTGG + Intronic
1157341829 18:46785510-46785532 ACAAATCTACCACTCAGGTGTGG - Intergenic
1157652975 18:49355618-49355640 ACAAATGTATTCCTCTGCTGAGG + Intronic
1157973076 18:52293201-52293223 ACAAATGTACCACTGTGGTTTGG + Intergenic
1158534447 18:58295064-58295086 ACAAACATACCACTCTGGTGGGG - Intronic
1158633552 18:59136978-59137000 ACAAATGTACTACTCTGGCAGGG - Intergenic
1158702621 18:59762354-59762376 ATAAATGTACCACTCTGGTGGGG + Intergenic
1158730964 18:60022056-60022078 ACAAGCGTACCACTCTGGTGGGG - Intergenic
1158937334 18:62376561-62376583 GCAAATGTACCACTCTAGTGGGG - Intronic
1159308866 18:66681766-66681788 ACAAATGTACCACTCTGGTGGGG + Intergenic
1159326185 18:66922284-66922306 ACAAATGTACTTATCTGGATGGG - Intergenic
1159373103 18:67554917-67554939 ACAAATATACCACTCTGATGTGG - Intergenic
1162234890 19:9300985-9301007 ACAAATTTACCACTCTGGTGGGG + Intronic
1163227236 19:15972670-15972692 ACAAATGTGCCACTCTGGTAAGG + Intergenic
1164665479 19:30030760-30030782 ACAAATGTATCACTCTGGTGGGG - Intergenic
1164817192 19:31213605-31213627 ACAAAGGTACCACCCTGGTGGGG + Intergenic
1165613917 19:37182027-37182049 ACAAATGTACCACTCTGAAGGGG + Exonic
1166289871 19:41855956-41855978 GCAAAGGTACCACTCTGGTGTGG - Intergenic
1166290087 19:41857454-41857476 GCAAAGGTACCACTCTGGTGTGG + Intergenic
1167728302 19:51234232-51234254 ACAAATGTACCACTCTGATGGGG - Intronic
1167977383 19:53240876-53240898 ACAAATGTACCACTGTGATGGGG + Intronic
1168586377 19:57596923-57596945 ACAAATATACTATTCTAGTGGGG + Intergenic
925901085 2:8509976-8509998 CCCAATGTACCACTTTGGGGTGG - Intergenic
925901093 2:8510008-8510030 TCCAATGTACCACTTTGGGGGGG - Intergenic
926053609 2:9760592-9760614 ACAAATGTACAACTCTGGTGGGG - Intergenic
926780867 2:16470750-16470772 ATAAATGTACCACTCTGGTGGGG + Intergenic
926835836 2:17018824-17018846 ACAAATGTACCATTCTGGTAGGG - Intergenic
927580078 2:24235518-24235540 ACAAATGTACTGCTCTGGTGGGG + Intronic
928020772 2:27703056-27703078 ACAAATTTACCACTCTGGTGGGG - Intergenic
928550280 2:32363569-32363591 TAAAATGTACTACACTGGGGAGG - Intronic
929067008 2:37987732-37987754 ACAAATGTACCACTGTGAAGTGG + Intronic
929503330 2:42508683-42508705 ACAAATATACAACTCTGGTGAGG + Intronic
930241765 2:48942850-48942872 ACACATGTGCCACTCTGGTGGGG - Intergenic
930493001 2:52100348-52100370 ACAAGTGTACCACTGTGGTGGGG - Intergenic
930568427 2:53052958-53052980 ACAAAAATATTACTCTGGTGTGG - Intergenic
930742095 2:54842024-54842046 ACAAATGTACCACTCTGGTGGGG - Intronic
930810878 2:55539066-55539088 ACAAATGTACTACTTTTGAGGGG - Intronic
930925513 2:56813718-56813740 ACAAATGTACTATTCTGGTGAGG + Intergenic
931007371 2:57867147-57867169 AAAAATGTCATACTCTGTGGAGG - Intergenic
931024270 2:58091252-58091274 AAAAATGTGCTACTCTAGTGAGG + Intronic
931131714 2:59343540-59343562 ACAAACATAACACTCTGGGGGGG - Intergenic
931202324 2:60110085-60110107 ACAAATGGATTAATTTGGGGTGG + Intergenic
931751099 2:65330574-65330596 ACAAATGTACCACCGTGGTGGGG - Intronic
931838026 2:66120080-66120102 ACAAATGCACCACTTTGGTGGGG - Intergenic
932470726 2:71953622-71953644 ACAAATGTACCGCTCTGTTGGGG - Intergenic
932488926 2:72106090-72106112 ACAAATGTACCACTGGGAGGGGG - Intergenic
933352569 2:81173522-81173544 ACAAATACACTACTCTGGTGGGG - Intergenic
933864560 2:86504291-86504313 ACAAATGTACCACTCTGGTGTGG + Exonic
933865561 2:86513541-86513563 ACAAATGTACCACTCTTGTGTGG + Intronic
933872992 2:86588110-86588132 ACAAACGTACCACTCTGTGGGGG + Intronic
934100635 2:88649952-88649974 ACAAATATACCACTCTGGTGTGG - Intergenic
934499177 2:94841096-94841118 ACAAATGTACCACTCTCTGGTGG + Intergenic
935051314 2:99527349-99527371 ACAAATGGACCACTCTGGGGAGG + Intergenic
935209252 2:100924199-100924221 ACTAATGCACCACTCTGGTGGGG - Intronic
935257646 2:101326477-101326499 ACAAATGTTCCACTCTGGTGGGG + Intergenic
935454455 2:103251058-103251080 ACAAACGTACCACTCTGGGGAGG - Intergenic
935518523 2:104076290-104076312 ACAAATGTGCTACTGTGGCATGG - Intergenic
936238237 2:110764688-110764710 ACAAATATACCACTCTGGTGGGG + Intronic
936692133 2:114902750-114902772 ACAAATGTGCCACTCTGGTGGGG - Intronic
936787484 2:116111402-116111424 ACAAAAGTTCTACTCTAGGTGGG - Intergenic
936919407 2:117672192-117672214 CCAAATGTACCACTCTGGTGGGG + Intergenic
936941916 2:117892136-117892158 ACAAATGTGCTGCTATGGTGTGG - Intergenic
937598068 2:123694224-123694246 ACAATTGTACCACTCTAGTGGGG + Intergenic
937743786 2:125386903-125386925 ACAAATGTCCCACTTTGGTGAGG + Intergenic
937806327 2:126149912-126149934 ACAAATGTACTACTCTGGTGAGG - Intergenic
939136833 2:138306350-138306372 ACACATATACCACTCTGGTGAGG - Intergenic
939172231 2:138709483-138709505 ACAAATGCACCACACTGGTGGGG - Intronic
939664376 2:144932672-144932694 ACAAATGTACCACTCTGGTGGGG - Intergenic
939780880 2:146446194-146446216 ACAAATATACCACTCTGGTGGGG - Intergenic
939857844 2:147382013-147382035 ACAAATGTACCACTCTGGTGTGG + Intergenic
940313018 2:152298357-152298379 ACAAATGTACCGCTGTGGTGTGG - Intergenic
940371569 2:152907500-152907522 ATAAATGTACCACTGTGGTGAGG - Intergenic
940624406 2:156154519-156154541 ACAGATGTACCACTCTAGTGGGG + Intergenic
940714289 2:157201911-157201933 ACAAATGTACCCCTCTGGTGTGG + Intergenic
940768668 2:157817572-157817594 GTACATGTACTACTCTGGTGTGG + Intronic
940980368 2:159994921-159994943 GCAAATGTACGACTGTGGTGTGG + Intronic
941242428 2:163055944-163055966 ACAAATGTACCACTCTGGAGGGG - Intergenic
941265814 2:163360463-163360485 ACAAATGTATTATTATGGTGTGG - Intergenic
941816676 2:169802794-169802816 AGAAATGTACCACTCTGGTGGGG - Intronic
941956220 2:171207559-171207581 ACAGATGTACCACTGTGGTGTGG + Intronic
942269663 2:174261714-174261736 ACAAATGCACCACTCTGGTGAGG + Intergenic
942761717 2:179406591-179406613 ACAAAAGTACCACTCTGGTGGGG - Intergenic
942919021 2:181348280-181348302 ACAAACATACCACTCTGGTGGGG + Intergenic
943031998 2:182696659-182696681 ACAAATCTACCACTCTGGGAGGG + Intergenic
943089074 2:183352618-183352640 ACAAATGCACCACTCTGGTGGGG + Intergenic
943194650 2:184730330-184730352 ACAAATATACTACTCTGGTAGGG - Intronic
943952024 2:194142517-194142539 ACAAATGTACCACTCTTGTATGG - Intergenic
944207459 2:197171735-197171757 ACAAATGTGCCACTCTTGGGTGG + Intronic
944219381 2:197287130-197287152 ACAAATGTACCACTCTAGTGGGG + Intronic
944443429 2:199765287-199765309 ACAAACGTACCACTCTGTGGGGG + Intronic
944482690 2:200174278-200174300 ACAAATGTGCCACTCTGGTGGGG - Intergenic
944870351 2:203904859-203904881 ACAAATGTACCCCTCTGGTGGGG - Intergenic
