ID: 1190623566

View in Genome Browser
Species Human (GRCh38)
Location X:52313644-52313666
Sequence CTGTTGATCAGCAGGAAACA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 215
Summary {0: 1, 1: 0, 2: 0, 3: 16, 4: 198}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1190623566_1190623570 15 Left 1190623566 X:52313644-52313666 CCATGTTTCCTGCTGATCAACAG 0: 1
1: 0
2: 0
3: 16
4: 198
Right 1190623570 X:52313682-52313704 TTCCCTCCACAGCAACCTCTAGG 0: 1
1: 0
2: 1
3: 29
4: 762

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1190623566 Original CRISPR CTGTTGATCAGCAGGAAACA TGG (reversed) Intergenic
901421121 1:9151836-9151858 CTGTTGATAAGAAGGAAATGTGG + Intergenic
904053565 1:27655814-27655836 CTGTTCCCCAGCAGGAACCAAGG + Intergenic
906057777 1:42929899-42929921 CGGTTGATGAGCAGGAAGCGGGG + Exonic
909138764 1:71836007-71836029 CTGGTGATTAGCAGATAACAAGG + Intronic
911650078 1:100377965-100377987 CTGTTCATCACTTGGAAACAGGG - Intronic
911976410 1:104502416-104502438 CAGTAGAAAAGCAGGAAACATGG - Intergenic
911978561 1:104535238-104535260 CTGTTGATCAGCAGATAATTTGG - Intergenic
915626313 1:157116012-157116034 CTTTGCATCAGCAGGAACCAGGG - Intergenic
915884272 1:159705855-159705877 CTGATGAAAACCAGGAAACATGG + Intergenic
918098290 1:181352173-181352195 GATTTGATCAGCAGGAAAGAGGG + Intergenic
919006403 1:191904210-191904232 CTGATGTGCAGCAGGAAAAATGG + Intergenic
919085699 1:192917969-192917991 TAGATGATCAGCAGGACACAGGG - Intergenic
919377890 1:196817223-196817245 CTGGTGATACCCAGGAAACAGGG - Intergenic
920860708 1:209704114-209704136 CTGTAGAGCAACAAGAAACATGG - Intronic
922286504 1:224175365-224175387 CTGTTGATCAGCAAAAATAAAGG - Intergenic
923998843 1:239528305-239528327 GTGTTGATCAGCAAGAGACTTGG + Intronic
924417297 1:243870458-243870480 CTGTTGAACAATAGGAAAAAAGG + Intergenic
1063021437 10:2132909-2132931 CTGCTGATGAGAAGGAAAAATGG + Intergenic
1063156063 10:3380051-3380073 CTGTTCTTCTGCAGAAAACAGGG + Intergenic
1064902944 10:20314358-20314380 CTCTTGATCAATAGGCAACAAGG - Intergenic
1066156369 10:32682395-32682417 CTGTTGATGAGCAGGCATCTAGG + Intronic
1068429957 10:56918776-56918798 CTGTTGATAACCAGGATACATGG + Intergenic
1068911313 10:62381302-62381324 GTGTTATCCAGCAGGAAACAGGG - Intronic
1069218054 10:65846965-65846987 ATGTTGCTCAGAAGGAAAAAAGG + Intergenic
1070366330 10:75740707-75740729 CTGTTGATCAGCAACAGACTTGG + Intronic
1070490011 10:76967412-76967434 TTGTTGATTGGCAGAAAACAAGG - Intronic
1070569332 10:77629334-77629356 CTCTTGATCAGTAGCTAACAAGG - Intronic
1071868862 10:89769342-89769364 CTAGTGATAAGCAGAAAACAGGG - Intronic
