ID: 1190622106

View in Genome Browser
Species Human (GRCh38)
Location X:52297717-52297739
Sequence CAATTGGAACACATGGACCC AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 34499
Summary {0: 1, 1: 5, 2: 433, 3: 15917, 4: 18143}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1190622099_1190622106 16 Left 1190622099 X:52297678-52297700 CCAAACACCACATGTTCTCACTC 0: 4749
1: 11870
2: 17435
3: 10841
4: 8050
Right 1190622106 X:52297717-52297739 CAATTGGAACACATGGACCCAGG 0: 1
1: 5
2: 433
3: 15917
4: 18143
1190622101_1190622106 9 Left 1190622101 X:52297685-52297707 CCACATGTTCTCACTCATAGGTG 0: 8120
1: 14274
2: 8213
3: 6298
4: 4752
Right 1190622106 X:52297717-52297739 CAATTGGAACACATGGACCCAGG 0: 1
1: 5
2: 433
3: 15917
4: 18143

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1190622106 Original CRISPR CAATTGGAACACATGGACCC AGG Intergenic
Too many off-targets to display for this crispr