ID: 1190620119

View in Genome Browser
Species Human (GRCh38)
Location X:52278882-52278904
Sequence ACAGGCTTTAAGGGTCAACC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 92
Summary {0: 1, 1: 2, 2: 3, 3: 6, 4: 80}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1190620119_1190620127 18 Left 1190620119 X:52278882-52278904 CCTGGTTGACCCTTAAAGCCTGT 0: 1
1: 2
2: 3
3: 6
4: 80
Right 1190620127 X:52278923-52278945 CCATTTCCATGCAATCAATTTGG 0: 1
1: 0
2: 1
3: 8
4: 139
1190620119_1190620122 -10 Left 1190620119 X:52278882-52278904 CCTGGTTGACCCTTAAAGCCTGT 0: 1
1: 2
2: 3
3: 6
4: 80
Right 1190620122 X:52278895-52278917 TAAAGCCTGTATCTCGACCCTGG 0: 1
1: 0
2: 1
3: 8
4: 64

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1190620119 Original CRISPR ACAGGCTTTAAGGGTCAACC AGG (reversed) Intergenic
900888540 1:5432445-5432467 ACAGGCATTAAGGGTCCCCCAGG + Intergenic
902488680 1:16764879-16764901 ACTGGCTGGAAGGGTCAGCCAGG - Intronic
903539989 1:24091415-24091437 CCAGGCTTGGAGGGTCAACCTGG - Intronic
903849003 1:26295228-26295250 ACAGGCCTTGTGGGTCATCCTGG - Intronic
906111125 1:43322785-43322807 AGAGGCTGTAAGGGTCAGACTGG - Exonic
909623422 1:77689871-77689893 ACAGGAGTTCAAGGTCAACCTGG + Intergenic
911420340 1:97633351-97633373 CCAGGCTTTCAGGGAAAACCTGG - Intronic
915590430 1:156867314-156867336 AGAGGCTTTAAGTGCCCACCAGG - Intronic
923531760 1:234817640-234817662 ACTGGCTGGAAGGGTCAGCCAGG + Intergenic
1062772714 10:115870-115892 TCAGGCTTTAATGGGAAACCTGG + Intergenic
1070337046 10:75465059-75465081 AGAGCATTTAAGGGTCAGCCAGG - Intronic
1076190748 10:128481851-128481873 ACACTGTTTAAGGGCCAACCTGG - Intergenic
1077166081 11:1139558-1139580 ACTGGGTTTAGGGGTCATCCCGG + Intergenic
1087683425 11:101238878-101238900 TCAGGGTTTATGGGTCAAACTGG + Intergenic
1087880763 11:103413493-103413515 ACAGGCTTTAATGCTCTACCAGG - Intronic
1089465900 11:118686392-118686414 ACAGGATTTCAGGGCCAGCCTGG - Intergenic
1091855464 12:3735899-3735921 ACAGGCTTATAGTGTCAAGCAGG - Intronic
1092232816 12:6786303-6786325 ACAAGCATTAAGGGTCTTCCAGG + Intergenic
1098821033 12:75229630-75229652 ACAGGCTTAAAGGGAAAAACAGG - Intergenic
1105433067 13:20354952-20354974 TTAGGCATTAAGGGTAAACCTGG - Intergenic
1105905345 13:24804059-24804081 CCAGGAGTTCAGGGTCAACCTGG + Intronic
1110434446 13:75463777-75463799 ACAGGTTTTAGGGGTAAATCAGG - Intronic
1112463629 13:99624243-99624265 ACAGGCATAAAGGGTGAACGTGG - Intronic
1112598458 13:100831553-100831575 ACAGGCTTTAGGACTCAACGTGG - Intergenic
1117277769 14:54206859-54206881 ACAGGTTTGAATAGTCAACCTGG + Intergenic
1121228252 14:92337471-92337493 ACAGGCTAGAGGGGTCAGCCAGG - Intronic
1121257108 14:92539110-92539132 ACAGGATTTAGGGGCCAAGCTGG - Intronic
1123819647 15:24015192-24015214 ACTGGCCTTAAGGGTCAACCAGG + Intergenic
1123874956 15:24614752-24614774 ACTGTCTTTAAGGGTCAACCAGG + Intergenic
1128741631 15:70087907-70087929 CCAGGCTTGGAGGGTTAACCAGG - Intronic
1131131685 15:89904498-89904520 CCAGGCTCTCAGGGTCTACCTGG + Intronic
1138026080 16:53523475-53523497 ACAGGCTCTAACAGTCACCCAGG - Intergenic
1139681206 16:68565242-68565264 ACAGCCTATAAGGGTAAAGCTGG + Exonic
1141346636 16:83252640-83252662 ACATGGATTAAGGGCCAACCTGG + Intronic
1143047509 17:4094042-4094064 CCAGGCTTTAAGGGGCAACAAGG - Intronic
1146130483 17:30269637-30269659 ACAGGTTTTTAGGGTTACCCAGG - Intronic
1146198536 17:30833980-30834002 ATAGGCTTTAAAGTTAAACCAGG - Intronic
1148259516 17:46168265-46168287 ACCAGCCTTAAGAGTCAACCCGG + Intronic
1151916463 17:77121759-77121781 ACAGCCTTTAACGGTGAATCAGG + Intronic
1163017256 19:14463993-14464015 GCAGGCTTCAAGGGGCAGCCGGG - Intronic
