ID: 1190629403

View in Genome Browser
Species Human (GRCh38)
Location X:52369939-52369961
Sequence GCTGTATTTGACCACTTTCA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 164
Summary {0: 1, 1: 1, 2: 0, 3: 14, 4: 148}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1190629403 Original CRISPR GCTGTATTTGACCACTTTCA TGG (reversed) Intronic
903101137 1:21030566-21030588 GATGTATTAGTCCATTTTCAGGG - Intronic
904186114 1:28706246-28706268 GCTGTTTCTGAATACTTTCAGGG + Intronic
906039734 1:42778945-42778967 CCTGTATTTCACCAATTACAAGG + Intronic
907581871 1:55579412-55579434 GCTGTATTTCAAAACTTTAAGGG - Intergenic
909323063 1:74314285-74314307 GCTGTTTTTCAAAACTTTCAAGG + Intronic
909505139 1:76379676-76379698 GCCAAATTTGACCACTTTCTGGG - Intronic
911612014 1:99968336-99968358 CCTGTATTAGTCCATTTTCATGG + Intergenic
914388998 1:147201288-147201310 CTTGTTTTTGACCACTTTGACGG + Exonic
915064832 1:153216257-153216279 GCTGAAGTTGACCAAATTCAAGG - Intergenic
917115200 1:171596138-171596160 ACTCTATTTAACCACTTCCAAGG - Intergenic
924198320 1:241633754-241633776 GCTGTTTTGGACCTCCTTCATGG - Exonic
1064850097 10:19700381-19700403 GTTTTATTTGACAACTTTAAAGG + Intronic
1068713828 10:60164603-60164625 GGTGTATTTGACCAAGTTGATGG - Intronic
1070265706 10:74900648-74900670 ACTGTGTTTGACAACTGTCAAGG + Intronic
1070454444 10:76597658-76597680 CATATATTAGACCACTTTCAAGG - Intergenic
1073659863 10:105463067-105463089 GCTGTATTTCAAAAGTTTCATGG + Intergenic
1078058149 11:8024314-8024336 GCAGGATGTCACCACTTTCATGG + Intronic
1080958419 11:37129544-37129566 ACTGTATTAGTCCATTTTCATGG - Intergenic
1082615551 11:55355960-55355982 CCTGGATTTGACCACTTTCCTGG - Intergenic
1083178704 11:60970764-60970786 TCTGGATTTGACCACTTCCAGGG + Intergenic
1087511702 11:99102875-99102897 ACTGTATTAGTCCATTTTCACGG + Intronic
1089676140 11:120090997-120091019 GCTGAATTTCTCCACTCTCATGG - Intergenic
1091042182 11:132292055-132292077 GCTGTACTGGATCATTTTCATGG - Intronic
1092043456 12:5406035-5406057 GCTGGATTTGAGCACTGTAAGGG + Intergenic
1094678846 12:32649361-32649383 GCTGTTTTTCACACCTTTCAGGG + Intergenic
1096284407 12:50285736-50285758 GCTGCATTTGCCCATTTCCATGG - Intergenic
1100118155 12:91334955-91334977 GGTGTATTAGCCCACGTTCATGG + Intergenic
1102418400 12:112784404-112784426 GCTGTCTTTGAACAATTTTAGGG - Intronic
1103839930 12:123854579-123854601 GCTGTTTTTTACCTCTTTCTCGG - Intronic
1107978038 13:45708805-45708827 ACTGCACTTGACCACTTTCTTGG + Intronic
1109968988 13:69739827-69739849 GCTGTATTTTGCCACTTCCCAGG + Intronic
1110453100 13:75659316-75659338 ACTGTATTTCACCACATTAATGG - Intronic
1111093577 13:83479324-83479346 TCTGTATTTATCCACTTACATGG + Intergenic
1111368526 13:87284421-87284443 TCTGTAATTGACCACTGTTAAGG - Intergenic
