ID: 1190621309

View in Genome Browser
Species Human (GRCh38)
Location X:52289105-52289127
Sequence GTGCATGAGCAAGTGAACAC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 220
Summary {0: 1, 1: 2, 2: 2, 3: 25, 4: 190}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1190621309_1190621314 13 Left 1190621309 X:52289105-52289127 CCTGTGTTCACTTGCTCATGCAC 0: 1
1: 2
2: 2
3: 25
4: 190
Right 1190621314 X:52289141-52289163 ATGCCTGTCTTGCCCTTGGCAGG 0: 1
1: 29
2: 58
3: 138
4: 378
1190621309_1190621316 18 Left 1190621309 X:52289105-52289127 CCTGTGTTCACTTGCTCATGCAC 0: 1
1: 2
2: 2
3: 25
4: 190
Right 1190621316 X:52289146-52289168 TGTCTTGCCCTTGGCAGGCCTGG 0: 1
1: 2
2: 54
3: 137
4: 402
1190621309_1190621320 30 Left 1190621309 X:52289105-52289127 CCTGTGTTCACTTGCTCATGCAC 0: 1
1: 2
2: 2
3: 25
4: 190
Right 1190621320 X:52289158-52289180 GGCAGGCCTGGAATCTGGACTGG 0: 1
1: 0
2: 2
3: 51
4: 347
1190621309_1190621318 25 Left 1190621309 X:52289105-52289127 CCTGTGTTCACTTGCTCATGCAC 0: 1
1: 2
2: 2
3: 25
4: 190
Right 1190621318 X:52289153-52289175 CCCTTGGCAGGCCTGGAATCTGG 0: 1
1: 1
2: 41
3: 112
4: 287
1190621309_1190621313 9 Left 1190621309 X:52289105-52289127 CCTGTGTTCACTTGCTCATGCAC 0: 1
1: 2
2: 2
3: 25
4: 190
Right 1190621313 X:52289137-52289159 CTCTATGCCTGTCTTGCCCTTGG 0: 1
1: 2
2: 48
3: 104
4: 376

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1190621309 Original CRISPR GTGCATGAGCAAGTGAACAC AGG (reversed) Intergenic
904370209 1:30043460-30043482 GTGTGTGAGCAAGTGAGCATGGG - Intergenic
905807350 1:40886488-40886510 CTGAATAAACAAGTGAACACTGG + Intergenic
906913644 1:49983438-49983460 GTGTGTGAGCAAGTGAGCATGGG - Intronic
913551562 1:119921749-119921771 GTACTGGAACAAGTGAACACTGG - Exonic
916289886 1:163153573-163153595 CTACATGAGCAATTGTACACTGG - Intronic
918471456 1:184880032-184880054 GTTCATGACGATGTGAACACTGG + Intronic
919304368 1:195811182-195811204 ATACATGAGCAAGTGGAAACAGG + Intergenic
919304655 1:195816469-195816491 GTACATAAGCAAATTAACACAGG - Intergenic
920928395 1:210364552-210364574 CAGCGTGAGAAAGTGAACACAGG + Intronic
921015777 1:211189445-211189467 GTTGATGAGCCAGTGAAAACTGG + Intergenic
921826272 1:219675242-219675264 GTAAATGAGCAAATGAACAAAGG + Intergenic
923077438 1:230622733-230622755 ATGCTTGAGCCAGTGAAGACTGG + Intergenic
1063089945 10:2855152-2855174 GTGCTGGAACAACTGAACACAGG + Intergenic
1063858327 10:10280472-10280494 GTGTATGAGCTACTGTACACAGG - Intergenic
1064014692 10:11762993-11763015 TTGCAGGAGCAAGAGAACACGGG + Intronic
1064336491 10:14448102-14448124 GTGAATAAGCAAATGAACAAGGG + Intronic
1065513864 10:26505971-26505993 GTGAATGAAGGAGTGAACACTGG - Intronic
1065825853 10:29570856-29570878 GTGTATAAGTAACTGAACACAGG + Intronic
1067018154 10:42772808-42772830 GTGTGTGAGCAAGTGAGCATGGG - Intergenic
