ID: 1190618413

View in Genome Browser
Species Human (GRCh38)
Location X:52262107-52262129
Sequence ACACTCTCCCAGCCAGCCCC TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 547
Summary {0: 1, 1: 1, 2: 4, 3: 37, 4: 504}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1190618407_1190618413 9 Left 1190618407 X:52262075-52262097 CCTCACGTTCGAGACCTGTGCCA 0: 1
1: 2
2: 0
3: 0
4: 40
Right 1190618413 X:52262107-52262129 ACACTCTCCCAGCCAGCCCCTGG 0: 1
1: 1
2: 4
3: 37
4: 504
1190618409_1190618413 -5 Left 1190618409 X:52262089-52262111 CCTGTGCCAATCCCATGGACACT 0: 1
1: 1
2: 0
3: 7
4: 130
Right 1190618413 X:52262107-52262129 ACACTCTCCCAGCCAGCCCCTGG 0: 1
1: 1
2: 4
3: 37
4: 504
1190618406_1190618413 12 Left 1190618406 X:52262072-52262094 CCGCCTCACGTTCGAGACCTGTG 0: 1
1: 0
2: 2
3: 5
4: 35
Right 1190618413 X:52262107-52262129 ACACTCTCCCAGCCAGCCCCTGG 0: 1
1: 1
2: 4
3: 37
4: 504
1190618405_1190618413 16 Left 1190618405 X:52262068-52262090 CCAGCCGCCTCACGTTCGAGACC 0: 1
1: 0
2: 1
3: 3
4: 31
Right 1190618413 X:52262107-52262129 ACACTCTCCCAGCCAGCCCCTGG 0: 1
1: 1
2: 4
3: 37
4: 504

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1190618413 Original CRISPR ACACTCTCCCAGCCAGCCCC TGG Intergenic
900104553 1:976735-976757 CCACTCCCCCCGCCAACCCCGGG + Intronic
900104568 1:976767-976789 CCACTCCCCCCGCCAACCCCGGG + Intronic
900104583 1:976799-976821 CCACTCCCCCCGCCAACCCCGGG + Intronic
900104598 1:976831-976853 CCACTCCCCCCGCCAACCCCGGG + Intronic
900104613 1:976863-976885 CCACTCCCCCCGCCAACCCCGGG + Intronic
900104628 1:976895-976917 CCACTCCCCCCGCCAACCCCGGG + Intronic
900104643 1:976927-976949 CCACTCCCCCCGCCAACCCCGGG + Intronic
900290885 1:1923135-1923157 ACACCCCTCCAGCCAGCTCCCGG - Intronic
900594797 1:3475868-3475890 ACACCTGCCCAGCCAGCCTCTGG - Intronic
901139934 1:7022110-7022132 ACTCTCTGCCAGCCACTCCCAGG - Intronic
901644323 1:10708590-10708612 TCACTCTCACAGCAGGCCCCAGG - Intronic
901862170 1:12081360-12081382 TCACACCTCCAGCCAGCCCCAGG + Intronic
901898123 1:12332609-12332631 ACCCTCTCCCACCCAACTCCAGG - Intronic
902043431 1:13508904-13508926 AGGCTCCCCCAGCAAGCCCCAGG + Intronic
902090846 1:13902054-13902076 ACACGGCCCCAGGCAGCCCCGGG + Intergenic
902222390 1:14975142-14975164 AGACTGTGCCAGCCAGCTCCTGG + Intronic
902408151 1:16197697-16197719 CCACTCTCCCCTCGAGCCCCGGG + Intergenic
903236089 1:21951644-21951666 ACTCTGTCCCTGCCAGGCCCCGG - Intergenic
903326971 1:22574471-22574493 GCCCCCTCCCTGCCAGCCCCTGG + Intronic
903378044 1:22878789-22878811 AGACGCTCCCATCCAGTCCCTGG - Intronic
903953907 1:27012141-27012163 CCCCTCTCCCAGCCAGGCCCTGG + Intronic
904031614 1:27536817-27536839 AGAGGCTCCCAGCCTGCCCCGGG - Intronic
904267455 1:29325928-29325950 TCACTCTGCCAGGCAGCACCAGG - Intronic
904938084 1:34145872-34145894 CCACTTTCCCAGCCAGCTCTTGG - Intronic
905343475 1:37295339-37295361 AGACTCTCACAGCCACCCCCAGG - Intergenic
905639246 1:39577035-39577057 ACACCCTCCCACCCATCACCCGG + Intergenic
906035188 1:42746462-42746484 ACACAGGCCCAGCCACCCCCAGG - Exonic
906702841 1:47872367-47872389 CCACTCTCCCTGCCACCTCCGGG + Intronic
906785519 1:48612104-48612126 ACACTCTGGCAGCAGGCCCCTGG - Intronic
909209461 1:72805636-72805658 ACACTCTCACAGACACACCCAGG - Intergenic
910322803 1:85967887-85967909 ACACTCTCACAGACACACCCAGG - Intronic
910587715 1:88897714-88897736 ACACTCTCACAGACACACCCAGG - Intergenic
910639424 1:89443605-89443627 ACACCCTCACAGCCACACCCAGG + Intergenic
910790595 1:91045874-91045896 ACACTCTCACAGACACACCCAGG - Intergenic
910791503 1:91055702-91055724 ACACTCTCACAGACACACCCAGG + Intergenic
911831661 1:102557205-102557227 ACACTCTCACAGACACACCCAGG + Intergenic
912051110 1:105528590-105528612 ACACTCTCACAGACACACCCAGG + Intergenic
912129612 1:106585611-106585633 ACACCCTCACAGCCACACCCAGG + Intergenic
913110836 1:115655760-115655782 ACCCTCTCCCAGACAGCACTTGG + Intronic
913276094 1:117139299-117139321 ACATTCACCCAGCCATTCCCTGG - Intergenic
913481378 1:119292744-119292766 ACACCCTCCCAGACACACCCAGG - Intergenic
913963328 1:143355230-143355252 ACACGCTCCCAGCCCGCACTGGG + Intergenic
915107744 1:153544951-153544973 ACACCCTCCCAGCCAGGTGCGGG - Intronic
915491087 1:156250412-156250434 CCACCCTCCCAGCCGGCTCCTGG + Exonic
915709958 1:157886083-157886105 ACACTCTCACAGACACACCCAGG - Intronic
916261763 1:162849325-162849347 ACACCCTCCCAGACACACCCAGG + Intronic
917535517 1:175871860-175871882 ATACCCTCCCAACCAGCCTCAGG + Intergenic
918887212 1:190210744-190210766 ACACTCTCACAGACATACCCAGG - Intronic
919451080 1:197774759-197774781 ACACGCACACAGGCAGCCCCAGG + Intronic
919697367 1:200591628-200591650 ACACTCTCCCAGTCTTCCTCTGG + Intronic
920039490 1:203086183-203086205 CCACCCTGCCAGCCTGCCCCTGG + Intergenic
920227834 1:204450894-204450916 ACACCCTCCTGGCCAGCCCAGGG + Intronic
920230497 1:204466803-204466825 AGACTCCCCCAGCCAGCATCGGG - Intronic
921208883 1:212875369-212875391 AGACTCTCCCGGCCATCCCTAGG - Intronic
