ID: 1190627282

View in Genome Browser
Species Human (GRCh38)
Location X:52348575-52348597
Sequence TAGACTAGTAATGAAGTTCC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 108
Summary {0: 1, 1: 0, 2: 1, 3: 7, 4: 99}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1190627282 Original CRISPR TAGACTAGTAATGAAGTTCC AGG (reversed) Intergenic
904583141 1:31562785-31562807 TAGATTATTTATGAATTTCCAGG + Intergenic
905087841 1:35399398-35399420 TAGACTAGTAAAGAAATATCAGG - Intronic
905145664 1:35884935-35884957 TAGGAAAGTAATGAAGTTCATGG - Intronic
911753155 1:101522177-101522199 TAGACTAGTGTGGAAGCTCCAGG - Intergenic
912035909 1:105313192-105313214 TAGACTAGTCTTGAACTCCCAGG - Intergenic
920920954 1:210296774-210296796 TAGACAAGGAATGAATCTCCTGG + Intergenic
921563141 1:216682766-216682788 TAGACTAGTGTTGCAGCTCCCGG + Intronic
921899660 1:220436884-220436906 TAGACAAGGAATGAATCTCCAGG - Intergenic
923852560 1:237813233-237813255 TAGAATAGAACTGAATTTCCTGG - Intronic
924845242 1:247762106-247762128 TAGAGAAGTTATGAAGCTCCTGG + Intergenic
1065028276 10:21559965-21559987 TACATTAGGAATGAAGTTGCTGG + Intronic
1070106782 10:73440569-73440591 TAGAATAGAAAGGAAGTTACTGG - Intronic
1071612846 10:87047293-87047315 TAGACTAGTGTTGAACTTCTGGG + Intergenic
1072628849 10:97132040-97132062 TAAAGTAGAAATGAAGCTCCGGG + Intronic
1074248515 10:111719020-111719042 TACCCCAGTAATGAAATTCCTGG - Intergenic
1077562752 11:3274482-3274504 AAGACTAGAATTGAATTTCCTGG + Intergenic
1077568645 11:3320301-3320323 AAGACTAGAATTGAATTTCCTGG + Intergenic
1080312488 11:30911346-30911368 AAGACTAGAAATGAAGTTTGTGG - Intronic
1083576640 11:63796604-63796626 GAGACTAGGAAGGAAGTTCATGG + Intergenic
1087029103 11:93684514-93684536 TAGACAAGAAATGAACCTCCAGG - Intronic
1087050305 11:93880225-93880247 TAGCCCAGGAATGAAATTCCCGG - Intergenic
1091133413 11:133165751-133165773 TAGACCAGTAATCAAGAGCCTGG - Intronic
1093397136 12:18696223-18696245 TATTCTGGTAATGAACTTCCTGG + Exonic
1093440380 12:19188531-19188553 TAGATTAGAAATGATGTTTCTGG + Intronic
1098992274 12:77076913-77076935 TGGTCTAATAATGATGTTCCTGG + Intergenic
1100589263 12:96010192-96010214 TACACTAATAAGGAAGTTTCAGG - Intronic
1105671659 13:22624614-22624636 TAGACAAGTAAAGCATTTCCAGG + Intergenic
1110936989 13:81303806-81303828 TAAACTAGTAAGGGAGTACCAGG + Intergenic
1111066607 13:83101962-83101984 TAGACTAGTAAGTTAGTCCCTGG - Intergenic
1115544447 14:34453136-34453158 TAGACTATTAGTAAAGTTTCTGG + Intronic
1119762606 14:77162354-77162376 TAGGCTAGTAAGGAAGTTGCTGG + Intronic
1121803379 14:96794077-96794099 TAGCCTAGTACTGAGATTCCTGG - Intergenic