1167054351 19:47099786-47099808 CCAGGGTTTATGGATCAACCTGG + Intronic
926763105 2:16297000-16297022 ACAGGGTTTAGGGGTCTACTAGG - Intergenic
933409737 2:81910191-81910213 ACAGGCTTGAAGGGTGAACGTGG + Intergenic
933877656 2:86634647-86634669 ACATGTTTTAAGTGTCAATCTGG + Intronic
934801978 2:97172548-97172570 ACATGCTTTAAGGGGGAAACAGG - Intronic
939571432 2:143845025-143845047 ACAGGCTATAAAGGTCAAAATGG + Intergenic
944203492 2:197133482-197133504 TCAGGGTTTGAGGTTCAACCAGG - Intronic
1175127178 20:56761058-56761080 ACAGGATTTGAAGATCAACCAGG + Intergenic
1182515910 22:30858994-30859016 CCAGGCTGTGAGCGTCAACCAGG + Intronic
1182563412 22:31179756-31179778 ACAGGCATGAGGGGACAACCAGG - Intronic
949318542 3:2783828-2783850 ACATTCATTAAGTGTCAACCTGG - Intronic
950173916 3:10858526-10858548 ACATCCTCTAAGGGGCAACCTGG - Intronic
950748800 3:15112487-15112509 ACCGGCTTTAAGGGTAAACCAGG + Intergenic
950869116 3:16213573-16213595 ACAGCATTTATGGGTCAATCTGG - Intronic
953963688 3:47285575-47285597 TTAGGCTGTAAGGGTGAACCAGG + Intronic
958917681 3:100067815-100067837 AGAGGCTTTAATGGCCACCCAGG + Intronic
960252659 3:115473423-115473445 ACTGGCCTTAAGGGTCAGTCAGG - Intergenic
961051559 3:123751230-123751252 CAAGGCTTTAAGTGTCAGCCAGG + Intronic
967111998 3:186302034-186302056 TCATGCTTTAAGGCCCAACCCGG + Intronic
968242822 3:197107167-197107189 ACATGCTCCAAGGGTGAACCTGG - Intronic
969357662 4:6639975-6639997 AGGGGCTTTAAGCGTCCACCTGG + Intergenic
974858560 4:67491661-67491683 ACCAGCTTTAAGGTTAAACCTGG + Intronic
975626928 4:76359701-76359723 ACAGGCTTTTAGGAGCAGCCAGG - Intronic
978451400 4:108838132-108838154 AAAGGATTGAAGGGTGAACCAGG - Intronic
984309050 4:178033201-178033223 CCAGGCTTTAAGGGTCAACCAGG + Intergenic
984855178 4:184189021-184189043 ACAGACTTGAATGGTCACCCTGG - Intronic
984917334 4:184736234-184736256 ACAGGGTTTATGGGTCAAATTGG - Intergenic
988396648 5:30704439-30704461 ACATGCTTTAAGGGGCAAAAAGG + Intergenic
991771245 5:70042992-70043014 ACAGGCATTAAGGGCACACCAGG - Exonic
991850537 5:70918409-70918431 ACAGGCATTAAGGGCACACCAGG - Exonic
992260659 5:74966905-74966927 AGAGGCTTTAAAGGAGAACCTGG - Intergenic
997978732 5:138455680-138455702 AGAGGCTTTAAGGGCCACCCTGG - Intergenic
1000877211 5:166655677-166655699 ACAGGCTTTCACTGTCACCCAGG + Intergenic
1002272824 5:178083874-178083896 AAAGGCCTTGAGGGTCAAGCTGG + Intergenic
1005398573 6:25408260-25408282 ACAGGCTTTTACTGTCACCCGGG - Intronic
1007426260 6:41748185-41748207 AGAGGCTTTCAAGGTCAAACAGG + Intronic
1022311069 7:29195988-29196010 ACAGTATTTAAGGGTCAAGAAGG + Intronic
1026477935 7:70752876-70752898 AAGAGCTTTTAGGGTCAACCTGG - Intronic
1026950100 7:74341086-74341108 ACAGGCTTGAAGATTCAACGGGG - Intronic
1030334512 7:108310168-108310190 ACATGCTTTAAGGTGCAGCCTGG + Intronic
1030697080 7:112597351-112597373 ACAGGTTTTAAGGACCAACTTGG - Intergenic
1032714106 7:134489619-134489641 ACAGGCTTTAGGGGTCAACCAGG + Intergenic
1039401362 8:37272321-37272343 ACAGGCTTAAAGGGAGACCCAGG + Intergenic
1044677149 8:94740858-94740880 AGAGTATTTTAGGGTCAACCAGG - Intronic
1047761259 8:127956194-127956216 ACAAGCACTAAGGCTCAACCTGG - Intergenic
1057398692 9:94703286-94703308 AGAGGCTTTTTAGGTCAACCAGG - Intergenic
1187979357 X:24738639-24738661 ATTGGCTTTAAGAGTCACCCAGG - Intronic
1189559851 X:42181247-42181269 AGAGGCTTTAAAGATCACCCAGG + Intergenic
1190620119 X:52278882-52278904 ACAGGCTTTAAGGGTCAACCAGG - Intergenic
1190935586 X:54996514-54996536 AAAGTCTTAAAGGGTAAACCTGG + Intronic
1193325971 X:80178964-80178986 ACATACTTTAAGGGCAAACCTGG - Intergenic
1195476240 X:105289159-105289181 TCAGACTTTAAGGAACAACCAGG + Intronic