1072886355 10:99278615-99278637 CTGTTTATCAGGATGAAAAAAGG + Intergenic
1083300317 11:61736637-61736659 CCGTTTGTCAGAAGGAAACATGG + Intronic
1085204977 11:74726161-74726183 CTGTTAAAGGGCAGGAAACAGGG + Intronic
1085385956 11:76158529-76158551 GTGTTGAGCAGGAGGAGACAGGG - Intergenic
1085883181 11:80491793-80491815 CTGTTTTAAAGCAGGAAACACGG + Intergenic
1086757500 11:90582735-90582757 CTGCTGATACCCAGGAAACAGGG - Intergenic
1087286162 11:96267017-96267039 CTGTTCCTCAGCAGGCTACATGG - Intronic
1088335177 11:108695858-108695880 CTTTTGACCAGCATGAAAGAAGG + Intronic
1088588795 11:111383190-111383212 CTGCTGATCAACAAGAAAAAGGG - Intronic
1091384292 12:82924-82946 CTGTTGTTCAGCAGGGGATAGGG + Intronic
1092327136 12:7544453-7544475 CTGGTGATACTCAGGAAACAGGG + Intergenic
1093824392 12:23665511-23665533 CCGTTGATCAGGAGGGAATACGG + Exonic
1094224456 12:28029669-28029691 CATTTGCTCAGCAGGACACACGG - Intergenic
1098880308 12:75910441-75910463 CTGTGGAACAGCAGGCAGCAGGG - Intergenic
1099848380 12:88058741-88058763 CTGTTCATCAGGAAGAAACCAGG + Intronic
1100965814 12:100011551-100011573 CTGGTGATACCCAGGAAACAGGG + Intergenic
1102120917 12:110440383-110440405 CTTTTGCTAAGCAGGACACAAGG + Exonic
1102632616 12:114294827-114294849 CTGTCCAGCAGCAGGAAAGATGG + Intergenic
1104510010 12:129368711-129368733 CTGTTGGTAAGGAGGAAAGAGGG - Intronic
1104950712 12:132438715-132438737 CTGTGGCTGTGCAGGAAACAGGG - Intergenic
1106169378 13:27275776-27275798 CTGCTGATCAGCAGGAGGCCTGG - Intergenic
1107833171 13:44392370-44392392 CTTTTGATGTGCAGTAAACACGG + Intronic
1108503461 13:51088373-51088395 GTGTTTATCAGCAAGGAACAAGG - Intergenic
1111452315 13:88435264-88435286 ATCTTGAACAGCAGAAAACAGGG - Intergenic
1115099323 14:29678992-29679014 CTGTTAATCAGAAGGCCACAGGG + Intronic
1115710215 14:36042244-36042266 CTGTTGGTCAGAAGGAAGAATGG - Intergenic
1116227613 14:42171742-42171764 CTGGTGATACCCAGGAAACAGGG + Intergenic
1118737328 14:68711394-68711416 TTGTTGAAAAGCAGGAAACAGGG - Intronic
1122727368 14:103766505-103766527 CTGTTGATTAGGAGCAACCACGG - Intronic
1123011563 14:105352320-105352342 CTGCATATCAGCAGGAAACCAGG - Intronic
1125103488 15:35943197-35943219 CAGTTTATCAGCAGGAAGGACGG + Intergenic
1127353938 15:58180206-58180228 CTTTGGTTCATCAGGAAACAGGG + Intronic
1128757533 15:70193753-70193775 CTGTTTATCAACAGGAATCCAGG - Intergenic
1129534361 15:76299885-76299907 ATGTTGATGAGAAGGAACCAGGG - Intronic
1129766868 15:78175153-78175175 CTGTTGGACAGAAGGAAAGAAGG - Intronic
1133319580 16:4904656-4904678 CTGTGGATAGGGAGGAAACAGGG + Intronic
1136700453 16:32134208-32134230 CTGTTGTACAGCAACAAACATGG + Intergenic
1136767202 16:32793257-32793279 CTGTTGTACAGCAACAAACATGG - Intergenic