944870464 2:203906546-203906568 ACAAATGTACCACTTTGGTGGGG + Intergenic
945061970 2:205917091-205917113 ACAAATGTACCACTCTCATGGGG + Intergenic
945536877 2:211028082-211028104 ACAAATGTACCCCTTTGGTGGGG - Intergenic
946486655 2:220106976-220106998 ACAAATGCACCACTCTGGAGAGG - Intergenic
946574809 2:221063459-221063481 ACAAATGTACCACTCTAGTGGGG - Intergenic
946661397 2:222003938-222003960 ACAAATGTACCACTCTGGTGTGG - Intergenic
946750209 2:222886874-222886896 ACCAATGTAGCACTCTGGGGAGG - Intronic
946917463 2:224539956-224539978 ATAAATGTACCACTCTGGTGTGG + Intronic
947213133 2:227725988-227726010 ACAAATGTACCACCCTGGCATGG - Intergenic
947254437 2:228146207-228146229 ACAAATGTACCACTATGGCTGGG - Intronic
947415999 2:229897008-229897030 ACAAATGTACCACTTCGGTGGGG + Intronic
1168867368 20:1099172-1099194 GCAAATGTACCACTCTGGTGTGG + Intergenic
1169084106 20:2816302-2816324 ACAAAGGGGCTCCTCTGGGGAGG + Intronic
1169292757 20:4366659-4366681 ACAAATGTACCACTCTGGTAGGG - Intergenic
1169833956 20:9856803-9856825 ACAAATGTACCACTCTGGTGAGG + Intergenic
1170433646 20:16300787-16300809 ACAAATATGCCACTCTGGTGTGG - Intronic
1170636280 20:18107518-18107540 ACAAATGTACCACTTTGGTAGGG - Intergenic
1170651482 20:18246513-18246535 ACAAATGTGCGACTCTGGTGGGG - Intergenic
1170670634 20:18429544-18429566 ACAAATGTACCACTTGGGTGTGG - Intronic
1171140912 20:22741762-22741784 ACAAATGTACTGCTTTGGTGGGG + Intergenic
1171890412 20:30707802-30707824 ACAAATGTACCACTCTCTGGTGG + Intergenic
1172725238 20:37034969-37034991 ACAAATGTAGCATTCTGGTGTGG + Intronic
1173234361 20:41230818-41230840 ACAAATGTACCATTCTGGTGGGG - Intronic
1174292381 20:49518248-49518270 ACAAATGTGCCACTCTGCTGAGG + Intronic
1175519708 20:59592400-59592422 ACAGATGTACTGCTCTGGTGGGG - Intronic
1176608589 21:8855024-8855046 ACAAATGGACCACTCTCTGGTGG - Intergenic
1176855220 21:13963082-13963104 ACAAATGTACCACACTCTGGTGG + Intergenic
1176889140 21:14293352-14293374 ACAAATGTACCCCTCTGTGGAGG + Intergenic
1177001117 21:15614473-15614495 ACAAATGTACCACTCTCATGGGG + Intergenic
1177325584 21:19584201-19584223 ACCAATGTAGCACTCTGGTGGGG - Intergenic
1177484457 21:21738918-21738940 ACAAATATACCACTCTAGTGGGG + Intergenic
1177568611 21:22857096-22857118 ATAAAGGTACCACTCTGGTGGGG - Intergenic
1177669995 21:24212626-24212648 ACAAATGCAGCACTCTGGTGGGG + Intergenic
1177826750 21:26092721-26092743 ACAAATGTACCATTCTGTGGGGG + Intronic
1177935584 21:27341289-27341311 ACAAATGTACCACTCTGGTCAGG + Intergenic
1178031350 21:28529910-28529932 ACAAGTGGACCACTCTGGTGTGG - Intergenic
1178101703 21:29275876-29275898 ACAAATGTACCACTCTGGTAGGG - Intronic
1178224158 21:30695809-30695831 GCAAATGTACCACCCTGGTGGGG - Intergenic
1178226002 21:30719196-30719218 ACAACTGTACTACTCAGGAGAGG + Intergenic
1178381152 21:32110020-32110042 ACAAATGTACTACTCTGATGGGG + Intergenic
1178891888 21:36526868-36526890 ACAAATGTACTTCTGTATGGTGG + Intronic
1179078306 21:38144588-38144610 ACAAATGTACCACTCTGGTGTGG - Intronic
1179348430 21:40583767-40583789 ACAAATGTACCACTCTTGCGGGG + Intronic
1180358673 22:11864839-11864861 ACAAATGGACCACTCTCTGGTGG - Intergenic
1180379593 22:12127492-12127514 ACAAATGGACCACTCTCTGGTGG + Intergenic
1181716615 22:24735304-24735326 ACAAATGTACCACACTGGTAGGG + Intronic
1183052761 22:35277808-35277830 ACAAATGTACTAGTCTGGTGGGG - Intronic
1183761201 22:39819777-39819799 ACAAATGTACCACTCTGGTGTGG + Intronic
1183766449 22:39880518-39880540 ACAAATGTACCACTTTGGTTGGG + Intronic
949358704 3:3208936-3208958 ACAAATGTACCACACTGGTGGGG + Intergenic
949451285 3:4188091-4188113 ACACATGTGCTACTCTGGTGAGG - Intronic
949693955 3:6672510-6672532 ACAGATGTACCATTCTGGTGAGG + Intergenic
949703320 3:6784809-6784831 ACAAAGGCACCACTCTGGGCAGG + Intronic
949899997 3:8804866-8804888 GCAAATGCACCACTCTGGTGGGG + Intronic
949978938 3:9487809-9487831 AAAAATGTACCACTCTGGTGGGG + Intergenic
950635316 3:14310255-14310277 ACAAATGTTCCATTCTGGTGGGG + Intergenic
950845684 3:16013578-16013600 ACAATTGTACCACTCTGGTGTGG - Intergenic
951244803 3:20328291-20328313 ATAAATGTACCACTCTGGTGGGG - Intergenic
951265806 3:20564915-20564937 ACAAATGTACCAATCTTGTGTGG - Intergenic
951344585 3:21531931-21531953 ACAAATGTACCATTCTAGAGGGG + Intronic
951367214 3:21798070-21798092 ACAAATGTACCTCTCTGGTGGGG + Intronic
951905148 3:27698923-27698945 ACAAATGTACCACTGTGGTGGGG + Intergenic
952473373 3:33680393-33680415 ACAAATGTACCACTCTGTTGAGG + Intronic
952575590 3:34770305-34770327 ACAAATGTACTGCTTTGGTAGGG + Intergenic
952635028 3:35518824-35518846 ATAAATGTACCACTCTGGTGGGG - Intergenic
952745101 3:36769497-36769519 GCAAATTTAATACTTTGGGGTGG - Intergenic
952917278 3:38256484-38256506 TCAAATGTACTACTCTAGTGGGG - Intergenic
953173448 3:40527959-40527981 ACAAACGTGTTACTCTGGTGTGG - Intronic
953189613 3:40671537-40671559 ACTAATGTACTACTCTGCTGAGG + Intergenic
953577429 3:44124102-44124124 ACCACTGTACCACTCTGGTGGGG - Intergenic
953753388 3:45626772-45626794 ACAAGTGTACCACTCTGGTGGGG + Intronic
953779818 3:45857832-45857854 ACACATGTACCATTCTGGTGGGG - Intronic
954237088 3:49265195-49265217 AAAAAAGTACCACTCTGGGCCGG + Intergenic
955047408 3:55373050-55373072 TCAAATGTACTACTGTGGAAAGG - Intergenic
955169781 3:56551927-56551949 ACAAATGTACTACTCTAGTCGGG - Intergenic
955479349 3:59373797-59373819 ACAAATGTACCACTCTGGTGGGG + Intergenic
955528961 3:59852478-59852500 ACAAATGTACCAGTCTGGTGGGG - Intronic
955877068 3:63502344-63502366 ACAAATGCACTACTCTGGTGGGG - Intronic
956115854 3:65917966-65917988 ACAAATGTACCACCTTGGTGGGG + Intronic
956127605 3:66025751-66025773 ACACATGTATTTCTCTGGGGTGG + Intronic
956535288 3:70268498-70268520 ACAAATGCACCATTCTGGTGGGG - Intergenic
956771421 3:72529272-72529294 ACACATGCACTACTCTGGTGGGG + Intergenic
956861748 3:73331143-73331165 ACAAATTGACCACTCTGGTGGGG + Intergenic
956973265 3:74551428-74551450 ACAAATGTACCACCCTGGTTGGG - Intergenic
957005422 3:74940208-74940230 ACAAATGTACCACTCTGATGTGG + Intergenic
957664894 3:83215290-83215312 ACAAATGCACCACTCTGGTGGGG + Intergenic
957676419 3:83372751-83372773 ACAAATGTACCACTCTGGTGGGG + Intergenic
957711924 3:83872307-83872329 ACAAATGTATCACTCTGTGGGGG + Intergenic
958009426 3:87857689-87857711 ACAAATGTACTACTTCGGTGGGG - Intergenic
958084196 3:88785097-88785119 ACAAATGTACTGCTGTGGCATGG + Intergenic
958106426 3:89079627-89079649 ACAAACGTACTACTGTGTTGGGG - Intergenic
958146135 3:89628105-89628127 ACAAATGTACCATTCTGGTGGGG + Intergenic
958490997 3:94773035-94773057 ACAAATGTACCACTCTGGTGAGG + Intergenic
