ID: 1190628399

View in Genome Browser
Species Human (GRCh38)
Location X:52359930-52359952
Sequence GGGCGGGTTAATGCAAATTT AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 125
Summary {0: 1, 1: 0, 2: 19, 3: 27, 4: 78}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1190628399_1190628405 3 Left 1190628399 X:52359930-52359952 CCTAAATTTGCATTAACCCGCCC 0: 1
1: 0
2: 19
3: 27
4: 78
Right 1190628405 X:52359956-52359978 ATATACACGTAATTGAAAGTGGG 0: 1
1: 1
2: 9
3: 70
4: 374
1190628399_1190628404 2 Left 1190628399 X:52359930-52359952 CCTAAATTTGCATTAACCCGCCC 0: 1
1: 0
2: 19
3: 27
4: 78
Right 1190628404 X:52359955-52359977 AATATACACGTAATTGAAAGTGG 0: 1
1: 1
2: 8
3: 54
4: 350

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1190628399 Original CRISPR GGGCGGGTTAATGCAAATTT AGG (reversed) Intergenic
902153404 1:14463105-14463127 GGGTGGGTTAATGCAAATTGAGG + Intergenic
902260117 1:15218834-15218856 GGGTGGGTTAATGCAAATTGAGG - Intronic
905764939 1:40592499-40592521 GGGTGGGTTAATGCAAATTGAGG - Intergenic
909051988 1:70777197-70777219 GGGCAGGTTAATGCAAATTGAGG - Intergenic
909773187 1:79451762-79451784 GTGTGGGATAATGCAAAGTTAGG - Intergenic
922968607 1:229715315-229715337 GGACAGGTTAATGCAAATTGAGG - Intergenic
923995896 1:239494090-239494112 AGGCAGGTTAATTCAAATTGAGG + Intronic
924273050 1:242354306-242354328 GGGTGGATCAATGCAAATTCAGG - Intronic
1063925783 10:10975946-10975968 GGGTGGGTCAATGGAAATTGAGG + Intergenic
1063966825 10:11352513-11352535 GGCCAGGTTAATGCAAACTGAGG + Intergenic
1064710903 10:18123421-18123443 GAGTGGGTTAATGCAAATGGAGG - Intergenic
1064800469 10:19064954-19064976 GAGCAGATTAATGCAAATTGAGG + Intronic
1065186810 10:23176245-23176267 GGGCCTGTTACTGCAATTTTAGG - Intergenic
1065827616 10:29586210-29586232 AGGCTGGTTAATGCAATTTGAGG + Intronic
1065950257 10:30645079-30645101 AGGCTGGTTAATGCAATTTGAGG - Intergenic
1066711662 10:38242353-38242375 GGGTGGATCAATGCAAATTCAGG + Intergenic
1068917125 10:62444563-62444585 GGGCAGGTTAAGGAAAAGTTAGG - Intronic
1075091244 10:119445193-119445215 GGTCGGGTAAATGGAAATGTGGG + Intronic
1076200558 10:128554441-128554463 GGGTGGGTTAATGTAAACTGAGG + Intergenic
1077983112 11:7321762-7321784 GGGCGGGTTAATGCAAATAGAGG + Intronic
1080463195 11:32473562-32473584 GGGCAGGTCAATGCAAACTGAGG - Intergenic
1080956076 11:37097497-37097519 GGGCTGATTAATGCATATTCTGG + Intergenic
1085356262 11:75840412-75840434 GGGCGGGGGAAGGCAAGTTTTGG + Intronic
1093960591 12:25268997-25269019 GGGCGGGGGACTGCAAAATTTGG - Intergenic
1094475959 12:30840744-30840766 GGATGGGTCAATGCAAATTGAGG + Intergenic
1096017051 12:48286133-48286155 GGGTGGTTTAATGCAAATTGAGG + Intergenic
1096591641 12:52663939-52663961 GGGTGGGTTGATGGTAATTTGGG - Intergenic
1098756503 12:74370295-74370317 GGGCTCGTTAATGCAAAGTTGGG + Intergenic
1099955956 12:89352947-89352969 GGGAGGGTTAAGGCGAACTTGGG - Exonic
1103879006 12:124151693-124151715 GGGCAGGTTAATGCAAATTGAGG + Intronic
1105796262 13:23856509-23856531 GGGTGGGTTAATGCAAATTGGGG + Intronic
1108048451 13:46405723-46405745 AGGTGGGCTAATGCAAATTTAGG - Intronic
1108376820 13:49821749-49821771 GGGAGGGTTAATGCAAATTGAGG - Intergenic
1109256963 13:60095430-60095452 GGGTGGGTCAATGTAAATTAAGG + Intronic