921748417 1:218764741-218764763 TCTCTCTCCCAGCCATCCCAAGG + Intergenic
921925244 1:220705704-220705726 GCCCTCTCCCTGCCAGCCCCTGG - Intergenic
922152567 1:223018274-223018296 ACACTGTCACAGGCAGCCCAGGG - Intergenic
922573200 1:226645734-226645756 ACATGCCCCCAGCCAGCCCGAGG - Intronic
922696438 1:227733325-227733347 CCACTCTCCCAGCCAGAGCTGGG - Intronic
922764747 1:228150997-228151019 ACACACTCCCAGCCTGACCCAGG + Intronic
922801980 1:228368611-228368633 CCACTGTCCCACCCTGCCCCCGG + Intronic
922830196 1:228548929-228548951 AGAGACTCCCAGCCAACCCCAGG - Intergenic
922915240 1:229252137-229252159 ACACCCTCCCATCCAGGGCCAGG + Intergenic
923957549 1:239040100-239040122 ACACCCTCACAGACAGACCCAGG - Intergenic
924208873 1:241744143-241744165 ACTCTATTCCAGGCAGCCCCTGG - Intronic
924269492 1:242318162-242318184 ACACTCTCCTTCACAGCCCCAGG - Intronic
924293585 1:242563416-242563438 ACACTCTCACAGACACACCCAGG - Intergenic
924453372 1:244198924-244198946 GCACTCTCCAAGACATCCCCTGG + Intergenic
1063175319 10:3545317-3545339 ACACTCTCACAGACACACCCAGG + Intergenic
1065739126 10:28781070-28781092 ACACTCTCACAGACACACCCAGG + Intergenic
1066158629 10:32704799-32704821 GCACTCTCCGAGCCAGGCGCGGG + Intronic
1066715409 10:38280609-38280631 ACACTCTCCTTCACAGCCCCAGG + Intergenic
1066782686 10:38970103-38970125 ACACTCTCCTTCACAGCCCCAGG - Intergenic
1066958011 10:42191285-42191307 ACACTCTCACAGACACACCCTGG + Intergenic
1067443589 10:46326911-46326933 ACCCTCACCCTGCCTGCCCCAGG - Intronic
1067595360 10:47553301-47553323 TCACTCTCCCAACGACCCCCGGG + Intergenic
1068966705 10:62919093-62919115 ACACTTACCCAGCCAGGCACTGG + Intronic
1069191998 10:65503928-65503950 ACACTCTCACAGACACACCCAGG + Intergenic
1069604870 10:69732711-69732733 GCCCTCTCCCTGCCAACCCCAGG - Intergenic
1069728106 10:70594158-70594180 ACACTCTCACCAGCAGCCCCAGG + Intergenic
1070099151 10:73368507-73368529 TCACCCTCCTACCCAGCCCCTGG - Intergenic
1071308816 10:84324526-84324548 ACACCCTCCCAGACACACCCGGG - Intergenic
1071522006 10:86337292-86337314 CCACTCTCCCAGGCAGCCTTTGG - Intronic
1073753012 10:106550958-106550980 ACACTCTCCCAGACACACCCAGG + Intergenic
1073806652 10:107105785-107105807 ACACCCTCCCAGACACACCCAGG + Intronic
1074447515 10:113532849-113532871 CCTCTCTGCCAGCCAACCCCTGG + Intergenic
1074503074 10:114043792-114043814 CCACTCCCCAAGCCAACCCCCGG - Intergenic
1074715620 10:116215880-116215902 TCCCTCTCCCCACCAGCCCCTGG + Intronic
1074737146 10:116447166-116447188 TCAGTCTCTCAGGCAGCCCCTGG - Intronic
1075279766 10:121129557-121129579 ACAACCACCCAGCCAGCTCCTGG + Intergenic
1075345424 10:121678668-121678690 ACACTCACACAGCCAGGCCTTGG + Intergenic
1075721882 10:124592321-124592343 ACCCTCACTCACCCAGCCCCGGG + Intronic
1076398291 10:130157586-130157608 ACACCCTCACAGCCATGCCCAGG + Intronic
1076519762 10:131074080-131074102 TCTCACTCCCAGCCAGACCCCGG + Intergenic
1076576815 10:131474976-131474998 ACACCCTCACAGACAGACCCAGG + Intergenic
1077113650 11:873094-873116 ACACACCCCCACCCAGCACCTGG - Intronic
1077636640 11:3846288-3846310 TCCCTCTCTCAGCCAGCCTCAGG + Intergenic
1078008478 11:7550699-7550721 ACACTCTCACAGACACACCCGGG - Intronic
1078079819 11:8195783-8195805 AGAACCACCCAGCCAGCCCCTGG - Intergenic
1080145007 11:28971319-28971341 ACACCCTCCCAGACACACCCAGG - Intergenic
1081854141 11:46293409-46293431 TCATTTTCCCAGCCAGCCCCTGG - Intronic
1082066553 11:47905541-47905563 ACACTCTCCCAGCAAAGCCGTGG - Intergenic
1082645017 11:55712566-55712588 ACAATCTCCCATTTAGCCCCAGG - Intergenic
1082671229 11:56039296-56039318 ACACTCTCACAGGCACACCCAGG - Intergenic
1083281817 11:61631486-61631508 TCTCCCTCCCAGCCAGCCCCTGG + Intergenic
1083325280 11:61869918-61869940 CCACTCCTCCAGCCAGCCGCTGG - Intergenic
1083628445 11:64083861-64083883 ACACTCGCCCAGCACCCCCCAGG - Intronic
1083883509 11:65559417-65559439 ACCCTCTCCCGGACAGCACCCGG + Intergenic
1084077238 11:66789409-66789431 ACATTCTCCCAGGAAGCCCTTGG + Intronic
1084410766 11:69004897-69004919 ACTGTGTCCCAGCCAGCACCAGG - Exonic
1084493332 11:69489893-69489915 CCACTCACCCAGCCTGACCCTGG - Intergenic
1084509825 11:69596618-69596640 ACACTCTCCTTGCCAGACACAGG + Intergenic
1084580421 11:70019893-70019915 TCACCGGCCCAGCCAGCCCCAGG + Intergenic
1085446165 11:76602595-76602617 AGCCTTTCCCACCCAGCCCCAGG - Intergenic
1085823703 11:79820305-79820327 ACTCTCTCCGAGTCTGCCCCAGG - Intergenic
1085998109 11:81947087-81947109 ACACTCTCACAGGCACACCCAGG - Intergenic
1087165059 11:94994775-94994797 TCTCTCTCCCACCCAACCCCAGG - Intronic
1088379155 11:109173916-109173938 ACACTATCCCAGCCAACACCAGG - Intergenic
1089309400 11:117547911-117547933 ACACTCTCCCACCCCTTCCCAGG + Intronic
1090981115 11:131723300-131723322 ACACTCTCCCATCCATCATCAGG - Intronic
1091342320 11:134825449-134825471 ACACCCTCCCAGACACACCCAGG + Intergenic
1091405799 12:208680-208702 TCCCTCTCCCTGCCAGCCCTTGG - Intronic
1091663758 12:2403724-2403746 ACCATCTCCCAGTGAGCCCCAGG + Intronic
1091710890 12:2739631-2739653 GCCCTCTCCCAGCCAAGCCCTGG + Intergenic