958533604 3:95366586-95366608 ACAAATGTACCACTCTGTTGGGG - Intergenic
959081507 3:101806518-101806540 AAACATGTACTACTCAAGGGAGG - Intronic
959112389 3:102137246-102137268 CCATATGTACCACTCTGGTGTGG - Intronic
959168718 3:102816886-102816908 ACAAATGTAGTGCACTGGTGGGG - Intergenic
959193527 3:103146255-103146277 ACAAATGTAGCAATCTGGCGGGG - Intergenic
959413580 3:106056525-106056547 ACAAATGTACCACTCTGCTAAGG + Intergenic
959485123 3:106919846-106919868 TCAAATGTACCACTTTGGTGGGG + Intergenic
959529952 3:107423963-107423985 ACAAATGTACCAGTTTGGTGTGG + Intergenic
959771153 3:110098238-110098260 CCAAATGTGCCACTCTGGTGGGG - Intergenic
959778019 3:110192580-110192602 ACAAATGTACCACTCTGGTAGGG - Intergenic
959877006 3:111395070-111395092 ACAAATGTACCACTTTGGAAAGG - Intronic
959900709 3:111658691-111658713 CCAAATGTAATACTCTGGGAAGG + Intronic
960020555 3:112947325-112947347 ACAAATGTACCACTCTAGTCAGG + Intronic
960220671 3:115104900-115104922 ACAAATATATGACTCTGGTGGGG + Intronic
960834113 3:121886735-121886757 GCAAATGTGCCACTCTGGTGTGG - Intergenic
961026036 3:123558448-123558470 ACAAATGTACTACTCTGGTTGGG + Intronic
961370750 3:126428556-126428578 TCAAATGTGCTACTCTGGAGGGG + Intronic
961691266 3:128671578-128671600 ACAAATGCACCACTCTGCTGGGG - Intronic
962323605 3:134412975-134412997 ACAAATGTAGCACTTTGGTGTGG + Intergenic
962699910 3:137987806-137987828 AGAAATGTACCACTCTGTGGGGG - Intergenic
962705917 3:138044391-138044413 ACAAAGGTACCACTCTGTGGGGG - Intergenic
963015182 3:140817216-140817238 GCAAATATACCACTCTGGTGGGG + Intergenic
963587961 3:147217471-147217493 ACAAATATACCACTCTGGTGTGG + Intergenic
963731375 3:148976724-148976746 ACAAATGTACCAGTCTGGTGAGG - Intergenic
964205584 3:154171317-154171339 ACAAATGTACCATTCTGATGTGG - Intronic
964304931 3:155329603-155329625 ACAAATGTACTACTTTGTAGAGG + Intergenic
964361298 3:155899559-155899581 TCAAATGTATCACTCTGGTGTGG - Intronic
964662877 3:159140103-159140125 ACAAATGTACCACTCAGGTGTGG - Intronic
964818535 3:160743560-160743582 ACAAATGTACCACTCTGGCGTGG - Intergenic
964917723 3:161856296-161856318 ACAAATGTACCACTTTGGTGGGG + Intergenic
964998569 3:162921515-162921537 ATAAATGTGGTACTCTGTGGGGG + Intergenic
965114588 3:164471888-164471910 ACAAATATACCACTCTGGAGAGG - Intergenic
965181688 3:165412146-165412168 GCAAATGTACCACTCTGATGTGG + Intergenic
965280392 3:166744296-166744318 ACAAAGGTACCACTCTGGTTGGG - Intergenic
965315851 3:167189741-167189763 ATAAATGTATCACTCTGGTGTGG - Intergenic
965641525 3:170833761-170833783 ACAAATGTACCACTCTGGTGGGG - Intronic
965810062 3:172582355-172582377 ACAAATGTGCCACTCTGGTGTGG - Intergenic
965848828 3:172996604-172996626 ACAAATATACCACTCTGGTGAGG - Intronic
966249393 3:177846150-177846172 ACAAATGCACCACTCTGGTGGGG + Intergenic
966399368 3:179532683-179532705 ACAAATATACCACTCTGGTGTGG - Intergenic
966497553 3:180598486-180598508 ACAAATGTACCACTCAGGTGGGG + Intergenic
966546014 3:181149315-181149337 ACAAATGTACCACTTTAGCGTGG + Intergenic
966562374 3:181337356-181337378 ACAAATGTACCGTTCTGGTGTGG + Intergenic
966609559 3:181854835-181854857 ATAAATGTACCACTCTGGTGGGG - Intergenic
966736546 3:183191287-183191309 ACAAATGTGCCTCTCTGGTGGGG - Intronic
967110911 3:186293075-186293097 ACAAATGTACCACTCTGGTGGGG - Intronic
967287176 3:187883792-187883814 ATAAATGTACCACTTTGGTGCGG - Intergenic
967806541 3:193719264-193719286 ACACATGTACCACACTGGTGAGG + Intergenic
968031910 3:195507175-195507197 ACAAATGTACCACTTTGTGGGGG + Intergenic
968044421 3:195616052-195616074 ACAAATGTGCCACTCTGGTGGGG - Intergenic
968060210 3:195722103-195722125 TCAAATGTGCCACTCTGGTGGGG - Intronic
968636139 4:1681017-1681039 GCAAACGTACTACTCCGGTGGGG + Intronic
968674068 4:1867748-1867770 AGAAATATACTACTCTAGTGGGG - Intergenic
970100083 4:12511367-12511389 ACAAATGTACCACTTTGGTTGGG - Intergenic
970119385 4:12735601-12735623 AAAAATGTACCACCCTGGTGTGG - Intergenic
970319115 4:14858142-14858164 GCAAATGTATCACTCTGGTGAGG + Intergenic
970359093 4:15289816-15289838 GCAAATGTACCACTCTGTTGTGG + Intergenic
970405908 4:15764094-15764116 ACAAATATACCCCTCTGGGTGGG + Intergenic
970448522 4:16144303-16144325 ACAAATGCACCACCCTGGTGGGG + Intergenic
970701489 4:18745762-18745784 ACAAATGTACCATTCTGCTGAGG - Intergenic
970762389 4:19506688-19506710 ACAAATGCACCACTCTGTTGGGG - Intergenic
971630478 4:28986969-28986991 ACAAATGCACCACTCTGGTAGGG - Intergenic
971639702 4:29116657-29116679 ACAAATTTACCACTCTGGTGGGG - Intergenic
971752778 4:30672566-30672588 ACAAATGTACCACTGTGGTGAGG + Intergenic
971807134 4:31373398-31373420 ACAACCGTACCACTCTGGTGGGG - Intergenic
971904669 4:32711003-32711025 ACAAATGTACCAGTCTGGTGGGG - Intergenic
971994510 4:33947906-33947928 ACAAATGTACCACTCTGGTGTGG + Intergenic
972141035 4:35959383-35959405 ACAAGTATACCACTCTGGAGGGG - Intronic
972182080 4:36479565-36479587 ACAAATGTGCTACTCTAGTATGG - Intergenic
972318538 4:37950616-37950638 ACAAATGGACCACTCTGGTGGGG - Intronic
972322374 4:37983703-37983725 ACAAATGCACCATTCTGGTGAGG - Intronic
972349268 4:38221510-38221532 ACAAATGTACCTCTCTGGTAGGG + Intergenic
972445504 4:39139580-39139602 ACAAATGTAGCACTCTGGCGGGG + Intergenic
972807262 4:42542066-42542088 ACAAATGTACCACTCTGGTGGGG + Intronic
973235406 4:47897541-47897563 ACAAATGTACCAGTCTGGTGGGG - Intronic
973302085 4:48597449-48597471 ACAAATGTATCACTCTGAAGGGG + Intronic
973331792 4:48916774-48916796 ACAAGTGTACTGGTCTGGTGAGG - Intergenic
973635255 4:52856371-52856393 ACAAATGCACCATTCTGGTGTGG - Intergenic
973904305 4:55511573-55511595 GTAAATGTACCACTCTGGTGGGG - Intronic
974071732 4:57130150-57130172 ACAAATGTACCACTTTGCTGGGG - Intergenic
974258893 4:59498721-59498743 ACAAATGTATCACTCTGCGGGGG + Intergenic
974394019 4:61311930-61311952 ACAAATGTACCACTCTCATGTGG + Intronic
974670607 4:65025367-65025389 ACAAATGTACCATCCTGGTGCGG - Intergenic
974670937 4:65029082-65029104 ACAAATATGCCACTCTGGTGGGG - Intergenic
974678079 4:65122374-65122396 ACAAATGTACTAGTTTGGTGGGG + Intergenic
974778996 4:66527604-66527626 AGAAATGTACTAATATGGGTTGG + Intergenic
974843564 4:67324447-67324469 ACAAATATACCACTCTGGTGAGG + Intergenic
974921724 4:68250371-68250393 ACAAACGTACCACTCTGATGGGG - Intergenic
975160471 4:71119101-71119123 AAAAATGTACCACTCTGGTATGG + Intergenic
975354333 4:73382944-73382966 ACAAATGTATCACTCTGGCCGGG - Intergenic
975666135 4:76736874-76736896 ACAAATGTACTACTCTGGTGGGG - Intronic