1110369676 13:74726043-74726065 GGGCGGGTGAATCCACCTTTGGG - Intergenic
1110497055 13:76180350-76180372 GGGCAGATTAATGCAAATTGAGG - Intergenic
1111179599 13:84645781-84645803 GGGTGGATCAATGCAAATTGAGG + Intergenic
1112022133 13:95380718-95380740 GAGTGGGTTAATGCAAATTGAGG + Intergenic
1112582487 13:100688435-100688457 GGGCAGATTAATGCACATTGGGG + Intergenic
1112583574 13:100697167-100697189 GAGTGGGTTAATGCAAATTTGGG + Intergenic
1112751485 13:102588329-102588351 GGGTGGGTTAATGCAAACTGAGG + Intergenic
1116259350 14:42602982-42603004 GGGCAGGTTAATGCAAATTGAGG + Intergenic
1117243571 14:53860939-53860961 GGGAGGGTGAAAGTAAATTTGGG + Intergenic
1120813730 14:88831303-88831325 GGGTGGGCCAATGCAAATTAGGG - Intronic
1121513993 14:94536843-94536865 GGGCAGTTTAGTGCAAATTGAGG + Intergenic
1123854901 15:24398888-24398910 GGGCAGGTCAATGCAAATTGAGG + Intergenic
1123870931 15:24571872-24571894 GGGCAGATCAATGCAAATTGAGG + Intergenic
1125925468 15:43559406-43559428 GAAGGGGTTCATGCAAATTTAGG + Intronic
1125938611 15:43658957-43658979 GAAGGGGTTCATGCAAATTTAGG + Intronic
1129981172 15:79872616-79872638 GGGCAGGTCAATGCAAATTGAGG + Intronic
1133512583 16:6474053-6474075 GGGCTGGTTACTGCAAACTGTGG + Intronic
1133895994 16:9929478-9929500 GGCAGGCTTAATGCATATTTGGG - Intronic
1135995288 16:27243486-27243508 GGGCAGGTTGATGTAGATTTTGG - Intronic
1136245522 16:28973794-28973816 GGGGGGGTTAAAGCCAATTATGG + Intergenic
1137577825 16:49615257-49615279 CGGCAGGCAAATGCAAATTTCGG + Intronic
1138777434 16:59740914-59740936 GGGAAGGTTAATGCAAATTGAGG + Intronic
1142158017 16:88541555-88541577 GGGTGGGTTAATGCAAATTGAGG + Intergenic
1142746250 17:1960163-1960185 GGGCGGGGTGATGTGAATTTGGG - Intronic
1144424856 17:15132285-15132307 GGGTGGGTCAATTCAAATTGAGG - Intergenic
1146087973 17:29847876-29847898 GGGCAGGTTAATGCAAATTGAGG - Intronic
1155523941 18:26697561-26697583 GGGTGGGTCAATGCAATTTGAGG + Intergenic
1159108474 18:64029312-64029334 GAGTGGGTTAATGCAAATTGAGG + Intergenic
1159838540 18:73370017-73370039 GGGGGGGTTCATTCAAATTTGGG - Intergenic
1162001767 19:7749111-7749133 GGGTGGGTCAATGCAAATTGAGG - Intergenic
1164313380 19:24065710-24065732 GGGAGGGATCCTGCAAATTTTGG + Intronic
1165134738 19:33660703-33660725 AGGCAGGTTAATGCAAATCAAGG - Intronic
1166513337 19:43426206-43426228 GTGTGGATTAATGCAAATTAAGG - Intergenic
925634232 2:5927181-5927203 GGGAGGGAAAATGCAGATTTGGG - Intergenic
928618086 2:33058946-33058968 GCTCGGGTTTATGCAAATGTGGG + Intronic
930863709 2:56102497-56102519 GGGTGGGCCAATGCAAATTGAGG - Intergenic
931965433 2:67528671-67528693 GTGCAGGTTAATGCAAATTGAGG - Intergenic
933486888 2:82935445-82935467 GGGTGGGTCAATGCAAATTGAGG - Intergenic
940748452 2:157597212-157597234 GGGCAGGTTAATGCACATGCAGG - Intronic
942216421 2:173724312-173724334 GGCCAGGTAAATGTAAATTTTGG - Intergenic
944062200 2:195582012-195582034 GGGGGGGTCAATAAAAATTTTGG - Intronic
1169035415 20:2447151-2447173 GGGCAGGTTGATGCAAATTGAGG - Intergenic
1169308733 20:4517384-4517406 GAGAGGGTTAATCCTAATTTTGG + Intergenic
1171325011 20:24283460-24283482 GGGCAGGTCAATACAAATTAAGG + Intergenic
1172570708 20:35968166-35968188 GGGCAGGCTAATGCAAATTAAGG + Intronic