1091767409 12:3130573-3130595 CCACTCTGCCACCCTGCCCCAGG - Intronic
1091859279 12:3764949-3764971 ACACCCTCACAGCCACACCCAGG + Intergenic
1091971154 12:4788157-4788179 GCCCCCTCCCCGCCAGCCCCCGG - Intronic
1092241575 12:6839275-6839297 ACACTCTCCTCCCCAACCCCAGG + Exonic
1092784962 12:12018378-12018400 CCACTCTGCCAGCCAGGCCCAGG + Intergenic
1093036648 12:14338099-14338121 ACACTCTCACAGACACACCCAGG - Intergenic
1093376069 12:18429472-18429494 ACCCTCTCCCAGCCACCATCTGG + Intronic
1095279372 12:40332245-40332267 ACCCTCACCCATGCAGCCCCTGG - Intronic
1095298095 12:40550016-40550038 ACACACTCCCTGCCATACCCTGG + Intronic
1095949812 12:47775776-47775798 ACACTCTGCCCACCAGACCCAGG - Intronic
1095970818 12:47901056-47901078 ATCCTCTCCCAGCCAGCCTTGGG + Intronic
1096372947 12:51083652-51083674 TCCATTTCCCAGCCAGCCCCGGG - Intronic
1096463378 12:51835123-51835145 ACAGCCTCCCACCCATCCCCTGG + Intergenic
1096497155 12:52045272-52045294 CCACCCTCCCTGCCAGCCCCAGG + Intronic
1097136269 12:56858988-56859010 ACACTCTCACAGACACACCCAGG - Intergenic
1097371125 12:58782774-58782796 ACACTCTCACAGACACACCCAGG - Intronic
1097540749 12:60939113-60939135 ACACTCTCACAGACACACCCAGG - Intergenic
1097560350 12:61197390-61197412 ACACTCTCACAGACATACCCGGG + Intergenic
1098673317 12:73256659-73256681 ACACTCTCACAGACACACCCAGG - Intergenic
1099765851 12:86982589-86982611 CCATTTTCCCAGCCAGCACCAGG + Intergenic
1100266553 12:92982208-92982230 ACACTCTCACAGACACACCCAGG - Intergenic
1101606220 12:106248624-106248646 TCACTCTCCCAGCCCGCCATGGG + Intronic
1101721267 12:107352604-107352626 ACGCTCTCACAGGTAGCCCCAGG - Intronic
1102408973 12:112700577-112700599 ACACTCTCCGAGTCTGCACCTGG + Intronic
1102436127 12:112925355-112925377 CCCCTCTCCCAGCCAACCGCAGG + Intronic
1102498980 12:113338335-113338357 ACAATCTCCAAGCCTGCTCCGGG + Intronic
1102737518 12:115175834-115175856 ACACTCTCACAGACACACCCAGG + Intergenic
1103716314 12:122947385-122947407 GCCATCTCCCACCCAGCCCCCGG - Intronic
1104446670 12:128839649-128839671 GTTCTCTCCCTGCCAGCCCCTGG + Intergenic
1104858531 12:131913009-131913031 GCATCCTCCCTGCCAGCCCCAGG - Intronic
1105874580 13:24540996-24541018 ACACTCTCCCGGCAGGCCCTGGG - Intergenic
1107682500 13:42866209-42866231 ACACCCTCCCAGACACACCCAGG - Intergenic
1107817807 13:44259818-44259840 ACACTCACCCATTCATCCCCTGG - Intergenic
1109518943 13:63484181-63484203 ACACTCTCACAGACACACCCAGG - Intergenic
1110016160 13:70407083-70407105 ACACTCTCACAGACACACCCAGG - Intergenic
1110083151 13:71343729-71343751 ACACTCTCACAGACACACCCAGG + Intergenic
1111441157 13:88284124-88284146 ACACTCTCACAGGCACACCCAGG - Intergenic
1111786245 13:92790190-92790212 ACACCCTCACAGACAGGCCCAGG + Intronic
1112225579 13:97536379-97536401 ACACTCTCACAGACACACCCAGG + Intergenic
1112249637 13:97767928-97767950 ACACTCTCACAGACACACCCAGG + Intergenic
1113396450 13:109952065-109952087 ACACTCTCACAGACACACCCAGG - Intergenic
1113647202 13:112006958-112006980 TCCCCCTCCCTGCCAGCCCCTGG - Intergenic
1115077936 14:29414086-29414108 GGACTCTCCCAGCCAGGCACGGG - Intergenic
1116414540 14:44664904-44664926 ACACCCTCCCAGACACACCCGGG - Intergenic
1116538345 14:46064554-46064576 CCACTCTCCCTCCCAACCCCTGG + Intergenic
1117442624 14:55774170-55774192 ACACTCTCACAGACACACCCAGG - Intergenic
1119636862 14:76280348-76280370 CCACTCTCCTGGCCAGCCCTAGG - Intergenic
1120100969 14:80445315-80445337 ACACTCTCACAGACACACCCAGG + Intergenic
1120483598 14:85083145-85083167 ACACTCTCACAGACACACCCAGG - Intergenic
1120555721 14:85928196-85928218 ACACCCTCCCAGACACACCCAGG + Intergenic
1120646824 14:87084329-87084351 ACACCCTCCCAGACACACCCAGG + Intergenic
1121234271 14:92380691-92380713 ACACTGGGCCAGCCAGCACCAGG + Intronic
1121617603 14:95323267-95323289 ACACCCTCCCAGCCACTTCCGGG + Intergenic
1122353643 14:101111335-101111357 ACACTTTCCCAGGCTGACCCTGG + Intergenic
1122409661 14:101519314-101519336 AGTCCCTCCCAGCCAGCCACGGG - Intergenic
1122900335 14:104779749-104779771 ACCCCCGCCCAGCCAGCCTCAGG + Intronic
1202935103 14_KI270725v1_random:80610-80632 ACACTCTCACAGACACACCCTGG - Intergenic
1124560519 15:30769893-30769915 ACACTCTCCCTGGAAGCACCAGG + Intronic
1127029743 15:54848872-54848894 CCACTCTCTCATCCAGCTCCTGG - Intergenic
1127814769 15:62598255-62598277 CCACGCTCTCAGCCTGCCCCAGG - Intronic
1127882400 15:63169933-63169955 CCTCTCTCCCTGCCAGCCCACGG + Intergenic
1128810324 15:70566651-70566673 TTGCTCTCCCACCCAGCCCCGGG - Intergenic
1129162731 15:73755761-73755783 CCCCTCCCCCCGCCAGCCCCTGG + Intergenic
1129522918 15:76197098-76197120 AGCCTCTGCCAGGCAGCCCCAGG + Intronic
1130979832 15:88804621-88804643 ACAGCCTCCAACCCAGCCCCAGG - Intronic
1131547873 15:93330941-93330963 ACACTGTGACAGCCAGCACCAGG - Intergenic
1131651852 15:94409067-94409089 ACACTCTCACAGACACACCCAGG - Intronic
1132025680 15:98402738-98402760 ACACTCTCACAGACACACCCAGG + Intergenic
1132669286 16:1096094-1096116 AGACTCCCACAACCAGCCCCAGG + Intronic
1132869240 16:2108326-2108348 ACTCGCTCCCATCCAGCACCAGG + Exonic