975795808 4:78006333-78006355 ACAAATACACCACTCTGGAGTGG + Intergenic
975932546 4:79542853-79542875 ACAAATGCATCACTCTGGTGTGG - Intergenic
975977109 4:80112111-80112133 ACAAATATACTACTCTGGTGGGG + Intronic
976361352 4:84182254-84182276 ACATATGTACTTTTCTGGAGTGG + Intergenic
976818702 4:89180255-89180277 ACAAATGTACCACTCTGGTGTGG - Intergenic
977003836 4:91540184-91540206 ACAAATGTACCACTGTGATGTGG - Intronic
977839168 4:101680818-101680840 ACAAAGGTACTACTCTGGTGGGG - Intronic
977929295 4:102734146-102734168 ACAAATGTACCACTCTGGTGGGG + Intronic
977951907 4:102980796-102980818 ACAAATGGACCACTCTGGTGTGG - Intronic
978018356 4:103777588-103777610 ACAAATGTACGACTCTGGTAAGG - Intergenic
978033011 4:103958986-103959008 ACAAATGTACCACTGTGGTGGGG + Intergenic
978047342 4:104146879-104146901 ACAAATGTATCACTCTGGTGGGG - Intergenic
978129546 4:105178609-105178631 ACAAATATACCACTCTGGTATGG + Intronic
978207376 4:106093946-106093968 ACAAATGTACCACTCTGATGGGG + Intronic
978243661 4:106547394-106547416 ACATAGGTACCACTCTGGTGTGG + Intergenic
978399989 4:108321261-108321283 ACAAATGTACCCCTCTGCTGGGG + Intergenic
978686152 4:111445992-111446014 ACAAATGTACCACTCTGATTAGG + Intergenic
978920049 4:114173192-114173214 ACAAATGTACCACTCTGTTGGGG - Intergenic
978998717 4:115189453-115189475 ACAAATGTACCACTGTGGTTGGG - Intergenic
979025323 4:115565195-115565217 ACAAATGTACCACTCTGGTGTGG + Intergenic
979104125 4:116663080-116663102 ACAAATGTACCACTCTGATGGGG - Intergenic
979133478 4:117078901-117078923 ATAAATGTACCACTCTGAGGTGG + Intergenic
979162939 4:117486802-117486824 ACAAATGCACCACTCTGGAGGGG - Intergenic
979532185 4:121780648-121780670 ACAAATGTACAGCTCTGGTGGGG - Intergenic
979991244 4:127378338-127378360 ACAAATGTACCACTCTGGTGGGG - Intergenic
980063783 4:128159585-128159607 ACAAATGTACCACTGTGGTAGGG - Intronic
980600030 4:135010944-135010966 ACAAATGTACCACTCTGGTGGGG - Intergenic
980656128 4:135789129-135789151 ACATTTGTCATACTCTGGGGTGG - Intergenic
980668130 4:135966967-135966989 ACAAATGCACCAATCTGGGGTGG - Intergenic
981352439 4:143748099-143748121 AAAAATGTACCATTCTGGTGCGG - Intergenic
981438207 4:144751069-144751091 ACAAATGTACCTCTTTGGTGGGG - Intergenic
981486398 4:145291122-145291144 ACAAATGTACCACTCTGGTGTGG - Intergenic
981509849 4:145544146-145544168 ACAAATGTGCCACTCTGGTGGGG + Intronic
981523062 4:145684642-145684664 ACAAATGTACCACTGTGGTGGGG + Intronic
981555799 4:145992053-145992075 ACAAATGTACCACTATGTTGTGG - Intergenic
981710524 4:147704857-147704879 ACAAATGCATTACTCTGGTATGG - Intergenic
981910374 4:149973176-149973198 AAAAATGTATCACTCTGGTGTGG + Intergenic
982058612 4:151579291-151579313 ACAAATGTAGCACTCTGGTAGGG + Intronic
982146614 4:152401726-152401748 ACAAATGTACTACTCTGGTAAGG + Intronic
982188461 4:152827365-152827387 ACGAATGTACCACTCTAGCGAGG - Intronic
982428047 4:155289625-155289647 ACAAATGTACTAATATGGTGAGG + Intergenic
982693010 4:158569467-158569489 ACAAATGCACCACTCTGGACTGG + Intronic
982807311 4:159782464-159782486 ACAAATGTACCATTGTGGTGTGG - Intergenic
983074794 4:163312781-163312803 ACAAATGTTCCACTCTGGTGTGG - Intergenic
983110710 4:163745967-163745989 ACAAATGTACCACTCTGGTGGGG - Intronic
983595343 4:169460065-169460087 ACAAACGTACCTCTCTGGTGTGG + Intronic
983601302 4:169532511-169532533 ACAAATGTACTGCTCTGCTAAGG + Intronic
984100125 4:175474312-175474334 GCAAATGTACCACTCTGGTGGGG + Intergenic
984114639 4:175664379-175664401 ACAAATGTACCACTCTGGTGAGG + Intronic
984292635 4:177814583-177814605 ACAAATGTGCCATTCTGGTGGGG - Intronic
984404588 4:179311538-179311560 ACAAATGTACCACTGTGGTGCGG - Intergenic
984636493 4:182115990-182116012 ACAAATGTACCACTGTGTTGTGG - Intergenic
985225205 4:187752613-187752635 ACAAATGTACCACTTTGGAGAGG - Intergenic
985330441 4:188825874-188825896 ACAACTGTACCATTCTGGTGGGG - Intergenic
1202770661 4_GL000008v2_random:203509-203531 ACAAATGGACCACTCTCTGGTGG + Intergenic
985953380 5:3240701-3240723 ACAAATGTTCCACTCTGGTAGGG - Intergenic
986021817 5:3811799-3811821 ACTAATGAACCACTCTGGTGGGG + Intergenic
986877421 5:12128335-12128357 ACAATTGTACCACTTTGGTGGGG + Intergenic
986951826 5:13097225-13097247 ACTAATGTACCACTCAGGTGGGG + Intergenic
987196706 5:15534125-15534147 ACAAACATACCACTCTGGTGGGG - Intronic
987265049 5:16244809-16244831 ACAAGTGTACCTCTCTGGTGGGG + Intergenic
987934698 5:24449189-24449211 ACAAATGTACCACTCTGGTGTGG - Intergenic
988007554 5:25436692-25436714 AAAAATGTAGCACTCTGGTGGGG + Intergenic
988094444 5:26585838-26585860 ACAAATGCACTACTGTAGTGTGG - Intergenic
988372939 5:30395929-30395951 ACAAATGTATCACTCTGAGGGGG - Intergenic
988592709 5:32562853-32562875 ACAAATGTTCCACTCTGGCAGGG - Intronic
988720664 5:33875368-33875390 ACAAATGTACTACTCCGGTGGGG + Intronic
989154489 5:38331204-38331226 ACAAATGTACCACTCTGATAGGG - Intronic
989359506 5:40584616-40584638 ACAAATGTACCACTCTGGTGTGG - Intergenic
989436963 5:41425428-41425450 ACAAATGTGCCACTCTGGTGGGG - Intronic
989776885 5:45219648-45219670 ACAAATACACCACTCTGTGGGGG + Intergenic
990379280 5:55206335-55206357 ATAAATGTACCACTCTGGTGAGG + Intergenic
990528659 5:56652981-56653003 ACAAATGTACCACTCTGGTGGGG + Intergenic
990722805 5:58717004-58717026 ACAAATGCACCACTCGGGTGGGG + Intronic
991118681 5:62984897-62984919 AAAAATGTACCACTCTGGTATGG - Intergenic
991149857 5:63355127-63355149 ACAAATGTGCCACTCTGGTGGGG - Intergenic
991338465 5:65577838-65577860 ACAAATGGACCACTCTGGTGGGG - Intronic
991699602 5:69304930-69304952 AAAAATGTACCACTCTGGTGGGG + Intronic
991707865 5:69376603-69376625 ACAAATGTACTACTCTGGTGAGG - Intronic
992226270 5:74622080-74622102 ACAAATGTACCACTCTGGGCTGG - Intergenic
992315946 5:75555097-75555119 ACAAATGTACCCCTCTGGTGGGG - Intronic
992495010 5:77283292-77283314 ACAAATGTACCACTCTGGTGGGG - Intronic
992664161 5:78989524-78989546 ACAGATGTACCACTCTGGTGGGG + Intergenic
994493787 5:100483908-100483930 ACAAATGTACTACTCTGGTGGGG + Intergenic
994526125 5:100906693-100906715 AGAAATGTACTGCTCTGATGAGG - Intergenic
994802326 5:104394839-104394861 ACAAATGTATAACTCTGGTGAGG + Intergenic
994943068 5:106349939-106349961 ACAAATGTAACACACTGGTGGGG - Intergenic
995044446 5:107629544-107629566 ACAAACGTACCACTGTGGTGAGG + Intronic
995073757 5:107956731-107956753 AGAAACTGACTACTCTGGGGTGG + Intronic
995184658 5:109259308-109259330 AAACATGAACTACTCTGGGCTGG - Intergenic
995466489 5:112454566-112454588 ACAAATGTACCACTCTGGTGGGG - Intergenic
995527904 5:113065233-113065255 ACTAATATACTACCCTGGTGGGG + Intronic