1136800946 16:33077444-33077466 CTGTTGTACAGCAACAAACATGG + Intergenic
1136955128 16:34774545-34774567 CTGTTGTACAGCAATAAACATGG + Intergenic
1137087565 16:36146383-36146405 CTGTTGTACAGCAATAAACATGG + Intergenic
1137092006 16:36204565-36204587 CTGTTGTACAGCAATAAACATGG + Intergenic
1138042428 16:53687074-53687096 CAGGTGATCATCAGGTAACAAGG + Intronic
1138749239 16:59398748-59398770 TTTTTGATCTACAGGAAACAAGG - Intergenic
1138870897 16:60883224-60883246 CTGTTGATCAGGGGGAGAGAAGG + Intergenic
1143682540 17:8488059-8488081 CCTTTGATCAGCAGGAAAGGGGG + Intronic
1145957629 17:28865513-28865535 CTGTTTATCAGGAGCCAACACGG + Intergenic
1147603638 17:41761246-41761268 CTGATTTTCAGCAGGACACACGG + Intronic
1152042015 17:77909753-77909775 AGGATGATAAGCAGGAAACAAGG + Intergenic
1153668737 18:7390585-7390607 CTGTTGCTCAGTAGAAAACAAGG - Intergenic
1154234109 18:12587074-12587096 TTCTTGATCAGAAGGAAATAGGG - Intronic
1154516698 18:15176253-15176275 TTGTTGTACAGCAGTAAACATGG - Intergenic
1160192321 18:76724145-76724167 CTGTTGAGCAGCAGGAAAGGGGG - Intergenic
1160495669 18:79373451-79373473 TTGTTCATCAGCATGAAGCATGG + Intronic
1161498594 19:4600705-4600727 CTGTTTATGTGCAGAAAACAGGG - Intergenic
1167864163 19:52310591-52310613 ATGATAATCAGCAGTAAACATGG - Intronic
925439571 2:3872840-3872862 CTTGTGATCAGCAGGAAATTTGG + Intergenic
926796776 2:16625973-16625995 ATGATGATCAGGAGGAAACCCGG - Intronic
927126597 2:20017527-20017549 CTGTGAATAAGCAGAAAACATGG + Intergenic
927239948 2:20912606-20912628 CTGTTGATCAGAAGGGACCCAGG - Intergenic
927307904 2:21594984-21595006 CCGTTGGTCAGCAAGAAAAATGG + Intergenic
927743960 2:25598802-25598824 CCGGTGATAAGCAGGAAACAGGG + Intronic
929422481 2:41807251-41807273 CTGTTGGTCAGCAGGGACCAGGG - Intergenic
932115814 2:69045949-69045971 CTGTTGAACAGAAGGCAGCAAGG - Intronic
932179737 2:69635336-69635358 CTGTTGATGGGAATGAAACATGG + Intronic
932745777 2:74332395-74332417 CAGTTGAAAAGCAGGAAAGAAGG - Intronic
932982568 2:76687400-76687422 TTGTTTATTAGCAGAAAACAAGG + Intergenic
933880505 2:86664521-86664543 CTGGTGATACCCAGGAAACAGGG + Intronic
935224573 2:101042173-101042195 ATGTTGATGAGGAGGAAAGAAGG + Intronic
935847143 2:107178185-107178207 ATTTTTACCAGCAGGAAACAAGG - Intergenic
939161577 2:138596413-138596435 CTCTAGATCACCAGAAAACAGGG + Intergenic
940700258 2:157032107-157032129 CTGTGGATGTGCAAGAAACAGGG - Intergenic
940780681 2:157930569-157930591 CTGTTGATCAGAAGTAAGCGGGG + Intronic
942897583 2:181076118-181076140 CTGTTGGCCTGGAGGAAACATGG - Intronic
944130004 2:196337432-196337454 CTGTTCATAAGCAGGAGAGATGG + Intronic