1128655055 15:69454438-69454460 AAGACTAATAAAGAGGTTCCTGG + Intronic
1128972433 15:72118935-72118957 AAGACTAGTAATCCAGTACCTGG + Intronic
1131599157 15:93829258-93829280 TAGACAAGAAATGAAGCTCTGGG + Intergenic
1135419362 16:22294887-22294909 TACACTAGAAATGAAATTGCTGG - Intergenic
1136459952 16:30403916-30403938 TAGTCTAGTAAAGAAGTTTTTGG - Intergenic
1140662673 16:77202717-77202739 GAGACTCCTAATGAAGTTTCTGG + Intronic
1153337805 18:3942493-3942515 CAGACTAGTAAGTAAGTTCTAGG + Intronic
1153676828 18:7463354-7463376 GAAACAAGTAATGAAGTTCCTGG - Intergenic
1157672220 18:49540290-49540312 TAGACAAGGAATGAATCTCCGGG - Intergenic
1165753171 19:38274018-38274040 CAGACTAGTATTGAAGTCCTGGG - Intronic
925489196 2:4373160-4373182 TAGACAAGGAATGAATCTCCAGG - Intergenic
930557496 2:52917222-52917244 TAGAATAAGAATGAAATTCCAGG - Intergenic
931618702 2:64188378-64188400 AGGACTAGTACTGAAGTTACTGG + Intergenic
931775167 2:65534137-65534159 TAGACTAGTAAAGAAGTCCCAGG + Intergenic
931790428 2:65659397-65659419 TAGACATGTAATGAGGATCCAGG + Intergenic
933484384 2:82899261-82899283 TATACACATAATGAAGTTCCAGG - Intergenic
946540499 2:220679239-220679261 TATACTATTAATGAATTTTCAGG + Intergenic
1176977704 21:15341402-15341424 TAGACTATTCATTAATTTCCAGG - Intergenic
1182868018 22:33621949-33621971 TAGACAAGGAATGAATCTCCAGG - Intronic
950288158 3:11761467-11761489 TAGAGGAGAAATGCAGTTCCAGG + Intergenic
950298686 3:11854845-11854867 TAGACTAGGAAAGAACTTCTAGG - Intergenic
957596674 3:82275088-82275110 TAGACTAGTTATAAAGCTCTTGG - Intergenic
957889438 3:86336727-86336749 TAAACTAGTAATGATGTTGCTGG - Intergenic
958626950 3:96638597-96638619 TACACAAATAATGAAATTCCTGG - Intergenic
962186797 3:133268967-133268989 TATGCAAGTAATGAATTTCCTGG - Intronic
965063660 3:163815292-163815314 TATACCAGTAATGGAGTTGCTGG + Intergenic
966922603 3:184623278-184623300 TACACTAGTAATGATTTTCTGGG + Intronic
976536779 4:86226729-86226751 TGGAATAGAAATGAAATTCCAGG - Intronic
976717429 4:88137597-88137619 TAGCCTTGTAATGAAGGTCGTGG - Intronic
978930886 4:114310378-114310400 TAGACCAGTAAGGAAGTCACTGG - Intergenic
982746492 4:159108927-159108949 TAGACTGGTCATGAAGTCCTGGG + Intronic
986100535 5:4605883-4605905 TAGATCAGTAATGCAGTTGCTGG + Intergenic
986860242 5:11918926-11918948 AAGACTCCAAATGAAGTTCCAGG - Intergenic
986994443 5:13590934-13590956 TAGATTAGGAATTAACTTCCAGG - Intergenic
987402164 5:17489210-17489232 AAGAATAGTGATGAAGCTCCAGG - Intergenic
987403452 5:17501605-17501627 AAGAATAGTAATGAAGCTCCAGG - Intergenic
987410281 5:17608182-17608204 AAGAATAGTGATGAAGCTCCAGG - Intergenic
987410932 5:17614350-17614372 AAGAATAGTGATGAAGCTCCAGG - Intergenic