995576993 5:113547533-113547555 AAAAATGTTCCACTCTGGTGGGG + Intronic
995672285 5:114619626-114619648 ACAACTGTATCACTCTGGAGGGG + Intergenic
995709090 5:115016498-115016520 GCAAATGTCCCACTCTGGTGGGG + Intergenic
995821350 5:116236854-116236876 ACAAATGTACTACTCTGGTGGGG + Intronic
996002441 5:118380847-118380869 ACAAAGGTACCATTCTGGAGAGG - Intergenic
996026716 5:118654541-118654563 ACAAATGTACCACTCCGGTGGGG - Intergenic
996182316 5:120434213-120434235 ACATATGTACCACTCTAGTGGGG + Intergenic
996546992 5:124690412-124690434 ACACATGTACCACTCTGGTGGGG + Intronic
996752167 5:126899871-126899893 ACACATGTACCACTGTGGTGTGG - Intronic
996791956 5:127302954-127302976 AGAAATGTACAGCCCTGGGGAGG + Intronic
997058357 5:130471252-130471274 ACAAATATACCACTCAGGTGGGG - Intergenic
997201877 5:132014970-132014992 ACAATTTTACTAATCTGAGGGGG - Intergenic
997240169 5:132301073-132301095 ACAAATGCTCTGCTCTGGAGAGG + Intronic
997757026 5:136408978-136409000 ACAAATGCACCACTCTGTGCTGG - Intergenic
997871773 5:137512233-137512255 ACAAATGTACCACTCTGGTAGGG + Intronic
998259700 5:140620568-140620590 ACAAATGTACTACTCTGGTGGGG + Intergenic
998298713 5:140997155-140997177 ATGAATGTACCACTCTGGGCAGG - Intronic
998361882 5:141595357-141595379 ACAAATGTACCACGCTAGTGGGG + Intronic
999189559 5:149736879-149736901 ACAAATCTACAACTCTGGTGGGG - Intronic
999305586 5:150517434-150517456 ACAAATTTACCACTCTGGGTTGG - Intronic
999713092 5:154335775-154335797 ACAAATGTACCACTATGGTATGG - Intronic
1000423731 5:161066311-161066333 ACAAATGTGCCACTCTGGTGAGG - Intergenic
1001373718 5:171233927-171233949 ACAAATGCACCACTCTAGTGGGG + Intronic
1002084518 5:176764235-176764257 ACAAATGCACCAGTCTGGTGGGG - Intergenic
1002799513 6:508251-508273 ACAAATGCACCCCTCTGGTGGGG - Intronic
1003481887 6:6542133-6542155 ACGAATGTACCACACTGGAGGGG - Intergenic
1003522103 6:6867054-6867076 ACAAATGGACCACTGTGGTGGGG - Intergenic
1003731737 6:8832201-8832223 ACAAATGTACCTCTCTGATGGGG - Intergenic
1003843156 6:10143537-10143559 ACAAATGTGCCACTCTGGTGGGG + Intronic
1004471481 6:15933375-15933397 ACAAATGCACCATTCTGGTGGGG - Intergenic
1004952011 6:20683667-20683689 ACAAATGTACCATTCTGATGGGG - Intronic
1005122797 6:22408948-22408970 ACAAATGTACCTCTCTGGTGGGG + Intergenic
1005129312 6:22486441-22486463 ACAAATATACCATTCTGGTGGGG + Intergenic
1006825409 6:36931035-36931057 ACAAATGCACCACTCTGGTAGGG - Intergenic
1007391171 6:41550151-41550173 ACACATGTTCTGCCCTGGGGAGG - Intronic
1009515326 6:64609089-64609111 ACAAATGTACCACTCTGTCATGG + Intronic
1010770817 6:79827965-79827987 ACAAATGTGCCACTCTGGTGGGG + Intergenic
1010801636 6:80183549-80183571 AAAAATGTACAACTCTGATGGGG - Intronic
1011031427 6:82928085-82928107 ACAAATGTACCAATCTGGTGAGG + Intronic
1011031562 6:82929843-82929865 ATAAATGTACTGTTCTGTGGTGG - Intronic
1011105734 6:83778279-83778301 ACAAATGTCCTACTCTAGTGAGG + Intergenic
1011169273 6:84487986-84488008 ACAAATGTACCACTCTGATGGGG + Intergenic
1011494572 6:87925622-87925644 ACAAATGTACTCTCCTGAGGTGG + Intergenic
1011698402 6:89933569-89933591 ACACATGTACCACTTTGTGGGGG + Intronic
1011880310 6:92015817-92015839 ACAAATGTACTACTCTGGTGGGG - Intergenic
1012105592 6:95153856-95153878 ACAAATGTTCTAAGCTTGGGAGG + Intergenic
1012147045 6:95697909-95697931 ACAAATCTACCACTCTGGTGGGG - Intergenic
1012283216 6:97355341-97355363 ACAAATATACCACTCTGCTGGGG - Intergenic
1012320912 6:97844410-97844432 ACAAATACACCACTCTGGTGAGG - Intergenic
1012385586 6:98678322-98678344 ATAAATGTACCACTCTGGTGGGG + Intergenic
1012418310 6:99034059-99034081 ACAAATGTACCACTCTGGTGGGG + Intergenic
1012745548 6:103082747-103082769 ACAAATGTACTATTCTGCTGGGG + Intergenic
1012897199 6:104963687-104963709 ACAAATGTGCCACTCTTGGTAGG - Intronic
1012936280 6:105371061-105371083 ACAAATGTACCACTCTGGTGGGG + Intronic
1013008597 6:106098974-106098996 GCAAAAGTAGTACTCTGTGGTGG + Intronic
1013084265 6:106842094-106842116 ATAAATGTACCATTCTGGTGGGG - Intergenic
1013306741 6:108854689-108854711 ACCAATGTACCACTCTGGTGGGG - Intronic
1013517752 6:110904087-110904109 ACAAACGTGCCACTCTGGTGGGG - Intergenic
1013544636 6:111144024-111144046 ACAAATGTACTACTCTGGTGGGG + Intronic
1013566608 6:111370819-111370841 ACACATGTACCACTCTGGTAGGG - Intronic
1013720722 6:113024947-113024969 ATAAATGTACCACTCTGTGGGGG + Intergenic
1013931058 6:115533387-115533409 ACAAATGTACAAGTGTGGTGAGG - Intergenic
1014086153 6:117346699-117346721 ACAAATGTACTACTTTGGTAGGG - Intronic
1014121744 6:117733921-117733943 ATAAATGTACCACTTTGGTGTGG - Intergenic
1014634754 6:123831622-123831644 ACAAAGGTACCACTCTGATGTGG - Intronic
1015067833 6:129052582-129052604 ACAAATGTAGCACTCTGGAGGGG - Intronic
1015069786 6:129078047-129078069 ACAAATGTACTACTCTACTGGGG + Intronic
1015092207 6:129372098-129372120 ATAAATGTACCATTCTGGTGGGG - Intronic
1015218005 6:130772433-130772455 ACAAATGTACCACTGTGGTGAGG + Intergenic
1015694199 6:135962032-135962054 ACAAATGGACCACTCTGATGGGG + Intronic
1015752985 6:136579672-136579694 ACCAATATACCACTCTGTGGGGG + Intronic
1015757188 6:136619543-136619565 ACAAATGGACTACTCTGGTGGGG - Intronic
1015767457 6:136733747-136733769 AAAAATGTACCACTCTGGTGGGG - Intronic
1016101402 6:140105645-140105667 ACAAATGTACCACTCTGGTGGGG - Intergenic
1016125584 6:140398826-140398848 ACACATGTCCCACTCTGGTGGGG - Intergenic
1016145090 6:140660824-140660846 AAAAATGTACTACTCTGGTGGGG + Intergenic
1016221336 6:141673992-141674014 TCAAATGTACCTCTCTGGTGTGG + Intergenic
1016222643 6:141693782-141693804 ACAAATGTACCACTCTGGTGGGG + Intergenic
1016283942 6:142451585-142451607 ACAAATGTTCTACTCTGGTGGGG - Intergenic
1016430301 6:143977125-143977147 ACAAATGTACCACTCTAGTGGGG - Intronic
1016602493 6:145878264-145878286 ACAAATGTACAACTGTGATGTGG - Intronic
1017555652 6:155563853-155563875 ACAAATGTACAACTCTGGTAGGG - Intergenic
1017828412 6:158100889-158100911 ACAAATGTACCAGTCTGGTGGGG - Intergenic
1017997377 6:159544008-159544030 ACAAATGGGCCACTCTGGTGTGG + Intergenic
1018213001 6:161500261-161500283 ACAAATGTACCACTCTTGTGGGG - Intronic
1018289612 6:162278480-162278502 AAAAATGTACCGCTCTGGTGGGG + Intronic
1018553327 6:165024146-165024168 ACCAATGCACCACTCTGTGGGGG + Intergenic
1019903280 7:4041403-4041425 AGAAAGGTACCACTCTGGTGGGG - Intronic
1020544736 7:9512771-9512793 ACAAATGTATCACTCTGGTGTGG - Intergenic
1020770363 7:12384538-12384560 ACAAATGTAGCACTCTGGTGGGG + Intronic
1020866332 7:13568682-13568704 ACAAAGGTACCACTCAGGTGGGG - Intergenic