946467150 2:219922007-219922029 AAGTTGATGAGAAGGAAACAGGG - Intergenic
947371757 2:229453768-229453790 CTGTTGCTCAGCATGAAGCTTGG + Intronic
948283751 2:236768697-236768719 CCACTGATCAGCAGGACACAAGG + Intergenic
948522908 2:238552276-238552298 CTGTTTATGAGCCGGAAAAATGG + Intergenic
948570050 2:238912350-238912372 CTGTTGCTCACCAGGAAACCAGG - Intergenic
948570753 2:238915730-238915752 CTGATGATCTGCAAGAGACACGG + Intergenic
1169919949 20:10724625-10724647 CTGTTTCTGAGCAGAAAACAAGG + Intergenic
1173334937 20:42104877-42104899 CAGGTGATCATTAGGAAACATGG - Intronic
1175582797 20:60113430-60113452 CTGGTGCTCAGCAGGCAAGAAGG + Intergenic
1177518173 21:22181707-22181729 CTGTTGGTGAGAAGGCAACATGG - Intergenic
1179364450 21:40743686-40743708 CTGTTGACCAGACAGAAACATGG - Intronic
1180802353 22:18637813-18637835 CTGCTGACCAGCAGGAGCCATGG - Intergenic
1180853586 22:19033365-19033387 CTGCTGACCAGCAGGAGCCATGG - Intergenic
1181219371 22:21357448-21357470 CTGCTGACCAGCAGGAGCCATGG + Intergenic
1181482026 22:23206126-23206148 CTGGGAAGCAGCAGGAAACAGGG - Intronic
1182094837 22:27619130-27619152 CTGCTGGTCTGCAGGACACAAGG + Intergenic
1182904974 22:33927966-33927988 CTTGTGATCATGAGGAAACATGG - Intergenic
1185237982 22:49725626-49725648 CTGTTGCTCAGCTGGAGACGGGG - Intergenic
1203287937 22_KI270735v1_random:185-207 CTGTTGTACAGCAATAAACATGG - Intergenic
949155106 3:817336-817358 CTGGTGATTCTCAGGAAACAGGG + Intergenic
953334063 3:42078956-42078978 CTGACGGCCAGCAGGAAACAGGG + Intronic
954899068 3:54003439-54003461 CTGTGGAGCAGCAGGGCACATGG + Intergenic
956008350 3:64804520-64804542 CTGCTGTTAAGCAGGAAGCAGGG - Intergenic
957778955 3:84793438-84793460 TTGATGAACATCAGGAAACAGGG - Intergenic
957799984 3:85065695-85065717 CTATTCATCAGCAGGTAACCTGG + Intronic
959130945 3:102355364-102355386 CTGGTTATCAGAGGGAAACAGGG + Intronic
963569550 3:146975662-146975684 TTTTTAAGCAGCAGGAAACAGGG - Intergenic
964123991 3:153217017-153217039 CTGGTAATTAGCAGGAAACAGGG - Intergenic
965826287 3:172734311-172734333 CTAAAGATCAGAAGGAAACAAGG - Intergenic
967890694 3:194362373-194362395 CTGTGGATAAGCATGGAACAAGG - Intronic
968765240 4:2464922-2464944 CTGTTGGTTGGCAGGTAACAAGG + Intronic
970200403 4:13599229-13599251 CTGCTGCTCAGCAGGAAGAAAGG + Exonic
973644367 4:52935399-52935421 GTGTTGATCAGGAGCCAACATGG - Intronic
974814051 4:66982556-66982578 CTGATGATACCCAGGAAACAGGG + Intergenic
976756672 4:88506009-88506031 CTAGTGATAAGCAGGAAAGAGGG + Exonic
979712021 4:123790958-123790980 CTTTTTATTAGTAGGAAACATGG - Intergenic
979741780 4:124159881-124159903 CTGATAATCAGCAACAAACAAGG - Intergenic