1112713763 13:102160173-102160195 GCTGTCTTTGATTACCTTCAAGG - Intronic
1118844715 14:69538760-69538782 ACTGTATCTGCCCAATTTCAGGG + Intergenic
1121478043 14:94231498-94231520 TCTGTACTTGTCCACTTTTAAGG + Intronic
1124069006 15:26373908-26373930 ACTGTATTAGTCCATTTTCATGG + Intergenic
1124687682 15:31796547-31796569 GATGTATTTGACCACATTTCTGG + Intronic
1126297886 15:47161744-47161766 TCTGTATTAGTCCATTTTCATGG + Intergenic
1132001352 15:98183586-98183608 TTTGTATTTGAACACTTTCATGG - Intergenic
1132061243 15:98693919-98693941 TCTGTTTTTGCCCACTGTCAAGG + Intronic
1133591569 16:7249300-7249322 TCTCTATTGCACCACTTTCAGGG - Intronic
1141348061 16:83266742-83266764 GCTGTCTTTTACCTCATTCATGG + Intronic
1142994617 17:3753330-3753352 GCTCCATTTTACCACGTTCATGG - Exonic
1143998082 17:11025905-11025927 ACTGAATTAGACCACTTTTAGGG + Intergenic
1144560004 17:16313431-16313453 GCTGCATTTGAAAAGTTTCAGGG + Intronic
1145210171 17:21006903-21006925 GCTGGACATGACCCCTTTCATGG - Exonic
1146785084 17:35712680-35712702 GCTGTATTTTTCAACTTTCATGG - Intronic
1147373737 17:40011666-40011688 TCTGTATCTGGCTACTTTCATGG + Intergenic
1147492581 17:40884097-40884119 TCTGTATTTTATCAGTTTCATGG - Intronic
1152380724 17:79941168-79941190 GCTGTCTTTGGCCACTCCCATGG - Intronic
1159401842 18:67948130-67948152 TCTTTATTTGACAGCTTTCAAGG + Intergenic
1159621323 18:70642078-70642100 CCTGTATTGGAACACATTCAAGG - Intronic
1163129991 19:15266324-15266346 GGTGTCTTTGTCCATTTTCATGG - Intronic
1163373055 19:16913183-16913205 GACATATTTGACCACTTCCATGG + Intronic
925745602 2:7040943-7040965 GCTGTCTGTGACCATTTCCATGG + Exonic
927294199 2:21434718-21434740 ATTGTATTAGTCCACTTTCATGG - Intergenic
927405254 2:22758931-22758953 GCTGCATTTGACCACATTCTGGG - Intergenic
930663272 2:54076786-54076808 GCTATATTTGACCACTCCTAAGG - Intronic
939320818 2:140619140-140619162 GCTGTTTCTGTCCTCTTTCAGGG + Intronic
944430116 2:199624121-199624143 TCTATATTTTACCAGTTTCACGG + Intergenic
945736476 2:213607143-213607165 ACTGAATTTGAGAACTTTCATGG - Intronic
1172744939 20:37199639-37199661 GCTGTCTTTCACAACTTCCAGGG - Intronic
1175610350 20:60346165-60346187 TCTGGATGTGGCCACTTTCAAGG - Intergenic
1182270267 22:29148952-29148974 GATGCATTTGACCACTTGCCTGG + Intronic
1184096884 22:42320924-42320946 GCTGTGTTTGTCCACAGTCATGG + Intronic
949303131 3:2607927-2607949 GCTGTATTTGATCACTTCTGTGG + Intronic
949352975 3:3144595-3144617 ACTTTATTTGACTACTTTAATGG + Exonic
951342464 3:21505336-21505358 TCTCTATTTGAACACTATCATGG - Intronic
951543907 3:23806843-23806865 GCTGTTTTTGTCCGCTTTCCGGG - Intronic
951660873 3:25064574-25064596 GGTGAAGTTGACCCCTTTCATGG - Intergenic
953530826 3:43738338-43738360 TCTGTATTTGACAAGTTTCCTGG + Intergenic
957365196 3:79213504-79213526 GCTGTCTCTAACCACTTTGAAGG + Intronic