1020874973 7:13681798-13681820 AGAAATGTACCACTCTGATGGGG + Intergenic
1020965788 7:14866213-14866235 ACAAATGTACCACTCTGGTGGGG - Intronic
1021341703 7:19471732-19471754 ACAAATGTAGTATTCTGGTTGGG + Intergenic
1021643686 7:22766127-22766149 ACAAATTTACCACTGTGGTGGGG - Intergenic
1021664055 7:22956642-22956664 ACAAACGTACCACTCTGGTGCGG + Intronic
1022075361 7:26963604-26963626 ACAAATGTATCACTCTGGTCAGG + Intronic
1022420812 7:30221708-30221730 ACGAATGTACCACTCTGGTGTGG + Intergenic
1022480060 7:30737180-30737202 ACAAATGTACCACTCTGGTGGGG - Intronic
1022689096 7:32628401-32628423 ACAAATGTACCACTCTGGTGCGG + Intergenic
1022805039 7:33813123-33813145 ACAGATGTACCATTTTGGGGGGG + Intergenic
1022876070 7:34531765-34531787 ATAAATGTACCACTCTGGTTTGG + Intergenic
1022916674 7:34962802-34962824 ACAAATGTACCACTCTGGTGCGG + Intronic
1022969807 7:35506517-35506539 CCCAATGTACTACAGTGGGGAGG + Intergenic
1022987496 7:35672133-35672155 ACAAATGTACTACTTTGGTGTGG + Intronic
1023407687 7:39852497-39852519 TCAAATGTACCACTATGGTGAGG - Intergenic
1023524580 7:41086327-41086349 ACAAATGTACCACTCTGGATTGG - Intergenic
1023551592 7:41375749-41375771 ACAAATGCACCACTCTGCTGGGG - Intergenic
1023562015 7:41485223-41485245 CCAGATGTACCACTCTGGTGGGG - Intergenic
1023642852 7:42278251-42278273 ACAAATGCACCACTCTGGTGGGG + Intergenic
1024035965 7:45507647-45507669 ACAAATGTACCATTCTGGTGGGG - Intergenic
1024250112 7:47499881-47499903 ACAAATGTGCTGTTCTGGTGCGG + Intronic
1024418196 7:49132830-49132852 ACAGACGTAATACGCTGGGGTGG + Intergenic
1024721546 7:52142438-52142460 ACAAATGTACCATTCTGGTGGGG + Intergenic
1024794027 7:53001917-53001939 ACAAATGTGCCCCTCTGGTGGGG + Intergenic
1024899658 7:54304266-54304288 ACAAATGCAGCACTCTGGTGGGG + Intergenic
1026167664 7:67924567-67924589 ATAAATGTATCACTCTGGAGGGG + Intergenic
1027277098 7:76568450-76568472 ACAAAAGTATCACTCTGGTGAGG + Intergenic
1027301669 7:76844077-76844099 ACAAATTTGATACTCTGGTGAGG + Intergenic
1027393657 7:77730352-77730374 ACAAATGTACCACTCTGATAGGG - Intronic
1027982829 7:85249020-85249042 ACAAATGTACCACTCTGATAGGG + Intergenic
1028194653 7:87892046-87892068 ACAAATGTACCACTCTGGTGTGG - Intronic
1028770181 7:94610398-94610420 ACAAATATACCACTCTGGTGGGG + Intronic
1028897684 7:96060671-96060693 ACAAATGCACCACTCTGGTAGGG + Intronic
1028926476 7:96362034-96362056 ACAAATGTACCACTCTGGTGGGG - Intergenic
1029000642 7:97151091-97151113 ACAAATGTACTACTCCAGTGGGG - Intronic
1029846119 7:103413931-103413953 ACAGATGTGCCACTCTGGTGGGG - Intronic
1030002835 7:105083721-105083743 ACAAATGTCCTATTCTGGGGGGG - Intronic
1030049547 7:105525509-105525531 ACAAATGTACCACTTTGGTGAGG + Intergenic
1030463788 7:109874461-109874483 ACAAATGTGCCACTCTGGTGGGG + Intergenic
1030577412 7:111306344-111306366 ACAAATGTACCAGTTTGGTGGGG + Intronic
1031041791 7:116845987-116846009 ACAAATGTACCACTCTAGTGGGG + Intronic
1031116068 7:117670184-117670206 ACAAATGTACTACTTTAGTGTGG - Intronic
1031164542 7:118213187-118213209 ACAAATGTACAACTCTGCTGGGG + Intergenic
1031225328 7:119029846-119029868 ACTAATGTACCACTCTAGTGGGG + Intergenic
1031257993 7:119481581-119481603 ACAAATGAACCACTTTGGTGGGG - Intergenic
1031307061 7:120142052-120142074 GCAAATGTATTACTCTGTTGGGG - Intergenic
1031447068 7:121867927-121867949 ACAAATGTACCACTTTGATGTGG + Intergenic
1031639974 7:124150597-124150619 ACAAATTTACCACTCTAGTGGGG - Intergenic
1031946177 7:127843193-127843215 ATAAATATACCACTCTGGTGTGG - Intronic
1032015315 7:128376331-128376353 ACAAATGTACCATTCTGGTGAGG - Intergenic
1032757303 7:134903335-134903357 ACAAATGTACTACACTTGTGAGG + Intronic
1032948572 7:136880743-136880765 ACAAATGTATCACTCTGGTGGGG - Intronic
1033435204 7:141327429-141327451 ACAAATGTACCACTCTAATGGGG - Intronic
1034399592 7:150853296-150853318 ACAAATGTATGGCTCTGGTGTGG + Intronic
1034499760 7:151441988-151442010 ACAAATGTACCACTCTAATGGGG - Intergenic
1035148901 7:156849870-156849892 ACAAATTTTCCACTCTGGTGGGG + Intronic
1035440479 7:158893033-158893055 ACAAATGCACCACTCTGGTAGGG - Intronic
1035525829 8:312431-312453 ACAAATGCATCACTCTGGTGGGG - Intergenic
1035777924 8:2203690-2203712 ACAGGTGTGCTACGCTGGGGCGG + Intergenic
1035963381 8:4162698-4162720 ACAAATGCACCACTCTGGCGTGG - Intronic
1036204566 8:6795498-6795520 ACAAATGCACCACTCTGGTGGGG - Intergenic
1036205126 8:6799951-6799973 ACAAATGCACCACTCTGGGCCGG - Intergenic
1036600463 8:10255945-10255967 ACAAATGCACCACTCAGGTGGGG - Intronic
1036622588 8:10434621-10434643 ACAAATGCACCACTCTGGTGGGG - Intergenic
1036641744 8:10589075-10589097 ACAAATGCACCACTCTGGGGTGG + Intergenic
1036667663 8:10758098-10758120 ACAAATGTACCACTCTGGTGGGG - Intronic
1036703231 8:11027911-11027933 ACAAGTGCACCACTCTGGAGGGG - Intronic
1036918546 8:12829679-12829701 ACAATTGTACTACTCTTGTGGGG - Intergenic
1037281136 8:17243906-17243928 ACAAATGCATTACTTTGGGGAGG - Intronic
1037340746 8:17841958-17841980 ACAAATGTACCACTTGAGGGTGG - Intergenic
1037362711 8:18090850-18090872 GCATATCTACTACTGTGGGGAGG - Intergenic
1037449373 8:19001428-19001450 ACAAATGTACCGCTCTGGTGGGG - Intronic
1037631369 8:20659662-20659684 ACAAATGCAGCACTCTGGTGGGG + Intergenic
1037805963 8:22057996-22058018 ACACGTGCACTACTCTGGGATGG + Intronic
1037935214 8:22910984-22911006 ACAAATGCACCGCTCTGGTGGGG + Intronic
1038010500 8:23472022-23472044 AAAAATCCAATACTCTGGGGAGG - Intergenic
1038013731 8:23495821-23495843 ACAAATGCACCACTCTGGAGGGG - Intergenic
1038031109 8:23641233-23641255 ACAAATGGACCACTCTGGTGGGG - Intergenic
1038084910 8:24185368-24185390 ACAAATGTACCCCTCTGGTGGGG + Intergenic
1038094599 8:24293863-24293885 GGAAATGTACTACTTTGGAGTGG + Intergenic
1038121310 8:24619446-24619468 ACAAATGCACCACTCTGGTGGGG + Intergenic
1038122781 8:24636828-24636850 ACAAATGAACCGCTCTGGTGTGG + Intergenic
1038183963 8:25255717-25255739 ATAAATGTACCACTCTGGTGGGG + Intronic
1038419724 8:27425573-27425595 ACAAATGCACCACTTTGGTGGGG - Intronic
1038473885 8:27848244-27848266 ACAAATGCACCACTCTGGTGGGG - Intergenic
1038490799 8:27969695-27969717 ACAAATGCACCATTCTGGTGGGG + Intronic
1039095788 8:33883549-33883571 ATAAATGTACCACTCTGGTGTGG + Intergenic
1039312889 8:36338101-36338123 GCAAATGTACCACTCTGATGAGG + Intergenic
1039348900 8:36739734-36739756 ACAAATGTACCACTCTGTTAGGG + Intergenic
1039722906 8:40184179-40184201 ACAAGTGTACCACTCTGGTGGGG + Intergenic
1039862939 8:41474807-41474829 ACAAATGTACCATTCTGGTGTGG - Intergenic
1040004841 8:42611207-42611229 ACAAATGCACCACTGTGGTGTGG + Intergenic