1133706250 16:8357851-8357873 AATCTCTCCCTGCCTGCCCCAGG + Intergenic
1134550293 16:15135723-15135745 ACTCGCTCCCATCCAGCACCAGG + Intronic
1134718175 16:16367272-16367294 ACTCGCTCCCATCCAGCACCAGG - Intergenic
1134838364 16:17380988-17381010 CCACTCTCACCCCCAGCCCCTGG - Intronic
1134956577 16:18384887-18384909 ACTCGCTCCCATCCAGCACCAGG + Intergenic
1135903598 16:26489911-26489933 AAACTCACCCAGCCTGCCCCAGG + Intergenic
1135973382 16:27088488-27088510 ACATGCTCCCAGCCAGGCCCAGG + Intergenic
1136284462 16:29233014-29233036 TCATTCTCCCAGGCAGACCCAGG + Intergenic
1137047806 16:35685019-35685041 AGAGACTCCCAGCCAACCCCAGG - Intergenic
1137048145 16:35687134-35687156 AAAGACTCTCAGCCAGCCCCAGG - Intergenic
1137048888 16:35691773-35691795 AAAGTCTCCCAGCCAATCCCAGG - Intergenic
1137051272 16:35714755-35714777 AGAGACTCCCAGCCAACCCCAGG - Intergenic
1137306237 16:47203351-47203373 AAACCATCCCAGCCATCCCCTGG - Intronic
1137405966 16:48189720-48189742 ACACTTTCCCACCCGGCCTCTGG - Intronic
1137598460 16:49740347-49740369 ACACTCTCTCAAGCAGGCCCCGG + Intronic
1138268890 16:55680650-55680672 ACACACTCCCAGACACACCCAGG + Intronic
1138315207 16:56063984-56064006 ACCCTTACCCAGCCAGCCTCAGG + Intergenic
1139282174 16:65780470-65780492 TCACTGTCCCAGGCATCCCCTGG + Intergenic
1139850842 16:69950966-69950988 ACACTGTCCCAGCCAGGACACGG + Intronic
1139879825 16:70173878-70173900 ACACTGTCCCAGCCAGGACACGG + Intronic
1140372698 16:74421670-74421692 ACACTGTCCCAGCCAGGACACGG - Intronic
1141615996 16:85209712-85209734 AGACTCTCCCTCCCAGCCTCGGG - Intergenic
1141890346 16:86922364-86922386 CCACCCTCCCAGCCACTCCCGGG - Intergenic
1142089497 16:88202527-88202549 TCATTCTCCCAGGCAGACCCAGG + Intergenic
1142220426 16:88851709-88851731 AGACCCTCCGAGCCAGGCCCGGG - Intronic
1142557564 17:790196-790218 CCACTCTCCCAGCCCGCCCGTGG + Intronic
1142685064 17:1572784-1572806 TCACTCTCCCACCCACCCTCAGG - Intronic
1142687857 17:1588010-1588032 TCACTCTCCCACCCACCCTCAGG - Intronic
1142717241 17:1754048-1754070 ACACCCTCCCAAGCAGCTCCAGG + Intronic
1142848825 17:2694663-2694685 ACACTGCCCCACCCGGCCCCCGG + Intronic
1143899439 17:10162828-10162850 TCCCTCTCCCCGCCAGCCCCTGG - Intronic
1145013907 17:19384756-19384778 ACCCTCTCCCGGCCAGCTCGGGG - Intronic
1145126698 17:20306588-20306610 AAACTCCACCAGCCAGCCCAGGG + Intronic
1146002428 17:29139348-29139370 ACTCTCCCCCAGCCACCCCCGGG - Intronic
1146539772 17:33684297-33684319 ACCCACTCCCAGCCCGACCCTGG + Intronic
1146837323 17:36122449-36122471 ACACCCTCCCAGACACACCCAGG + Intergenic
1147614776 17:41821537-41821559 CCACTCTCCAGCCCAGCCCCAGG + Intronic
1148740626 17:49890580-49890602 GCCCTCCCCCAGCCAGCTCCGGG + Intergenic
1148953826 17:51337148-51337170 ACACTCTCACAGACACACCCAGG - Intergenic
1148995806 17:51708608-51708630 ACACCCTCACAGCCATGCCCAGG - Intronic
1150230381 17:63546400-63546422 AGACTCTCCCACCCTGCACCAGG - Exonic
1151435024 17:74089856-74089878 ACAGCCTCCCAGCCAGTCGCAGG - Intergenic
1151719083 17:75845456-75845478 CCTCTGTCCCAGCCAGGCCCTGG + Intergenic
1152244015 17:79175947-79175969 ACACCCTCACAGCCAGTGCCGGG + Intronic
1152272570 17:79333703-79333725 ACACACCCACAGTCAGCCCCTGG + Intronic
1152589506 17:81204396-81204418 ACAAACCCCCAGCCCGCCCCAGG - Intronic
1152738322 17:82008217-82008239 GCAGTCTCCCACCCAGCCACGGG - Intronic
1203165463 17_GL000205v2_random:89128-89150 CTACACTCCCAGCCAGCACCGGG - Intergenic
1153568782 18:6447261-6447283 AGACCCTCCCAGCCACCCACAGG - Intergenic
1154068009 18:11127366-11127388 ACACCCTCCCAGACACACCCAGG - Intronic
1154071512 18:11156369-11156391 ACACTCTCACAGACACACCCAGG + Intergenic
1154333401 18:13447977-13447999 ACACCCTCCCGGCCACCCCTTGG - Intronic
1155054533 18:22171936-22171958 CTACTCTCCCAGCCCGCCCATGG + Exonic
1156421620 18:36960158-36960180 ACACCCACCCAGCCAGACACAGG - Intronic
1156798242 18:41075197-41075219 AAACTCTTCCTCCCAGCCCCGGG - Intergenic
1156821027 18:41373013-41373035 ACAATCTCCAAGCCAGGCCAAGG + Intergenic
1157334029 18:46724234-46724256 TTAGTCTCCCAGCCAGACCCTGG + Intronic
1157687505 18:49654245-49654267 ACACTCTCACAGACACACCCAGG + Intergenic
1159768748 18:72522783-72522805 ACCCTCCCCCACCCAACCCCAGG - Intergenic
1160068814 18:75606411-75606433 ACATTCTCCCTGCCATCCCCAGG + Intergenic
1160100914 18:75918213-75918235 CCACTCTCCCCACCAGACCCTGG - Intergenic
1160505506 18:79424111-79424133 ACCCTCCCACAGCCTGCCCCAGG - Intronic
1160571143 18:79818394-79818416 GCAGACTCTCAGCCAGCCCCAGG + Intergenic
1160590929 18:79944264-79944286 ACACTATCCCCGCCTTCCCCAGG - Intronic
1160788620 19:912819-912841 CCCCTCCCCCAGCGAGCCCCCGG + Intronic
1160868049 19:1264754-1264776 CCACTCTCCCAGGCAGCTGCAGG - Intronic
1161044319 19:2126991-2127013 ACGGACTCCCAGCCAGCCCCAGG + Intronic
1161232393 19:3180775-3180797 ACACGCTCCCCGCCAGCCACAGG + Intergenic
1161644657 19:5445662-5445684 ACAGCCTCCCAGCCAGGCCCAGG - Intergenic
1161783222 19:6307311-6307333 CTGCTCTCCGAGCCAGCCCCTGG - Intronic