1067270456 10:44787360-44787382 GTGAGTGAGCAAGTGACCATTGG + Intergenic
1067279493 10:44860686-44860708 GTGAATGAGAAAGTGCACAGAGG + Intergenic
1067668071 10:48295598-48295620 GTGCATGTGCATGTGCATACAGG + Intergenic
1068444000 10:57096307-57096329 GTGCATGAGCAAGTGAGTGCAGG - Intergenic
1070401269 10:76055635-76055657 GTACATGAGCAAGCAAGCACAGG + Intronic
1073219541 10:101858703-101858725 GTGCATTAGCAGGTGGACGCAGG + Intronic
1073572721 10:104594200-104594222 ATGAATGAGCAAATGAACATAGG - Intergenic
1074979453 10:118608148-118608170 GTGTGTGAGCAAGTGAGCGCGGG + Intergenic
1076899120 10:133328483-133328505 GTCCTTGGGCAAGTGACCACTGG - Intronic
1077223780 11:1429039-1429061 GTGCATGCACATGTGTACACAGG + Intronic
1078969800 11:16395098-16395120 GTGAATGAGAAAGTGAAAAAAGG - Intronic
1079736826 11:24007979-24008001 GTGGATGAGCCACTGAACCCAGG + Intergenic
1081044004 11:38249878-38249900 GTGTGTGAGCAAATGAGCACGGG + Intergenic
1081767246 11:45620295-45620317 GTGCATGAGCAAGCGAACACAGG + Intergenic
1083587803 11:63873005-63873027 GCGCATGAGTATGTGAACTCTGG + Intronic
1083602255 11:63956044-63956066 GTGCAGGAGCCTGTGTACACAGG + Exonic
1086249459 11:84795962-84795984 GTGTGTGAGCAAGTGAGCATGGG - Intronic
1088572514 11:111236795-111236817 GGCCATGAGCAAAGGAACACGGG - Intergenic
1088651268 11:111959502-111959524 GTGTGTGATCAAGTGAACATGGG - Intronic
1091179133 11:133587894-133587916 GGGCCTGAGCAAGTGAGCAAGGG - Intergenic
1092123056 12:6057834-6057856 GCGCATGAGTATGTGAACCCGGG - Exonic
1092295815 12:7199297-7199319 GCACATAAGCAAGTGAACAAAGG + Intronic
1093899807 12:24618943-24618965 GAGAATGAGCAAGTGACCAATGG + Intergenic
1093939621 12:25039142-25039164 GCAAATGAGCAAATGAACACAGG + Intronic
1095443958 12:42266874-42266896 GTGCATGAGCGAGTGAGCACGGG + Intronic
1095815367 12:46416163-46416185 TTGTATGACCAAGTGACCACAGG + Intergenic
1098519533 12:71420301-71420323 GTGTGTGGGCAAGCGAACACAGG + Intronic
1098757338 12:74382477-74382499 GAGCAGCAGCATGTGAACACAGG + Intergenic
1100266207 12:92978730-92978752 AGGCATGGGCAAGTGTACACAGG - Intergenic
1101206572 12:102494186-102494208 TTTGATGAGCAAGTGAATACAGG - Intergenic
1101962618 12:109261253-109261275 ATGAATGAGGGAGTGAACACAGG - Intronic
1103221258 12:119247579-119247601 GAGCAGGAGCAAGAGAACAAGGG - Intergenic
1104337793 12:127916628-127916650 GGACATGAGCAAAGGAACACTGG + Intergenic
1107229220 13:38087369-38087391 GTGTATGAACAAGTGAGTACGGG - Intergenic
1108911110 13:55552130-55552152 GTGCAAGAACAAATGAATACAGG + Intergenic
1109611488 13:64771111-64771133 GAGCAGGAGCAAGAGAACAAGGG - Intergenic
1112609458 13:100941773-100941795 GTTCATGAGCAAATGAATAGAGG - Intergenic
1113888335 13:113723223-113723245 ATGTATGTGCAAGTGCACACAGG - Intronic
1114269300 14:21091410-21091432 GTGCATCTGCGAGTGCACACAGG - Exonic
1115081625 14:29459666-29459688 ATGCAATAGCAAGAGAACACTGG + Intergenic