1040430006 8:47330311-47330333 ACAAATATACCATTCTGGTGGGG - Intronic
1040642526 8:49355251-49355273 ACAAATGTACTACCCTGGAGAGG - Intergenic
1041005047 8:53489541-53489563 ACAAATGCACTAGTCTGGTGGGG + Intergenic
1041093281 8:54324910-54324932 ACAGATGTACCACTCTGTTGGGG + Intergenic
1041299865 8:56399726-56399748 ACAAATGGACCACTCTGGTGGGG - Intergenic
1041555714 8:59152798-59152820 ACAAATGTGCCACTCTGGTGAGG - Intergenic
1041941583 8:63393898-63393920 ACAAATGTCCCACTCTGGTGTGG - Intergenic
1042208878 8:66357567-66357589 ACAAATATACCACTCTAGTGTGG - Intergenic
1042253763 8:66782432-66782454 ACATATGTACCACTCTGGTGGGG - Intronic
1042427794 8:68669212-68669234 ACAAATATGCTACTTTGGTGGGG + Intronic
1042474475 8:69231670-69231692 ACAAATGTACTACTCTGATGTGG + Intergenic
1042513467 8:69635341-69635363 ACAAATGTGCCACCCTGGTGAGG + Intronic
1042780768 8:72488918-72488940 ATAAATGTACCACTCTGGTGTGG + Intergenic
1043035507 8:75192770-75192792 ACAACTGTATCACTCTGGTGTGG + Intergenic
1043159928 8:76833684-76833706 ACAAGTGTACCACTCTGGTGGGG - Intronic
1043739704 8:83795343-83795365 GTAAATGTACCACTCTGGTGGGG + Intergenic
1044309509 8:90677452-90677474 ACAAATGTGCCAGTCTGGTGTGG - Intronic
1044875452 8:96661290-96661312 ACGAATGTACCACTCTGGTAGGG - Intronic
1045037613 8:98188157-98188179 ACAAATGTACCACTCTGGTGGGG + Intergenic
1045130835 8:99150340-99150362 ACAAACATACTACTCTGTTGAGG - Intronic
1045271925 8:100669500-100669522 ACAAAAGTACCACTCTGGTGGGG - Intergenic
1045350921 8:101338887-101338909 AAAAATGTACCACTCTGGTGTGG - Intergenic
1045350966 8:101339200-101339222 AAAAAGGTACCACTCTGGGCTGG - Intergenic
1045521925 8:102911239-102911261 ACAAGTGTACCACTCTGGTAAGG - Intronic
1045751365 8:105488071-105488093 ACAAATGTACTGTTGTGGTGGGG - Intronic
1045989646 8:108290785-108290807 ACAAATGTGCCAGTCTGGTGTGG - Intronic
1046054747 8:109065930-109065952 ACAAATGTTCCACTCTGGGGAGG - Intergenic
1046228121 8:111313534-111313556 ACACATGTACTATTCTGGAGGGG + Intergenic
1046870076 8:119196518-119196540 ACAAATGTACCACTCTGGTGGGG + Intronic
1046877648 8:119274180-119274202 ACAAATGTGCCATTCTGGTGGGG + Intergenic
1046883987 8:119342330-119342352 ACAAATGTACCATTCTGATGTGG + Intergenic
1046952378 8:120030898-120030920 ACAAATGTACCACTCAGGTAGGG + Intronic
1047046529 8:121059279-121059301 ACAAATATACTGCTGTGGTGTGG + Intergenic
1047161949 8:122390529-122390551 ACAAGTGTATCACTCTGGTGGGG + Intergenic
1047421991 8:124714911-124714933 AGATATGTATTATTCTGGGGAGG - Intronic
1047626654 8:126663831-126663853 GCAAATGTACCACTGTGGTGGGG + Intergenic
1047980904 8:130181007-130181029 TCAATTGTACCACTCTGGTGGGG + Intronic
1048142292 8:131806227-131806249 ACAAATTTTCGACTGTGGGGAGG + Intergenic
1048726600 8:137392623-137392645 AAAAATGTACCACTCTGGTGAGG - Intergenic
1048994210 8:139781663-139781685 ACAAATGTACCACTCTAGTGTGG + Intronic
1049072507 8:140367770-140367792 ACAAATGTACCACCCTGGTATGG + Intronic
1050011274 9:1187773-1187795 ACAAATTTACCACTCTGGAGAGG - Intergenic
1050145625 9:2564358-2564380 ACAAATGTGCTACTCTGATGAGG + Intergenic
1050218071 9:3351134-3351156 ACAAATGTACCTCTCTGGTGGGG + Intronic
1050260680 9:3837941-3837963 ACAAAGGCACCACTCTGGTGTGG + Intronic
1050578984 9:7030502-7030524 ACAAATGTGCTGCTCTGGTGGGG + Intronic
1050796133 9:9545094-9545116 ACAAGTGTACTATTTTGGTGGGG - Intronic
1050804513 9:9656806-9656828 ACAAATGTACTTCTCTGGTGGGG + Intronic
1051189932 9:14500718-14500740 AAAAATGTAGGACTCTAGGGCGG - Intergenic
1051746715 9:20301696-20301718 ACAAATGTACCACGCTGGTGGGG - Intergenic
1051797818 9:20893820-20893842 ACAAATATACCACTCTGGTGGGG - Intronic
1052133087 9:24874665-24874687 ACAAATGTATCATTCTGGTGGGG - Intergenic
1052166573 9:25337772-25337794 ACAAATGTACCACTTTGGTGCGG + Intergenic
1052523809 9:29586180-29586202 ACAAATGTACTACTCTACTGGGG + Intergenic
1052613483 9:30807598-30807620 ACAAATGCACCACTCTGGTGAGG + Intergenic
1052783871 9:32810816-32810838 ACAAATGTACCACTCTGGTGGGG + Intergenic
1053271596 9:36753456-36753478 ACAAATGCATTACTCTGGTGGGG + Intergenic
1053541701 9:38980286-38980308 ACAAGTGTACCACTCTGGTGAGG - Intergenic
1053573506 9:39334243-39334265 ACAAATGCAGCACTCTGGTGGGG - Intergenic
1053624767 9:39857840-39857862 ACAAATGCACCACTCTGGTGGGG - Intergenic
1053657978 9:40239448-40239470 ACAAATGTACCACTCTCTGGTGG - Intronic
1053806044 9:41802918-41802940 ACAAGTGTACCACTCTGGTGAGG - Intergenic
1053838125 9:42162799-42162821 ACAAATGCACCACTCTGGTGGGG - Intergenic
1053880103 9:42585388-42585410 ACAAATGCACCACTCTGGTGGGG + Intergenic
1053892558 9:42708921-42708943 ACAAATGCACCACTCTGGTGGGG - Intergenic
1053908347 9:42868723-42868745 ACAAATGTACCACTCTCTGGTGG - Intergenic
1054095074 9:60892927-60892949 ACAAATGCAGCACTCTGGTGGGG - Intergenic
1054116543 9:61168853-61168875 ACAAATGCAGCACTCTGGTGGGG - Intergenic
1054123638 9:61284766-61284788 ACAAATGCAGCACTCTGGTGGGG + Intergenic
1054219128 9:62392858-62392880 ACAAATGCACCACTCTGGTGGGG + Intergenic
1054231585 9:62516315-62516337 ACAAATGCACCACTCTGGTGGGG - Intergenic
1054358481 9:64088396-64088418 ACAAATGGACCACTCTGTGGTGG - Intergenic
1054370099 9:64385724-64385746 ACAAATGTACCACTCTCTGGTGG - Intronic
1054526618 9:66136773-66136795 ACAAATGTACCACTCTCTGGTGG + Intronic
1054591216 9:67013707-67013729 ACAAATGCAACACTCTGGTGGGG + Intergenic
1054624438 9:67383625-67383647 ACAAGTGTACCACTCTGGTGAGG + Intergenic
1054677730 9:67875478-67875500 ACAAATGTACCACTCTCTGGTGG - Intronic
1055005624 9:71502707-71502729 ACAAATGTACCACTCTGGTGGGG + Intergenic
1055265589 9:74492455-74492477 ACATATGTAATACTGTGTGGTGG + Intergenic
1055527012 9:77145178-77145200 AACAATGTACCACTCTGGTGGGG + Intergenic
1055972251 9:81923268-81923290 ACAAATGTACCACTCTAGTATGG + Intergenic
1055974004 9:81938340-81938362 ACAAATGTACCACTCTAGTATGG + Intergenic
1055992939 9:82127644-82127666 ACAAATGTACCATTCTCGTGTGG + Intergenic
1056037812 9:82627477-82627499 ACAAATGTATCACTCTGGTGGGG + Intergenic
1056096921 9:83264500-83264522 ACAAATGTACTTCTCTTGTGTGG + Intronic
1056212450 9:84377258-84377280 ACAAGTGTACCACCCTGGTGGGG - Intergenic
1056401048 9:86227581-86227603 AGAAATGAACTTTTCTGGGGTGG + Intronic
1056626648 9:88259138-88259160 ACAGATGGACCACTCTGTGGGGG - Intergenic
1056844880 9:90029074-90029096 ACAAATGAACCTCTCTGGTGGGG + Intergenic
1056921939 9:90798903-90798925 ACAAATGTACCAGTCTGATGGGG - Intergenic
1057262012 9:93590280-93590302 ACAACTCTACAACTCTAGGGAGG - Intronic