1162079588 19:8210022-8210044 ACACACTCCCGGCTAGGCCCTGG - Intronic
1163676755 19:18659259-18659281 CCTCTCTCCCAGCCAGTCCCAGG - Intronic
1164370024 19:27636081-27636103 AAAAACTCCCAGCCAACCCCAGG - Intergenic
1164371940 19:27650956-27650978 AGAGACTCCCAGCTAGCCCCTGG - Intergenic
1164372860 19:27656924-27656946 AGAAACTCCCAGCCAGCCACAGG - Intergenic
1164376420 19:27691916-27691938 AGAGACTCCCAGCCAACCCCAGG - Intergenic
1164381952 19:27743278-27743300 AGACTCACCTAGGCAGCCCCAGG - Intergenic
1164626726 19:29734261-29734283 TCACTCCCCCCGCCACCCCCTGG + Intergenic
1164689270 19:30197286-30197308 ACACTCTCACAGACACACCCAGG + Intergenic
1164720620 19:30429155-30429177 CTCCTCTCCCAGCTAGCCCCAGG - Intronic
1164981056 19:32614924-32614946 ACCCTCTCCCAGCTTTCCCCAGG - Intronic
1165014172 19:32868803-32868825 GCTCTCTCCCAGACAGGCCCCGG + Intronic
1165827726 19:38714761-38714783 CCACCTTGCCAGCCAGCCCCTGG + Intronic
1165878282 19:39025066-39025088 AAACCCTCCGATCCAGCCCCAGG - Exonic
1167517061 19:49929570-49929592 GAACTCTCCCACCCGGCCCCGGG - Intronic
1167677335 19:50895414-50895436 ACACCCTCACAGACACCCCCAGG - Intergenic
925402870 2:3588246-3588268 ACAGTCTCCCAGCCAGATACAGG + Intergenic
925886856 2:8401047-8401069 ACACTATCTCAGGCAGTCCCAGG + Intergenic
927488252 2:23503981-23504003 GCACTCTCCAAGCCAGCCAGAGG + Intronic
927847688 2:26479897-26479919 ACTCTCTCCTCTCCAGCCCCGGG + Intronic
929560089 2:42951081-42951103 AGACTGTCCCACCCTGCCCCAGG - Intergenic
929889431 2:45906887-45906909 ACACTGTCCCAGCCAAGCGCAGG - Intronic
930001317 2:46863550-46863572 GCCTTCTCCCAGCCAGCCTCGGG - Intergenic
932581435 2:72994929-72994951 ACACCCACCCTGCCTGCCCCTGG + Intronic
933632549 2:84673885-84673907 ACACTCTCACAGACACACCCAGG + Intronic
933756358 2:85641876-85641898 ACACTCTGTCACCCAGACCCAGG - Intronic
933886310 2:86721137-86721159 CCCCGCTCCCAGCCGGCCCCGGG + Intronic
934306129 2:91823676-91823698 ACACTCTCACAGACACACCCTGG + Intergenic
934327127 2:92029066-92029088 ACACTCTCACAGACACACCCTGG - Intergenic
934465508 2:94259633-94259655 ACACTCTCACAGACACACCCTGG - Intergenic
934686393 2:96325184-96325206 CCACTCTCCCAGCAAACCCACGG + Intergenic
935526253 2:104171623-104171645 ACACTCTCACAGACACACCCAGG - Intergenic
936341619 2:111638733-111638755 CCCCTCTCCCTGCCTGCCCCTGG + Intergenic
937147993 2:119663790-119663812 CCCCGTTCCCAGCCAGCCCCTGG + Intergenic
937260085 2:120579771-120579793 TCAATCTCCCTCCCAGCCCCAGG + Intergenic
937443155 2:121933984-121934006 ACACTCTGCCAGACAGCCCATGG + Intergenic
937784912 2:125885326-125885348 ACACTCTCACAGACATACCCAGG + Intergenic
938261751 2:129901806-129901828 ACCCTCACCGAGACAGCCCCAGG - Intergenic
938554884 2:132415902-132415924 GCACTCCGCCAGCAAGCCCCAGG - Intergenic
939531002 2:143361806-143361828 TCTCTCTGGCAGCCAGCCCCAGG - Intronic
940008299 2:149029859-149029881 ACAATCCCCCAGCCAGCCGGTGG - Intergenic
940357711 2:152763680-152763702 ACACCCTCACAGACAGACCCGGG + Intergenic
942153757 2:173105743-173105765 ACTCTCTCTCTCCCAGCCCCTGG - Intronic
942498543 2:176564315-176564337 AAACTGTCCCAGGAAGCCCCAGG - Intergenic
943317631 2:186409928-186409950 ACACTCTCACAGACACACCCAGG + Intergenic
946160082 2:217830599-217830621 ACCTTCTCCCAGACAGGCCCAGG + Intronic
946236315 2:218326643-218326665 ATACTCTCCCACCCAACTCCAGG - Intronic
946797319 2:223369646-223369668 ACACTTCCCCAGCCTCCCCCTGG + Intergenic
947030641 2:225789058-225789080 ACACTCTCACAGACACACCCAGG + Intergenic
948106159 2:235415455-235415477 ACACCCTCCCAGACACACCCAGG + Intergenic
948149360 2:235732899-235732921 CACCTCCCCCAGCCAGCCCCAGG + Intronic
948517154 2:238511142-238511164 ACCATCTGCCAGCCAACCCCAGG - Intergenic
948903525 2:240967494-240967516 CCACTCTCACAGCCACTCCCAGG - Intronic
1169008602 20:2230866-2230888 TCATTCTCCTAGCCAGGCCCTGG - Intergenic
1169162023 20:3388778-3388800 TCCCTCTCCCATCCAGCACCTGG - Intronic
1169975303 20:11319089-11319111 CTCCTCTCCCACCCAGCCCCTGG + Intergenic
1170479792 20:16754492-16754514 ACACTCTCGCAGACACACCCAGG - Intronic
1170525127 20:17228712-17228734 CCTCTCTCCCAGCCACCGCCAGG + Intronic
1171295961 20:24017429-24017451 ACTCTCCCCCTCCCAGCCCCTGG + Intergenic
1171374284 20:24681709-24681731 ACACTGACCCAGCCAGCCTCAGG + Intergenic
1171533390 20:25866567-25866589 ACACGCCCCCTGCCACCCCCCGG - Intronic
1171866096 20:30488412-30488434 CCACTGTCGCGGCCAGCCCCCGG + Intergenic
1172020430 20:31909937-31909959 ATTCCCTCCCACCCAGCCCCTGG - Intronic
1173147794 20:40539878-40539900 ACTCTCTTCCCCCCAGCCCCTGG - Intergenic
1173373934 20:42465930-42465952 ACACTCCCCCAACAGGCCCCAGG + Intronic
1173527233 20:43742517-43742539 ACACTCTCACAGGCATACCCAGG + Intergenic
1174274569 20:49394405-49394427 AAACTCTCCCAGCCTGCACTGGG + Intronic
1174933944 20:54846594-54846616 ACACTCTCACAGACACACCCAGG + Intergenic
1175199547 20:57267847-57267869 CCACTCTCTCACCCAGCCCCAGG - Intergenic
1175552143 20:59824464-59824486 AGGCTCTCCCAGCCAGACTCTGG - Intronic
1175917304 20:62432528-62432550 TCCCTCTCCCAGCCAGCTCTTGG + Intergenic