1115272519 14:31569655-31569677 GTGCCTGAGCCAGTGCATACTGG + Intronic
1117009459 14:51455653-51455675 GTCCAAGAGCAGGAGAACACTGG + Intergenic
1118199992 14:63662953-63662975 GTGTGTGAGCAAGTGAGCACGGG + Intergenic
1119257035 14:73207818-73207840 GTGCATGAGCAAGTGAGTGCAGG + Intronic
1120106165 14:80497858-80497880 GTGCGTGTGCACGTGCACACCGG - Intronic
1120416382 14:84223154-84223176 GGACATGAGCTAGTGAAGACTGG - Intergenic
1121616407 14:95316636-95316658 TTGGATGAGCAAGTGAGCAGAGG + Intronic
1123008651 14:105336533-105336555 GTGCAGGAGCGAGTGAGGACAGG + Intronic
1124336299 15:28859710-28859732 GTGCGTGAGCATGTGCATACAGG + Intergenic
1124805497 15:32877855-32877877 ATGAATGAGCAAATGAACAATGG - Intronic
1127443219 15:59032862-59032884 ACGCATGAGCAAGAGCACACAGG - Intronic
1127463809 15:59224821-59224843 GAGCTGGAGCAAGAGAACACAGG + Exonic
1127693988 15:61426078-61426100 CTACATGAGCAAGTCTACACCGG - Intergenic
1132112045 15:99108762-99108784 GTGCCTGAGCAACTGACCGCTGG + Intronic
1137909098 16:52357954-52357976 GTGCAAGAGCAAGAGAGCAAGGG + Intergenic
1138863755 16:60791948-60791970 GGGCATGAGTGTGTGAACACAGG + Intergenic
1139532306 16:67548329-67548351 GGGGAAGAGGAAGTGAACACTGG + Intergenic
1141443661 16:84044926-84044948 GTGCATGAGCCAGTGCTCCCGGG + Intergenic
1143993586 17:10987944-10987966 GTGCTTGTACAAATGAACACTGG + Intergenic
1148986880 17:51630229-51630251 GTGCAGGAGCAATTGCATACGGG - Intergenic
1149090595 17:52773547-52773569 GTGCATGAATATGTGAACAAGGG - Intergenic
1152049793 17:77964107-77964129 GTTCATGAGAAAGTGGAAACTGG - Intergenic
1153139238 18:1953750-1953772 GTACATGAGCAAGAGAGCATGGG + Intergenic
1158322571 18:56279768-56279790 TTGAAAGAGCAAGTGACCACAGG + Intergenic
1158975302 18:62705850-62705872 GTGACTGGGCAAGAGAACACTGG - Intergenic
1159774180 18:72584952-72584974 GTGTGTGAGCAAGTGAGCACAGG + Intronic
1161390604 19:4018540-4018562 GTGCAAGATCAGGTGACCACGGG - Intronic
1162595177 19:11623094-11623116 GTAAAAGAGCAATTGAACACAGG - Intergenic
1165610956 19:37152010-37152032 GTGCATCAGCCAGTTCACACAGG - Exonic
1165614324 19:37185648-37185670 GTGCATCAGCCAGTTCACACAGG - Exonic
1166091725 19:40513577-40513599 GTGCATGAGGAAGGGGACCCCGG - Intronic
925363894 2:3297958-3297980 GTGAATGAGCAAATGAACAAAGG - Intronic
925475094 2:4204476-4204498 GTGCATTTCCAAGTGACCACAGG - Intergenic
925608893 2:5686721-5686743 ATGCAGGAGGAAGTGAACTCAGG + Intergenic
926594144 2:14771677-14771699 GGGCATGAGAAAGTGAATAAAGG + Intergenic
927236357 2:20879384-20879406 GTGTGTGAGCAAGTGAGCATGGG + Intergenic
927256686 2:21045549-21045571 GTGGATGAGCAACTGATCACTGG - Intergenic
927430034 2:23019660-23019682 GTGCCTGAGGCAGTGAGCACTGG - Intergenic
930946713 2:57084548-57084570 CTGCCTGAGCATGTGCACACCGG + Intergenic
931415047 2:62072893-62072915 GTGTGTGAGCAAGTAAGCACAGG - Intronic