1057462452 9:95275534-95275556 ACAAATGTACCACTCTGGTGGGG + Intronic
1057531506 9:95851129-95851151 ACAAATGTAGTACTCCGTAGGGG + Intergenic
1057858681 9:98622990-98623012 ACAAATGGACCACTCTGGTGGGG + Intronic
1058566450 9:106290296-106290318 ACAAATGTGCCACTCTGGTGGGG + Intergenic
1058654215 9:107205086-107205108 ACAAATGGACCACTCTGGTGGGG + Intergenic
1058772719 9:108252618-108252640 TCAAATGTACCACTCTGGTGAGG + Intergenic
1059010353 9:110451221-110451243 AGAAATGTACTAATTTGTGGTGG + Intronic
1059067196 9:111097936-111097958 ACAAATCTACCACTCTGCTGGGG - Intergenic
1059089762 9:111343362-111343384 ACAAATGTACCACCCTGGAGGGG + Intergenic
1059275605 9:113094273-113094295 ACAAATGTACCACCCTGGTGAGG + Intergenic
1059689135 9:116667865-116667887 ACAAATGTACCACTCTGTTGGGG - Intronic
1060111075 9:120906605-120906627 ACAAAACTACCACTCTGGTGGGG - Intronic
1060320593 9:122555827-122555849 ATAAATGTACCACTCTGGTGAGG - Intergenic
1060504056 9:124184865-124184887 ACAAATGGACCACTCTTGTGGGG - Intergenic
1060714981 9:125917329-125917351 ACAAATGAACCCCTCTGGTGGGG - Intronic
1061298775 9:129692353-129692375 ACGAATGTAACACTCTGGTGGGG - Intronic
1061581811 9:131542181-131542203 ACAAATGTACCACTCTGGTGTGG - Intergenic
1203703987 Un_KI270742v1:20243-20265 ACAAATGGACCACTCTCTGGTGG - Intergenic
1203560025 Un_KI270744v1:45581-45603 ACAAATGAACCACTCTCTGGTGG + Intergenic
1185819235 X:3185637-3185659 ACAAATGTACTGCTCTAGTCGGG + Intergenic
1185852356 X:3500967-3500989 ACAAATGCACCACTCTGGTGGGG + Intergenic
1185949517 X:4415996-4416018 AAAAATGTACCACTCTGGTGGGG - Intergenic
1185957527 X:4507795-4507817 CCAAATGTGCCACTCTGGTGGGG - Intergenic
1186167350 X:6840790-6840812 AAAAATGTACTGCTCAGGTGGGG + Intergenic
1186347244 X:8706588-8706610 ACAAATGTCCCACTCTGGTGGGG + Intronic
1186533392 X:10320465-10320487 ACAAATGTTCCACTCTAGTGGGG - Intergenic
1186561471 X:10618130-10618152 ACAAATGTTGTACACTGGTGTGG - Intronic
1186620069 X:11230886-11230908 ACAAAGGCACCACTCTGGTGGGG - Intronic
1187128137 X:16473656-16473678 ACAAATGAACCACTGTGGTGTGG + Intergenic
1187311096 X:18143693-18143715 ACAAATGTAGCACCCTGGTGAGG + Intergenic
1187600333 X:20822477-20822499 ATAAATGTACCACTCTGGTGGGG - Intergenic
1188043759 X:25401962-25401984 ACAAATGTACTACTCTGGTGGGG - Intergenic
1188088575 X:25934082-25934104 ACAAATGTACCACTTTGGTGGGG + Intergenic
1188269057 X:28116112-28116134 ACAAGTGTACCACTCTGGTGGGG - Intergenic
1188290290 X:28379430-28379452 ACAAATGGAATACACTGAGGAGG - Intergenic
1188622171 X:32239476-32239498 ACAAATGTACCACTCTGGTGTGG - Intronic
1188709129 X:33372533-33372555 AAGAATGTACCACTCTGGTGGGG - Intergenic
1188859604 X:35241887-35241909 ACAAATGTACCACTCTGGTGTGG - Intergenic
1189027565 X:37413094-37413116 ACAAATGTACCTCTCTGGTAAGG - Intronic
1189058445 X:37726160-37726182 AAAAATGTACCACTCTGGTGGGG + Intronic
1189411663 X:40778248-40778270 GCAAATATACCACTCTGGTGGGG - Intergenic
1189464962 X:41271618-41271640 ACAAATATACCACTCTGGTGGGG + Intergenic
1189775360 X:44465472-44465494 ACAAATGTACCACTCTGGTAGGG - Intergenic
1190011163 X:46786259-46786281 ACAAATGTACCACTCTGGTGGGG + Intergenic
1190341028 X:49295897-49295919 ACAAATGCACCACGCTGGTGAGG - Intronic
1190617667 X:52252833-52252855 ACAAATGTACTACTCTGGGGGGG - Intergenic
1190625350 X:52332042-52332064 ACAAATGCACTATTCTGGTGAGG - Intergenic
1190724575 X:53180460-53180482 ACGAATGTACCACTCTGCTGGGG + Intergenic
1192088742 X:68130108-68130130 ACAAATGTTATAATCTGTGGAGG + Intronic
1192419166 X:71013670-71013692 ACAAATATACCACTCTGGTGTGG + Intergenic
1192903647 X:75525690-75525712 ACAAATGTACTACTCTGGTGGGG - Intergenic
1193536261 X:82719089-82719111 ACAAATGTATCACTCTGGCTTGG - Intergenic
1193613970 X:83666329-83666351 AGAAATATACTGCTCTGGGGTGG + Intergenic
1194020352 X:88682627-88682649 ACAAATGTACCACTCTGATGGGG - Intergenic
1194102354 X:89721514-89721536 ATGAATGTACCACTCTGGTGTGG - Intergenic
1194184437 X:90756490-90756512 ACAAATGTACCACTCTGGTGGGG + Intergenic
1194278768 X:91921267-91921289 ACAAATGTGTCACTCTGGTGGGG - Intronic
1194280276 X:91943300-91943322 ACAAATGTACCACTTTGGTGGGG + Intronic
1194359565 X:92932737-92932759 ACAAATGTACCACTGTGATGGGG + Intergenic
1194440022 X:93920797-93920819 ACAAATGTATCACTTTGGTGGGG + Intergenic
1194450556 X:94040474-94040496 ACAAATCTACCTCTCTTGGGGGG - Intergenic
1194890986 X:99378389-99378411 ACAAATGTACCACTTTGGTGGGG - Intergenic
1195003425 X:100664384-100664406 AAAAATGTACCACTCTGGTGGGG - Intronic
1195028792 X:100906203-100906225 ACAAATGCACTACTCTGATGAGG - Intergenic
1195952696 X:110292882-110292904 ACAAATGTACCACTCAGGTGTGG + Intronic
1196227560 X:113184527-113184549 ACAAATGCACTACTCTGTTGGGG + Intergenic
1196313702 X:114197987-114198009 ATAAATGTACCACTCTGGTTGGG + Intergenic
1196896666 X:120343764-120343786 ACAAATGTACCACTCTGGTTGGG + Intergenic
1197392123 X:125880352-125880374 CATAATGTACTACTCTGGAGGGG - Intergenic
1197539536 X:127740148-127740170 ACAAATGTATTACCCTGGTATGG + Intergenic
1197616790 X:128701118-128701140 ACAAGTGTACCATTCTGGTGAGG + Intergenic
1197865767 X:131015036-131015058 AGAAATGTATCACTCTGGTGAGG - Intergenic
1198096392 X:133383925-133383947 ACAAATGCACCACTGTGGTGGGG + Intronic
1198134723 X:133737397-133737419 ACAAATGTACCACTCTGGTGAGG + Intronic
1198251615 X:134884418-134884440 ACAAATGTACCGGTCTGGTGAGG + Intergenic
1198410840 X:136365987-136366009 ACAAACATACCACTCTGGTGGGG - Intronic
1198738485 X:139813977-139813999 ACAAATGTACCATTCTGGTGTGG + Intronic
1198786482 X:140294257-140294279 ACAAATGTACTACTCTGGTGGGG - Intergenic
1198978705 X:142368018-142368040 ACCAATGTACTAGTCTGGTGGGG - Intergenic
1199498834 X:148486657-148486679 ACAAATGCACCACTCTGTGGAGG + Intergenic
1199747038 X:150778441-150778463 AAAAATGTACCACTCTGGCAGGG + Intronic
1199823431 X:151473791-151473813 ACATATGTACTATTCTGGTGGGG - Intergenic
1200021106 X:153209882-153209904 ACAAAGGTACCACTCTGGTGGGG - Intergenic
1200454941 Y:3378792-3378814 ATGAATGTACCACTCTGGTGTGG - Intergenic
1200492823 Y:3849581-3849603 ACAAATGTACCACTCTGGTTTGG - Intergenic
1200531026 Y:4338403-4338425 ACAAATGTACCACTCTGGCGGGG + Intergenic
1200596251 Y:5144769-5144791 ACAAATGTGTCACTCTGGTGGGG - Intronic
1200597753 Y:5166794-5166816 ACAAATGTACCACTTTGGTGGGG + Intronic
1200667765 Y:6048569-6048591 ACAAATGTACCACTGTGATGGGG + Intergenic
1201419661 Y:13784559-13784581 ACAAATATCCCACTCTGGTGGGG - Intergenic
1201736199 Y:17264748-17264770 ACAATTATACTACTAAGGGGTGG + Intergenic