1175948149 20:62568258-62568280 ACAGTCACACAGCCAGCCCTGGG + Intronic
1176045132 20:63088579-63088601 ACCCTCTCCCAGCAAGCTCCGGG - Intergenic
1176406289 21:6369951-6369973 CTACACTCCCAGCCAGCACCGGG + Intergenic
1176596526 21:8702838-8702860 ACACTCTCACAGACACACCCTGG - Intergenic
1176987485 21:15454783-15454805 ACACTCTCACAGACACACCCAGG - Intergenic
1177506061 21:22018163-22018185 ACACTCTCACAGACACACCCAGG + Intergenic
1178888627 21:36501783-36501805 CCAGGCTCCCAGCCAGCCCCTGG + Intronic
1179178034 21:39022706-39022728 ACACTCACCCAGCCCCCTCCTGG - Intergenic
1179383879 21:40924098-40924120 ACTCTCACCCTGCCAGCTCCAGG - Intergenic
1179832284 21:44004755-44004777 AGAATCTCCCACCGAGCCCCAGG + Intergenic
1180159674 21:45993425-45993447 TCACTCTGCCCGCCAGGCCCTGG - Intronic
1180169233 21:46049277-46049299 CCTCTGTCCCAGACAGCCCCAGG + Intergenic
1180177317 21:46097330-46097352 ACAGTCCCCCAGCCAGGGCCGGG - Intergenic
1180279438 22:10680284-10680306 ACACTCTCACAGACACACCCTGG - Intergenic
1180586652 22:16898819-16898841 ACACTCTCACAGACACACCCTGG - Intergenic
1180716985 22:17878411-17878433 CCACTCTCCGACCCAGCACCAGG + Intronic
1180800568 22:18630037-18630059 ACACCCTCCCAGCCAGCCGCTGG + Intergenic
1180851800 22:19025594-19025616 ACACCCTCCCAGCCAGCCGCTGG + Intergenic
1180863904 22:19104918-19104940 ACAATAGCCCAGCCAGCCCTTGG - Intronic
1181141853 22:20811413-20811435 ACACCCTCACAGCCAGTCCTTGG + Intronic
1181221151 22:21365225-21365247 ACACCCTCCCAGCCAGCCGCTGG - Intergenic
1182073207 22:27477589-27477611 AAACACACCCACCCAGCCCCTGG + Intergenic
1182089438 22:27584012-27584034 GGCCCCTCCCAGCCAGCCCCAGG + Intergenic
1182427077 22:30279570-30279592 ACACCCACCCTGCCAGCCCTGGG + Intergenic
1182661876 22:31930890-31930912 ACACTCTCACAGACACACCCAGG - Intergenic
1182771883 22:32802076-32802098 ATGCTCGCCCAGCCACCCCCAGG + Exonic
1182905687 22:33934208-33934230 TCACTCTCCCAGCCAGGCACCGG - Intergenic
1183270737 22:36861118-36861140 AGTCTCGCCCAGCCAGTCCCAGG - Exonic
1183383414 22:37501863-37501885 ACACTTTCCCAGCCTGACTCAGG + Intronic
1183690074 22:39383355-39383377 ACACTCTCCCCTACAGCCCATGG - Exonic
1184168636 22:42745360-42745382 ACACTCTCACTCCCAGACCCAGG - Intergenic
1184403300 22:44286266-44286288 ACCCTCTCTCAGCCTCCCCCAGG + Intronic
1184410026 22:44321035-44321057 GCAGTCTCCCAGGCAGCCCCAGG - Intergenic
950138839 3:10601455-10601477 AGACTCTCACAGCCAGCCTGGGG - Intronic
950188509 3:10960255-10960277 TCACCCTCCCTGCCAGCCTCAGG + Intergenic
950219078 3:11180610-11180632 CCACTCTCACCTCCAGCCCCTGG + Intronic
950448519 3:13052406-13052428 ACACTGTCCCAGCCACGCCGGGG - Intronic
951331707 3:21377325-21377347 ACACTCTCACAGACACACCCAGG + Intergenic
952082846 3:29781822-29781844 ACCCTCTCCCACACAGCCCACGG - Intronic
953513144 3:43563835-43563857 ACACACACCCACCCAGCCTCTGG - Intronic
953540616 3:43814519-43814541 CCAATCTCCCAGCCAACTCCTGG - Intergenic
953716278 3:45319371-45319393 ACACCCTCCCAGACAGACCAGGG - Intergenic
954379602 3:50212640-50212662 GCACTGCCCCAGGCAGCCCCAGG - Intronic
955701905 3:61690082-61690104 ACACTGTCTCAACCATCCCCTGG + Intronic
955745428 3:62135727-62135749 ACGCTCTCCCCACCAACCCCTGG - Intronic
956292839 3:67679515-67679537 ACTACCTCCCAGGCAGCCCCAGG - Intergenic
957754875 3:84471828-84471850 ACACTCTCACAGACACACCCAGG - Intergenic
961482550 3:127193367-127193389 GCACTCTCCCACCCAACTCCTGG + Intronic
961825428 3:129596722-129596744 ACACCCTCCTCCCCAGCCCCTGG + Intronic
962637729 3:137348240-137348262 ACAGTCTCCCAGAGTGCCCCAGG + Intergenic
964239811 3:154578432-154578454 ACACTCTCACAGACACACCCAGG + Intergenic
966818286 3:183906542-183906564 GCACCCTCCCTGCCAGGCCCTGG + Intergenic
968047473 3:195632128-195632150 CCACTCTTCCAGCCAGGCCTTGG - Intergenic
968307140 3:197657796-197657818 CCACTCTTCCAGCCAGGCCTTGG + Intergenic
968545805 4:1197399-1197421 ACACACTCCCAGGTAGCCCTTGG + Intronic
968678006 4:1895895-1895917 CCCCTCTACCAGCCAGCCCAGGG - Intronic
968962735 4:3753547-3753569 ACAGGCTCCCAGCCACCCCTGGG + Intergenic
969087937 4:4670384-4670406 ACACTCCCCCCCCCAGCACCAGG + Intergenic
969492167 4:7505635-7505657 ACCCTCTCCGTGCCAGGCCCTGG - Intronic
969540148 4:7783692-7783714 ACACTCTACAGGCCACCCCCAGG - Intronic
970127244 4:12828709-12828731 ATACCCTCACAGACAGCCCCAGG - Intergenic
970432463 4:16001423-16001445 TCTCTCTCCAAGCCAGCCCTGGG - Intronic
971769367 4:30876909-30876931 ACCCACTCCCAGACAGGCCCCGG + Intronic
971857674 4:32063018-32063040 ACACCCTCACAGACAGACCCAGG - Intergenic
972121446 4:35709498-35709520 ACACTCTCACAGACACACCCAGG + Intergenic
972277103 4:37567695-37567717 ACGCTCTCCCAGGGAGCACCCGG + Intronic
972308458 4:37855201-37855223 ACCCTTCCCCAGTCAGCCCCTGG + Intronic
972604766 4:40603887-40603909 CCACACTCCCAGCCGGCACCAGG + Intronic
972883437 4:43454948-43454970 ACCCTCTCCCTGCCAGCCTCTGG + Intergenic
976033911 4:80793439-80793461 ACACTCTCACAGACACACCCAGG + Intronic
976549441 4:86378026-86378048 ACACTCTCACAGACACACCCAGG + Intronic