932624466 2:73286263-73286285 GTGCATATGCAAGTGTACATAGG + Intergenic
933455030 2:82508877-82508899 CTGCAAGAACAAGTGAGCACAGG - Intergenic
933606412 2:84389142-84389164 GTGTGTGGGCAAGTGAGCACAGG + Intergenic
938130220 2:128708859-128708881 GAGCAGGAGCAAGAGAACAAGGG + Intergenic
938615240 2:132990930-132990952 ATGAATGAGCAAATGAACAGAGG + Intronic
939996102 2:148921354-148921376 GTGCATGAGAAAGAAAACACAGG + Intronic
940599567 2:155841573-155841595 GTGCAAGAGAAAGGGAACACAGG - Intergenic
940694147 2:156958587-156958609 ATGTGTGAGCAAGCGAACACTGG + Intergenic
940878411 2:158921850-158921872 GTGCATGAGCAAGCAAGCACAGG + Intergenic
940956833 2:159738070-159738092 GTGCATGGGCAAGTGAGCGCAGG + Intronic
943324995 2:186486683-186486705 GTGCATGGGTGGGTGAACACGGG - Intronic
943960338 2:194255230-194255252 GTTCATGAGCAAGTGAACACAGG - Intergenic
946083932 2:217151974-217151996 GGGAATGAGCAAGGCAACACTGG + Intergenic
946126407 2:217566864-217566886 GTCCAGGAGGAAGAGAACACTGG + Intronic
946662838 2:222019460-222019482 TTGCATGAGTAACTGAACACTGG + Intergenic
947054705 2:226087288-226087310 GTGTGTGAGCAAGTGAGCACAGG + Intergenic
948219398 2:236257722-236257744 GTTGACCAGCAAGTGAACACAGG + Intronic
948489952 2:238306198-238306220 GTGCATGAGCCAGAGAATGCAGG + Intergenic
948495339 2:238345262-238345284 GCGCATGAGCCAGTGAAGTCAGG + Intronic
1171749697 20:29036809-29036831 GTGCATGAAGTAGAGAACACTGG + Intergenic
1172857323 20:38015433-38015455 GTGTATGAGCCAGTGCACATGGG - Intronic
1173669941 20:44791903-44791925 GTACATTAGGAAGTGGACACAGG - Intronic
1173969591 20:47141750-47141772 GTGCATGGGGAAGTGTGCACTGG + Intronic
1174156940 20:48521717-48521739 GGCCATGACCAAGTGGACACAGG - Intergenic
1175599053 20:60257855-60257877 TTGCATGAGCAGGTGCACACAGG - Intergenic
1176315538 21:5239190-5239212 GTGCATGAAGTAGAGAACACTGG - Intergenic
1179410795 21:41161664-41161686 GGCCATGAGCCAGGGAACACAGG - Intergenic
1180367994 22:11957866-11957888 GTGTGTGAGCAAGTGAGCATGGG - Intergenic
1180393333 22:12305144-12305166 GTGCATGAAGTAGAGAACACTGG - Intergenic
1180406417 22:12559624-12559646 GTGCATGAAGTAGAGAACACTGG + Intergenic
1181884856 22:26012554-26012576 AGGCCTGAGCAAGTGAAAACAGG + Intronic
1181910105 22:26231800-26231822 GTGGCTAAGCAAGTGACCACTGG + Intronic
1183071844 22:35401643-35401665 CTGCATGAGTAAGTGAAAGCAGG - Intronic
1183543039 22:38440959-38440981 GTGCATGAGATGGTGAACGCTGG + Intronic
1184931930 22:47687789-47687811 GACCATGAGCCAGGGAACACAGG - Intergenic
949520621 3:4850306-4850328 GAGCATGTGCAGGTGCACACTGG + Intronic
951566684 3:24018939-24018961 GTGTGTGAGCAAGTGAGCGCAGG + Intergenic
952169503 3:30791432-30791454 GTGCATGAGGAAGTGGAGGCAGG - Intronic
952905034 3:38134226-38134248 GTGCATGGGCAAGTGAGCGTGGG - Intronic
954966286 3:54614048-54614070 GTGCTTGATCAATTGAACAAGGG - Intronic
957770049 3:84678827-84678849 GTGCATGTGCATGTGTACACAGG - Intergenic