987413482 5:17637812-17637834 AAGAACAGTAATGAAGCTCCAGG - Intergenic
988261939 5:28898047-28898069 TAGAATAGAAATGATTTTCCAGG - Intergenic
989798324 5:45503258-45503280 TAAACTAGTAGTGAAATTCAGGG - Intronic
989808766 5:45646642-45646664 TAAACCAGCAATGAAGTTCCTGG - Intronic
992866817 5:80965126-80965148 ATGACTAGTAATGAAGTGACAGG - Intronic
993431159 5:87833216-87833238 CAGATTACTTATGAAGTTCCAGG + Intergenic
996112758 5:119584583-119584605 TAGACAAGGAATGAATCTCCAGG - Intronic
996645346 5:125808171-125808193 TAAACTAGCAAAGAAATTCCTGG + Intergenic
1005242162 6:23843602-23843624 TAGACTAGGAATGCATTTTCAGG + Intergenic
1006523335 6:34584707-34584729 TAAACTAGTAAGGTGGTTCCTGG - Intergenic
1007668409 6:43530890-43530912 TAGGCTAGAAATGAAATTCATGG - Intronic
1008110186 6:47483623-47483645 TAGACTACTAATGTAGTCCCAGG - Intronic
1011740322 6:90353132-90353154 TAAACAAGTAATGAAATTCTGGG - Intergenic
1019005439 6:168792806-168792828 TAAAGTAGATATGAAGTTCCCGG - Intergenic
1019101124 6:169631171-169631193 TAGCCTTGTAAAGAAGTTACAGG + Intronic
1020450287 7:8314398-8314420 TAGATTAGTAATGATGTGCTGGG + Intergenic
1023661790 7:42478011-42478033 TAGACAAGTAATGAATCTCTGGG - Intergenic
1028699409 7:93760117-93760139 TAGATGAATAATGAATTTCCAGG - Intronic
1033862786 7:145649205-145649227 TTGAGGAGCAATGAAGTTCCTGG - Intergenic
1033991710 7:147295917-147295939 TTCTCTAGTAATTAAGTTCCTGG + Intronic
1035978252 8:4337140-4337162 TAGAGTAGTAATGAAGGTGGGGG - Intronic
1042344213 8:67711060-67711082 AAGACTAAGAATGCAGTTCCAGG - Intronic
1045648886 8:104324855-104324877 TAGACTAGTGGTGAAGTGACAGG + Intergenic
1046279552 8:112007968-112007990 TGGACTAGGAAAGAACTTCCAGG - Intergenic
1047433734 8:124816845-124816867 TTAACTAGGAATGAATTTCCAGG - Intergenic
1049130168 8:140832486-140832508 AAGACTGTTTATGAAGTTCCTGG + Intronic
1049294323 8:141822853-141822875 AAGACAAGTAACGAGGTTCCTGG - Intergenic
1051400039 9:16671157-16671179 TAGAGTAGAAATGAAGGACCAGG - Intronic
1052027545 9:23590307-23590329 TAGACTATTAGTGAAGGTCCTGG + Intergenic
1052073507 9:24112134-24112156 TATACTAGGTATGAAGTTGCTGG + Intergenic
1060727454 9:126015902-126015924 TAGACAAGGAATGAACCTCCGGG - Intergenic
1186381801 X:9068562-9068584 TAGATTAGTAATGAATTGCTTGG - Intronic
1187026473 X:15440483-15440505 AATACTAGGAATGAAGTTTCTGG + Intronic
1190627282 X:52348575-52348597 TAGACTAGTAATGAAGTTCCAGG - Intergenic
1190700662 X:52987050-52987072 TAGACTAGCAATGAACTGCTTGG + Intronic
1192555916 X:72089090-72089112 TAGACTAGTCAGGAAGATCTAGG + Intergenic
1194862574 X:99020428-99020450 TAGACTAGTAATGCACTTAATGG - Intergenic
1197827724 X:130608219-130608241 TAGAGAAGAAATGAAGTTCAAGG - Intergenic