977445867 4:97131158-97131180 ACACTCTCACAGACACACCCAGG - Intergenic
980030214 4:127819650-127819672 GCCCTCTCCCTGCCAGCCACAGG + Intronic
980475131 4:133304544-133304566 ACACTCTCACAGACACACCCAGG - Intergenic
980690454 4:136290005-136290027 GCTCTCTGCCAGACAGCCCCAGG - Intergenic
981018919 4:140004747-140004769 CCGCTCTCCCTGCCAGCCCAGGG + Intronic
982066647 4:151660232-151660254 TGGATCTCCCAGCCAGCCCCTGG + Intronic
982069071 4:151679426-151679448 ACCGCCTCCCAGCCAGTCCCAGG - Intronic
983235833 4:165178480-165178502 ACACCCTCCCAGTCACCCCTGGG - Intronic
984747865 4:183240688-183240710 TCTCTCTCTCTGCCAGCCCCAGG + Intronic
984860125 4:184230439-184230461 CCTCTCTCCCTGCCAGCCCCCGG + Intergenic
985851454 5:2391726-2391748 CCAGTCTCCCAGCCCGCCCCAGG + Intergenic
986264211 5:6178971-6178993 AGACTCTCCCAGCATGCCCTTGG - Intergenic
986440802 5:7779969-7779991 ATACTTTACCAGCCAGCCACGGG + Intronic
986938033 5:12916328-12916350 ACACTCTCACAGACACACCCAGG + Intergenic
987153491 5:15064073-15064095 ACACCCTCCCAGACACACCCAGG - Intergenic
987780987 5:22435061-22435083 ACACCCTCACAGACATCCCCAGG - Intronic
987796798 5:22638591-22638613 ACACCCTCACAGACACCCCCAGG + Intronic
988907250 5:35802291-35802313 GCACTCTCTCAGCAAGGCCCAGG + Intronic
989379363 5:40798230-40798252 ACCCCCTCCCCGCCCGCCCCCGG - Exonic
990438704 5:55821957-55821979 ACGCTCTCCCAGCCAGCGGCGGG + Intergenic
990664728 5:58059470-58059492 ACACTCCCACCACCAGCCCCTGG - Intergenic
992195079 5:74330991-74331013 ACACTCTCACAGACACACCCAGG + Intergenic
994204828 5:97023068-97023090 TCCCTCTCCCCACCAGCCCCTGG + Intronic
995449192 5:112281518-112281540 ACACTCTCCTAGCCAGATGCTGG + Intronic
997294638 5:132761949-132761971 AGACTCTCCCTCCCTGCCCCTGG + Intronic
997465351 5:134084417-134084439 AGACACTCCAAGCCAGACCCTGG + Intergenic
997633413 5:135386920-135386942 ACACAAACCCAGGCAGCCCCTGG - Intronic
997654081 5:135542715-135542737 ACACATTCCCACCCACCCCCCGG + Intergenic
1001063260 5:168512837-168512859 ACACTCTCACAGACACACCCAGG + Intronic
1001433339 5:171680686-171680708 CCACCTTCCCAGCCAGCCACAGG - Intergenic
1001920224 5:175594080-175594102 ACCCTCTTCCAGCCACCCCTTGG + Intergenic
1002259134 5:177982144-177982166 CCACTCTCCCTCCCACCCCCAGG + Intergenic
1003115594 6:3281800-3281822 ACATTCTCCCAGCCTGGCCCAGG + Intronic
1003691805 6:8362199-8362221 ACACTCTCACAGACATACCCAGG + Intergenic
1004274489 6:14223224-14223246 GCACTCTGACAGCCAGGCCCAGG - Intergenic
1007288188 6:40763235-40763257 ACACTCTGCCAGCGAGAGCCTGG + Intergenic
1008561933 6:52732503-52732525 ACACCATCCAAGCCATCCCCGGG + Intergenic
1010323864 6:74542898-74542920 ACACTCTCACAGACACACCCAGG - Intergenic
1010809914 6:80289664-80289686 TCACTCTCACCGCCAGCCTCTGG + Intronic
1016903817 6:149129465-149129487 ACACTCTCACAGACATGCCCAGG + Intergenic
1019394248 7:808487-808509 ACCCTCTCCCTTCCGGCCCCTGG + Intergenic
1019651766 7:2163251-2163273 ACACTCCCAGAGCAAGCCCCTGG - Intronic
1019664782 7:2246386-2246408 ACACTCTCCCAGCCAACGTCAGG - Intronic
1020148324 7:5662384-5662406 TCACTCCCTCAACCAGCCCCTGG + Intronic
1020277193 7:6631904-6631926 CCAGGCTCCCTGCCAGCCCCTGG + Intergenic
1021120958 7:16795163-16795185 CCACTCTACTACCCAGCCCCTGG + Intronic
1023180308 7:37475629-37475651 ACACTCTCACAGACACACCCGGG + Intergenic
1023393203 7:39730039-39730061 ACACCTTTCCAGCCAGCCCTGGG - Intergenic
1023861395 7:44219558-44219580 CCCCTCTCCCATCCACCCCCAGG + Intronic
1023864330 7:44231766-44231788 AGACTCTCCCACCCTGCTCCAGG + Intronic
1024249510 7:47495655-47495677 GCAGTCTCCCAGCCAGAGCCAGG + Intronic
1024717213 7:52093045-52093067 ACCCTCTCCCAGACAGCACCTGG - Intergenic
1026633092 7:72055226-72055248 ACCCTGCCCCACCCAGCCCCAGG - Intronic
1026863995 7:73811295-73811317 TCACCTTCCCAGCCAGACCCTGG + Intronic
1027796444 7:82699881-82699903 ACACACACACAGCCAGCCCTTGG - Intergenic
1029028213 7:97440617-97440639 ACTCCCTCCTATCCAGCCCCTGG - Intergenic
1030458546 7:109802872-109802894 ACACTCTCACAGACACACCCAGG + Intergenic
1031440987 7:121794393-121794415 ACACTCTCGCAGACAAACCCAGG - Intergenic
1031671517 7:124552977-124552999 CCACTCACCCACCTAGCCCCTGG - Intergenic
1031753762 7:125612253-125612275 ACACTCTCACAGACATACCCAGG - Intergenic
1031988123 7:128177031-128177053 CCACACACCCAGCCAGCCTCTGG - Intergenic
1032091670 7:128914583-128914605 AAAATCTCACAGCCAACCCCAGG + Intergenic
1035457399 7:159017476-159017498 CCCCTCTTCCAGCCAGCCCAGGG + Intergenic
1035751655 8:2001238-2001260 TCGCTCTCCCCGGCAGCCCCGGG - Exonic
1036574909 8:10018539-10018561 CAACTCCCCTAGCCAGCCCCTGG + Intergenic
1037613385 8:20495461-20495483 CCACGATCCCAGCCAGCTCCTGG + Intergenic
1037695688 8:21221965-21221987 ACACCCTCACAGACACCCCCAGG - Intergenic
1037748420 8:21664207-21664229 GTACCCTCCAAGCCAGCCCCAGG + Intergenic
1038467109 8:27774462-27774484 CCAATCACCGAGCCAGCCCCTGG + Exonic
1038629373 8:29226532-29226554 ACACTCACCCATCCAACCCTTGG + Intronic
1038800404 8:30744087-30744109 ACCCTCTCCCAGCCGGCCCGCGG + Intronic