958019548 3:87979748-87979770 GTGCATGAGCAAGTGAGCATGGG + Intergenic
958141651 3:89570593-89570615 GTGCATGTGCAAGTGAGCGCAGG + Intergenic
962348356 3:134638920-134638942 GTGCATGTGCACATGCACACGGG + Intronic
967824726 3:193869258-193869280 ATGAATGAACGAGTGAACACCGG - Intergenic
969876668 4:10140542-10140564 GTGTATGAGCAAGTAAAGATGGG - Intergenic
969962889 4:10963732-10963754 ATGCATACGCACGTGAACACAGG + Intergenic
969962893 4:10963770-10963792 GTGTATACACAAGTGAACACAGG + Intergenic
970508258 4:16754929-16754951 GTGCAGGAGAAAGGGAACAGGGG - Intronic
972158704 4:36197674-36197696 GTGTGTGAGCAAGTGAGCATGGG + Intronic
974515170 4:62898339-62898361 GTGTGTGAGCAAGTGAGCGCAGG - Intergenic
974698039 4:65399321-65399343 GTGCATGAGTGAGTGAGCACAGG - Intronic
975184371 4:71384237-71384259 GTATATGAGCAAGTGCACAATGG + Intronic
975604454 4:76140092-76140114 GTGGATGAGAAGGTGAAGACTGG + Intronic
979010902 4:115366581-115366603 GTGCATGAGTGAGTGAACCTAGG - Intergenic
979010908 4:115366617-115366639 GTGCATGAGTGAGTGAACCTAGG - Intergenic
982839046 4:160159536-160159558 GTGTGTGAGCGAGTGAGCACGGG + Intergenic
984106145 4:175548988-175549010 GTGCATGAGCTAGAGATGACAGG - Intergenic
985275932 4:188237839-188237861 TTGCAGGAGCAAGGGAACAACGG - Intergenic
985431581 4:189886362-189886384 GTGCATGAAGTAGAGAACACTGG + Intergenic
986103636 5:4638157-4638179 GTGCATCAGCATGTGTACACTGG - Intergenic
988218659 5:28312206-28312228 GTGCAAGAGCAATAGAAAACTGG + Intergenic
989033740 5:37147671-37147693 CTGAATGAGAAAGAGAACACAGG + Intronic
989943165 5:50179359-50179381 GTGCATGTGCACATGGACACAGG - Intergenic
991973068 5:72159488-72159510 GTGGACTAGCAAGTAAACACTGG + Intronic
995386748 5:111596911-111596933 GTGCATGAGCAAGCAAGCACAGG - Intergenic
995927116 5:117387151-117387173 GTATGTGAGCAAGTGAGCACAGG - Intergenic
997389606 5:133503425-133503447 GTGCCGGAGCCAGTGCACACTGG - Intronic
997406601 5:133653952-133653974 TTGCATGAGCAAATGAACGAAGG - Intergenic
1003402761 6:5804399-5804421 GTGCATGTGCATGTGAAGTCGGG - Intergenic
1004120881 6:12821159-12821181 GTGCATGAGAAGCTGACCACTGG + Intronic
1005665375 6:28047364-28047386 ATGCATGAGAAAGTTAACGCAGG + Intergenic
1009846778 6:69145211-69145233 GTGTGTGAGCAAGTGAGCATGGG + Intronic
1012532581 6:100255906-100255928 GTGGCTGAGCAAGTCAAGACAGG + Intergenic
1014318500 6:119896396-119896418 GTGCATGAGCACTTGAGGACAGG - Intergenic
1014785454 6:125613549-125613571 GTCCAAGTTCAAGTGAACACAGG - Intergenic
1015318590 6:131845860-131845882 GAGCTTGAGCAAGTCAACAAGGG - Intronic
1017304146 6:152897544-152897566 GTCCAACAGCAAGTGAAGACAGG + Intergenic
1020240174 7:6388258-6388280 GTGCCTGAGGAGGTGAACACAGG - Intronic
1022787831 7:33656470-33656492 GTGCAAAAGCAAGAGAATACAGG + Intergenic
1023664280 7:42505282-42505304 GTGTATGTGCATGTGCACACAGG + Intergenic