979856426 4:125638921-125638943 CTGCTGAGCTGCAGGCAACAAGG + Intergenic
981779357 4:148408615-148408637 CTGTTGATCATCAAGAAATGTGG - Intronic
981990098 4:150908142-150908164 TTGTTTATCAGTAGGAAATATGG - Intronic
983510563 4:168605569-168605591 ATGTTGGTCAGCAGGATCCAGGG + Intronic
985009643 4:185569220-185569242 CTGTTGATAAACAGAGAACAAGG - Intergenic
987876177 5:23684501-23684523 CTGTTGGGCAACAGGGAACAGGG + Intergenic
988720194 5:33869776-33869798 CTGATAAACATCAGGAAACAGGG + Intronic
990821445 5:59845024-59845046 CTGGTGATCAGCAAGAAAGTGGG + Intronic
993339808 5:86709943-86709965 CTCTTAATCAGCAGTATACATGG - Intergenic
993843621 5:92911481-92911503 ATGTAGATAAGCAGGAAAGAAGG - Intergenic
993968259 5:94385292-94385314 CTATTAATCAGCAGGTGACAGGG - Intronic
994808300 5:104479695-104479717 CTGTGGCTCAGCAGGGTACAAGG - Intergenic
1001050427 5:168409588-168409610 CAGTTGGTGAGGAGGAAACAGGG - Intronic
1002608903 5:180400932-180400954 CTGTTGAGCAGCAAGAAGGAAGG - Intergenic
1005419571 6:25635005-25635027 CTGTTGACCATCTGCAAACATGG + Intergenic
1006390827 6:33757287-33757309 CTGCTGATCAGGATAAAACATGG - Intergenic
1008047812 6:46869367-46869389 CTGATGATCAGCAGGGTAAAAGG + Intronic
1010454495 6:76039258-76039280 CTGTTGATCTGCAGACAACATGG + Intronic
1011636155 6:89375672-89375694 CTGTTAACCAGCAGGAGGCAGGG - Intronic
1013012121 6:106130427-106130449 CTGTTCATCCCCAGGATACAAGG - Intergenic
1017142552 6:151204851-151204873 CACTCGATCAGCAGGAACCATGG - Intergenic
1017189160 6:151633558-151633580 CTGTTTATCAGCAGTAAAATGGG + Intergenic
1017535958 6:155348612-155348634 CTGATGATGAGCAGGAGGCATGG + Intergenic
1017953143 6:159154996-159155018 CTATTGTTCAGCAGGGAAAATGG - Intergenic
1019363612 7:618760-618782 CTGCAAATCAGCAGGAAAGAAGG - Intronic
1021488386 7:21191836-21191858 CTGTTTATCAGGAAGTAACATGG - Intergenic
1022880997 7:34587256-34587278 CTGTTGATCTGAAGGGAACATGG - Intergenic
1023277011 7:38530706-38530728 CTGTTAATGAGCAGAAAAAAAGG - Intronic
1025489426 7:61094541-61094563 CTGTTGTACAGCAATAAACATGG - Intergenic
1026942721 7:74296987-74297009 CTGCTGATCAGCAAGTAACTGGG - Intronic
1028202138 7:87974364-87974386 CTATTTATCAGCCAGAAACATGG + Intronic
1028256109 7:88599567-88599589 CTGTTGACCAAAAAGAAACAGGG + Intergenic
1029943022 7:104500277-104500299 CAGTTGATTAGAAGGAATCACGG - Intronic
1031979410 7:128115150-128115172 CTGGAGTTCAGGAGGAAACATGG - Intergenic
1037565140 8:20111734-20111756 CTCTTGACCATCAGGAAGCATGG - Intergenic
1037723036 8:21460605-21460627 CTGTAGCCCAGCAGAAAACAAGG + Intergenic
1038451169 8:27639849-27639871 CTGCTGATCAGCAGTCAACGCGG - Intronic
1040078020 8:43259932-43259954 CTGTGGATCTGCAGGATACATGG + Intergenic