1039117861 8:34112635-34112657 ACAGCTTCCCAGCCAGACCCTGG - Intergenic
1039134780 8:34309195-34309217 CCCTCCTCCCAGCCAGCCCCTGG - Intergenic
1039323888 8:36464133-36464155 ACACTCTCACAGACACACCCAGG + Intergenic
1040105891 8:43541774-43541796 ACACCCTCCAAGCCTTCCCCAGG + Intergenic
1040709551 8:50171564-50171586 ACACTCTCACAGACACACCCAGG + Intronic
1041210769 8:55548914-55548936 ACACTCTCACAGACACACCCAGG - Intergenic
1043569627 8:81588164-81588186 ACACTCTCACAGACACACCCAGG + Intergenic
1044201943 8:89448854-89448876 ACACCCTCACAGACAGGCCCAGG - Intergenic
1044488745 8:92786834-92786856 CCACTCACCCAGACAGCTCCAGG - Intergenic
1045108281 8:98915121-98915143 ACACTCTCACAGACACACCCAGG - Intronic
1045781519 8:105869487-105869509 ACACTCTCACAGACACACCCAGG + Intergenic
1048042964 8:130748625-130748647 ACACTCTCACAGACACACCCAGG + Intergenic
1048176521 8:132157526-132157548 ACACTCTCCCAGCCAGCCACTGG - Intronic
1048621107 8:136133784-136133806 AAACTCTGCCAGTCAGCCTCTGG + Intergenic
1049107260 8:140622218-140622240 ATTCGCTCCCACCCAGCCCCTGG - Intronic
1049570575 8:143368631-143368653 ACAACCTGCCAGCCAGCCGCGGG + Intergenic
1049612693 8:143562762-143562784 ACACTCGTCCAGCAAGACCCAGG - Exonic
1049949171 9:627707-627729 GCACTCTCCCATCCACCCTCTGG - Intronic
1050813635 9:9781012-9781034 CCACCCTCCCTGCCAACCCCTGG - Intronic
1051230148 9:14947563-14947585 ACACTCCCCGAGACAGACCCTGG - Intergenic
1052465343 9:28822461-28822483 ACACCCTCACAGACATCCCCAGG - Intergenic
1053073418 9:35114501-35114523 ACCCTCTCCCAGCCAGCCCAGGG + Intronic
1053695573 9:40636414-40636436 ACACTCTCACAGACACACCCTGG - Intergenic
1053942563 9:43267457-43267479 ACACTCTCACAGACATACCCTGG - Intergenic
1054306820 9:63435636-63435658 ACACTCTCACAGACACACCCTGG - Intergenic
1054405551 9:64759626-64759648 ACACTCTCACAGACACACCCTGG - Intergenic
1054439176 9:65245115-65245137 ACACTCTCACAGACACACCCTGG - Intergenic
1054491230 9:65776826-65776848 ACACTCTCACAGACACACCCTGG + Intergenic
1058602499 9:106685016-106685038 AGACCCTCCAAACCAGCCCCAGG - Intergenic
1058768383 9:108205883-108205905 ACACTCTCACAGACACACCCAGG + Intergenic
1061096217 9:128458110-128458132 CCACCCTCCCTGCCACCCCCTGG + Intronic
1061423504 9:130484972-130484994 CCACCCTCCCAGGCAGCCTCCGG - Intronic
1061431861 9:130536357-130536379 CCACTCCCCCAGCCAGAGCCTGG + Intergenic
1061886542 9:133593822-133593844 CCACTGGCCCTGCCAGCCCCTGG - Intergenic
1062042363 9:134409974-134409996 ACTTCCTCCCCGCCAGCCCCTGG + Intronic
1062137902 9:134939303-134939325 GCACTCACCCTGCCACCCCCAGG + Intergenic
1062391012 9:136333888-136333910 AAGCTCTCCCAGCCAGGGCCTGG - Intronic
1062458694 9:136653783-136653805 ACCCACTCCCTGCCAGCCCCCGG - Intergenic
1062570432 9:137182629-137182651 CCACTGTGCCTGCCAGCCCCGGG + Intronic
1062574184 9:137198945-137198967 ACTCTCTCCCTGCCAGCCAGTGG + Intronic
1062733474 9:138121702-138121724 AGACCCCCTCAGCCAGCCCCTGG + Exonic
1202778018 9_KI270717v1_random:10030-10052 ACACTCTCACAGACACACCCTGG - Intergenic
1203736511 Un_GL000216v2:143663-143685 ACACCCTGCCAGCCTGTCCCAGG - Intergenic
1186368404 X:8920352-8920374 ACACTCTCACAGACACACCCGGG - Intergenic
1186974194 X:14882326-14882348 ACCCTCACCCCTCCAGCCCCTGG - Intronic
1187610214 X:20934778-20934800 ACACTCTCTCTGCCAGCCTTTGG + Intergenic
1188194132 X:27209619-27209641 ACACTTCCACACCCAGCCCCAGG - Intergenic
1189336611 X:40174352-40174374 AGACGCTCCCAGCCAGCCTCCGG + Intronic
1190160508 X:48028516-48028538 ACACACTCACAGCCACACCCAGG + Intronic
1190545613 X:51523246-51523268 ACACCCTCACAGACAGACCCAGG + Intergenic
1190618413 X:52262107-52262129 ACACTCTCCCAGCCAGCCCCTGG + Intergenic
1191089849 X:56608341-56608363 ACACTCTCACAGTCACACCCAGG - Intergenic
1191162059 X:57340357-57340379 ACACTCTCACAGACACACCCAGG + Intronic
1193391558 X:80935304-80935326 ACACCCTCCCAGACACACCCAGG - Intergenic
1193408603 X:81135665-81135687 TCTCCCTCCCTGCCAGCCCCAGG - Intronic
1193914520 X:87349538-87349560 ACACTCTCACAGACACACCCAGG + Intergenic
1194385729 X:93252568-93252590 CCACTACCCCACCCAGCCCCTGG + Intergenic
1194604861 X:95965835-95965857 ACACCCTCACAGACAGACCCAGG + Intergenic
1196099914 X:111837219-111837241 AGACTCTACCAGCCAGGGCCAGG + Intronic
1196605406 X:117651986-117652008 ACACTCTCTCAGACACACCCAGG - Intergenic
1197013778 X:121599063-121599085 ACACTCTCACAGACACACCCAGG + Intergenic
1197044692 X:121980714-121980736 ACACCCTCACAGACAGACCCAGG - Intergenic
1197244751 X:124156567-124156589 ACACTCTCACAGACACACCCAGG + Intronic
1197821501 X:130545227-130545249 CCATGCTCCCAGCCAGGCCCAGG + Intergenic
1198159378 X:133991700-133991722 ATACCCTACCAGCCAGGCCCAGG + Intergenic
1198276322 X:135098330-135098352 ACAGTGTCCCCGCCCGCCCCCGG - Intergenic
1198700798 X:139396285-139396307 ACACTCTCACAGACACACCCAGG - Intergenic
1200888177 Y:8293083-8293105 ACATTCTCCAAGGCAGCCCATGG + Intergenic
1201193349 Y:11468322-11468344 ACACTCTCACAGACACACCCTGG - Intergenic
1201482585 Y:14455755-14455777 ACACTCACCCATCCAAACCCAGG - Intergenic