1172570712 20:35968188-35968210 GGGCAGGTTAATGCAAATTAAGG + Intronic
1174209902 20:48869470-48869492 GGGTGGGTTAAATCAAATATGGG - Intergenic
1178026796 21:28477635-28477657 GGGTGAGGTAATGCAAATTGAGG - Intergenic
1178042340 21:28653003-28653025 GGGAGGGTTAATGCAAATTGAGG - Intergenic
956919790 3:73914922-73914944 GGGCGGGTAAATAAAAATTAAGG - Intergenic
959770636 3:110090911-110090933 GGGCAAGTCAATGCAAATTGAGG + Intergenic
974836422 4:67256658-67256680 GGGTGGGTCAATGCAAATTAAGG + Intergenic
985136653 4:186792982-186793004 GGGCAGGTTAATGCAAATTGAGG + Intergenic
985700465 5:1368840-1368862 GGACAGGTCAATGCAAATTAAGG - Intergenic
986209495 5:5657345-5657367 GGTGGGGTTATTGCAAATTGAGG - Intergenic
989311324 5:40022121-40022143 AGGCATGTCAATGCAAATTTAGG + Intergenic
989800228 5:45528701-45528723 GTGGGGGTTAAGGCAAAATTTGG - Intronic
997065446 5:130554186-130554208 GGGTGGGTCAATGCAAATTGAGG - Intergenic
998323082 5:141250943-141250965 AGGTGAGTTAATGCAAATTGAGG - Intergenic
1001347082 5:170913342-170913364 GGGTGGGTGAATGCAAATGATGG + Intronic
1003043808 6:2714336-2714358 GGGTGAGTTAATGCAAATTGAGG - Intronic
1006199630 6:32276618-32276640 TGGTGGGTTAATGCAAATTGAGG + Intergenic
1009370476 6:62894376-62894398 GTGTGGATTAATGCAAATTGAGG + Intergenic
1010675913 6:78742752-78742774 GGGTGGGTTAATGCAAATTGAGG - Intergenic
1010865954 6:80976978-80977000 GGGCAGGTCAATGCAAATTGAGG - Intergenic
1010866606 6:80983337-80983359 GGGAAGGTCAATGCAAATTGAGG - Intergenic
1011545406 6:88477438-88477460 GGGTGGGTTAATGCAAATCAAGG + Intergenic
1012475329 6:99610207-99610229 GAGCGGATTTATGCAAATTAAGG + Intronic
1014480363 6:121928372-121928394 GGGCTGATTAATGCTAATTGTGG - Intergenic
1016519575 6:144931464-144931486 AGGCAGGTCAATGCAAATTGAGG + Intergenic
1023507302 7:40913396-40913418 GGGTGGACTAATGGAAATTTGGG - Intergenic
1024747671 7:52427161-52427183 GGGTGGGTTAATGCAAATTGAGG - Intergenic
1028317910 7:89427065-89427087 GGGTGGGTCAATGCAAATTGGGG + Intergenic
1030136028 7:106249623-106249645 GGGCAGGTTAATAAACATTTTGG + Exonic
1030776765 7:113543307-113543329 GGACGAGTCAATGCAAATTGAGG - Intergenic
1036474920 8:9084495-9084517 AGGCTGGAAAATGCAAATTTGGG - Intronic
1044249629 8:89990648-89990670 GGCAGGGTTAATGGAATTTTGGG - Intronic
1051011160 9:12416231-12416253 GGGCGAGTCAAAGCAAATTAAGG + Intergenic
1051383804 9:16485500-16485522 GACTGGGTTAATGCAAAGTTGGG - Intronic
1052245434 9:26328603-26328625 GGGGTGGTTAATTCAAATTTGGG - Intergenic
1055079494 9:72255226-72255248 GGGTGGGTGGATGCAAATTGAGG + Intronic
1056618663 9:88191445-88191467 GGGTGAATTAATGCAAATTAAGG + Intergenic
1187571393 X:20507157-20507179 GGAAGGGTTAAAGCGAATTTTGG + Intergenic
1190554767 X:51623081-51623103 GGGCAGGTCAATGCAAATTGAGG + Intergenic
1190628399 X:52359930-52359952 GGGCGGGTTAATGCAAATTTAGG - Intergenic
1190953319 X:55167455-55167477 GGGCAGGTTAATGCAAGTTGAGG - Intronic
1192950711 X:76013467-76013489 GTGCTGTTTAATGCTAATTTAGG - Intergenic
1194152789 X:90345696-90345718 GGGGTGGTCAATGCAAATTGAGG + Intergenic
1195373931 X:104207065-104207087 GGGTGGGTTAATGCAAATTGAGG + Intergenic
1195389221 X:104343689-104343711 GGGCAGGTTAATGCAAATTGAGG + Intergenic
1200499133 Y:3922441-3922463 GGGGTGGTCAATGCAAATTGAGG + Intergenic