1040514890 8:48126545-48126567 CTGTTGATCACTAGGAAATGGGG - Intergenic
1040728230 8:50409521-50409543 CTGTTGATCAGAATGATGCATGG + Intronic
1043620711 8:82188971-82188993 CTTCTAATCAGCAGGAAACAGGG + Intergenic
1045335444 8:101199141-101199163 CTGTTGATCAGCAAAAATAAAGG - Exonic
1046510303 8:115193940-115193962 CTGTTGCTCAGAAGCAAGCATGG + Intergenic
1047567532 8:126062206-126062228 CTCTTGCTCAGCAGGAAAAGTGG - Intergenic
1047772242 8:128038872-128038894 ATGTTCTTCAGTAGGAAACATGG + Intergenic
1048206458 8:132419196-132419218 CTGTTGTTCAGCAGGGAGCCTGG - Intronic
1049026432 8:139993426-139993448 CTATAGATCAACAGGAAATACGG + Intronic
1050192372 9:3040939-3040961 CACTTGCTCAGCAGGAAACAGGG + Intergenic
1050427977 9:5531810-5531832 CATTTGATAAACAGGAAACAGGG - Intronic
1052887810 9:33666863-33666885 CTGGTGATACCCAGGAAACAGGG + Intergenic
1053596499 9:39566998-39567020 CTGTGGAGCAGCAGGAAGGAAGG - Intergenic
1053854464 9:42323638-42323660 CTGTGGAGCAGCAGGAAGGAAGG - Intergenic
1054569760 9:66798020-66798042 CTGTGGAGCAGCAGGAAGGAAGG + Intergenic
1055360857 9:75488801-75488823 CTATTGATGAGCAGGGAACAGGG - Intergenic
1055503234 9:76922583-76922605 TTGTTGATCTGCAGGGAACTTGG - Intergenic
1056016262 9:82391473-82391495 CTGGTGATACCCAGGAAACACGG - Intergenic
1059642665 9:116232880-116232902 CTGTTGATTAACAAGAAACTAGG + Intronic
1061284332 9:129613590-129613612 CTGTTGGACTGCAGGAAAGAGGG + Exonic
1061573898 9:131494435-131494457 CTCTGGATCAGCAGTTAACATGG + Exonic
1061649856 9:132038783-132038805 CTTTGAATCAGCAGGAGACAGGG + Intronic
1188240643 X:27784894-27784916 CTGTTGATGAGCGGGAGACACGG + Intergenic
1189597430 X:42584248-42584270 CTCTTAATCAGCAGGATAAATGG - Intergenic
1190528874 X:51355022-51355044 ATGTTTATCAGCAGGTAACATGG + Intergenic
1190623566 X:52313644-52313666 CTGTTGATCAGCAGGAAACATGG - Intergenic
1190770152 X:53507522-53507544 CAGTTGATTAACAGGAAAAAAGG + Intergenic
1190966999 X:55310428-55310450 TTTTTCATAAGCAGGAAACAAGG + Intergenic
1192560958 X:72127601-72127623 GTGTTGACCATCAGCAAACAGGG + Intronic
1193060061 X:77196757-77196779 CTGGTGATATCCAGGAAACAGGG - Intergenic
1194270106 X:91802368-91802390 GTGGTGAGAAGCAGGAAACAGGG - Intronic
1197865338 X:131011064-131011086 CTGTTGATCAGAAGGCAGCGTGG + Intergenic
1198696990 X:139352505-139352527 TTATTGATAAGCAGGAAGCAGGG + Intergenic
1199200828 X:145087484-145087506 ATGTTAATCAGCAAGAAAAAGGG + Intergenic
1199309542 X:146307175-146307197 ATGCTAATCAGCAGGAAAAATGG + Intergenic
1200587346 Y:5023807-5023829 GTGGTGAGAAGCAGGAAACAGGG - Intronic
1201460408 Y:14216297-14216319 CTGCTGAACTGCAGAAAACAAGG - Intergenic