1023679677 7:42672687-42672709 GACCATGAGCAAGTGAAAACAGG + Intergenic
1024275673 7:47674785-47674807 GTGCATGAGCGTGTGAATGCAGG - Intergenic
1024385666 7:48748738-48748760 CTGCAGGAGCATGTGTACACCGG - Intergenic
1027911935 7:84261687-84261709 GTGCATGAGTGAGTGAGCATTGG - Intronic
1028052141 7:86201938-86201960 GTACATGAGTGAGTGAACGCAGG + Intergenic
1030707736 7:112712182-112712204 GTGAATGAGAAAGCAAACACAGG - Intergenic
1030756456 7:113292369-113292391 GTGCATGAGCGAGCAAGCACAGG - Intergenic
1032320484 7:130882042-130882064 GCGGATGAACAAGTTAACACAGG + Intergenic
1032447511 7:131997273-131997295 GGGCATGAGCAATTGAAAAGTGG - Intergenic
1034829538 7:154297420-154297442 GTGCATGAGCATCTAAACAAGGG - Intronic
1043414384 8:80032986-80033008 GTGCGTGAGCAAGTGAGTGCAGG + Intronic
1044073258 8:87788476-87788498 GTGTATGAGAAAGTTACCACTGG + Intergenic
1047220825 8:122916922-122916944 ATGCATGAGCAAAAGAACAGAGG - Intronic
1047314347 8:123718593-123718615 GTGCATGAACAAGGCAGCACTGG + Intronic
1047759945 8:127947041-127947063 GCACATGAACAAGTGACCACGGG - Intergenic
1048522317 8:135168333-135168355 GTGCAGGAGCAAGTTAAGAAGGG - Intergenic
1048547763 8:135403575-135403597 ATGCATGAGCAAGCGAATGCAGG + Intergenic
1052552425 9:29968996-29969018 GTGTGTGAGCAAGTGAGCATGGG + Intergenic
1052864988 9:33459492-33459514 ATGTGTGAGCAAGTGTACACAGG - Intergenic
1052865188 9:33460557-33460579 ATGTGTGAGCAAGTGTACACAGG - Intergenic
1054345240 9:63907751-63907773 GTGCATGAAGTAGAGAACACTGG - Intergenic
1054847444 9:69811633-69811655 GTGAATGAGGAAGTGGAAACAGG - Intergenic
1054972225 9:71101463-71101485 GTGTATGTGTAAGTGAAGACAGG + Intronic
1055164198 9:73171627-73171649 GTGCAAAAGCAAGTTAACAAAGG - Intergenic
1057973061 9:99575866-99575888 GCTCCTGAGCAAGTGAACATGGG + Intergenic
1058077809 9:100668251-100668273 GTGCATGAGTGAGTGAGCACAGG - Intergenic
1062174952 9:135156425-135156447 CTGCATGCGGAAGTGAAAACTGG + Intergenic
1062399139 9:136364859-136364881 GTGGATGAGGAGGTGAACACAGG - Intronic
1203454390 Un_GL000219v1:151476-151498 GTGCATGAAGTAGAGAACACTGG - Intergenic
1185707178 X:2276615-2276637 GTGCCTGAAGCAGTGAACACAGG + Intronic
1187130163 X:16494738-16494760 GTGGAAGAGCAAGAGAACAAGGG + Intergenic
1188850878 X:35130585-35130607 TTGCTTGAGCAAGTCAACACAGG + Intergenic
1190360451 X:49644223-49644245 GTGTGTGAGCAAGTGAGCAGGGG + Intergenic
1190560226 X:51679627-51679649 ATGGATGAACAAGTGAACAACGG + Intergenic
1190564065 X:51713694-51713716 ATGGATGAACAAGTGAACAACGG - Intergenic
1190621309 X:52289105-52289127 GTGCATGAGCAAGTGAACACAGG - Intergenic
1193882091 X:86936101-86936123 GTCCATGTGCACGTGTACACTGG + Intergenic
1195568044 X:106364945-106364967 GTTCATGTGCCAGTGAACATAGG + Intergenic
1197688207 X:129467061-129467083 GTGAATGAGTAAATGAACACAGG - Intronic
1201057274 Y:10007758-10007780 ATGCATGAGCATTTGAACCCAGG + Intergenic