963127707 3:141830558-141830580 GCTGTAACTTTCCACTTTCAGGG - Intergenic
970838393 4:20438233-20438255 TCTGTATTAGTCCATTTTCATGG + Intronic
973083020 4:46018103-46018125 GCTGTATTTAAAGAATTTCAAGG + Intergenic
973926800 4:55747257-55747279 GCTGTATTTCACTTCTCTCAAGG - Intergenic
974462725 4:62208726-62208748 GTTGTATTTCATCAATTTCAAGG - Intergenic
974782605 4:66572915-66572937 GCTTTATTTGACCAAGTTCTTGG + Intergenic
975728678 4:77317029-77317051 TCTGTATTTTGCCACTTGCATGG + Intronic
980592946 4:134915152-134915174 GCTTTATCTGACCACATTTAAGG + Intergenic
981066108 4:140488010-140488032 GCTGTGACAGACCACTTTCATGG + Intronic
983116376 4:163821724-163821746 GCTGTAATTTTCCACCTTCATGG - Intronic
983224484 4:165073289-165073311 GCTGTATTGGATCAGTTTAATGG + Intergenic
984654555 4:182303808-182303830 TCTCTATTTGACAACTTTCTAGG + Intronic
984696906 4:182788074-182788096 GCTGGATCTGTCCACTTTGAAGG + Intronic
985177963 4:187223058-187223080 GCTGTAATTTACCATTTTTAAGG + Intergenic
986903635 5:12467729-12467751 GCTGTACTTGCCCAGTCTCATGG - Intergenic
988294668 5:29340692-29340714 TCTGTATTTAATCACTTTTATGG - Intergenic
988924721 5:35978324-35978346 TCTGTATTAGTCCATTTTCATGG + Intronic
988925578 5:35988227-35988249 TCTGTATTTTACCACTTACCTGG - Intronic
989091315 5:37736000-37736022 GCTGTGTTTGAAAATTTTCATGG - Intronic
989247205 5:39267513-39267535 ACTGTATCTGATCTCTTTCAAGG + Intronic
991390051 5:66133012-66133034 GCAGTATTTGAGAACATTCACGG - Intergenic
992863797 5:80938342-80938364 GCTGTCTTTGAGCGCATTCAAGG - Intergenic
992998564 5:82357050-82357072 GATGTATTTGACCACATGAAAGG + Intronic
993425625 5:87760905-87760927 GCTGCCTTTGACCACTTTAGAGG + Intergenic
994847454 5:105008104-105008126 ATTGTATTAGTCCACTTTCATGG + Intergenic
995196628 5:109377330-109377352 ACTGTAATTGAGCACTGTCAGGG + Intronic
997275308 5:132582116-132582138 GCTGTCTTTGAACACTGTCAAGG + Intronic
1003177860 6:3766589-3766611 GCTGCTTTTGGCCCCTTTCAGGG + Intergenic
1007268758 6:40619473-40619495 TCTTTATTTGACCATTTTTAAGG - Intergenic
1008654798 6:53601114-53601136 GCTATATTTAACTATTTTCATGG + Intronic
1013121198 6:107142856-107142878 GCTGTATTTTACCATTTTCTAGG - Intergenic
1014229707 6:118889702-118889724 GTTGTTTTTGACCATTTTGAAGG - Intronic
1015446230 6:133308192-133308214 GCTGTATTAGTCCATTTTCATGG - Intronic
1017021721 6:150144633-150144655 TCTGTATTTGACACATTTCATGG + Intronic
1018006281 6:159625230-159625252 GCATTAATTGACCACTTTAAAGG + Intergenic
1018240187 6:161766738-161766760 GCTGAGTCTGACCAATTTCATGG + Intronic
1019684143 7:2371210-2371232 TCTGTGTTTGACCTCCTTCACGG + Intronic
1020561310 7:9731117-9731139 GCTGTATTTCACCCCTTTTCTGG + Intergenic
1021679430 7:23115151-23115173 GCTGAATTTGTCCAATTTCAAGG + Intronic
1021891077 7:25187010-25187032 GCTGGACATGACCCCTTTCATGG + Intergenic
1022184922 7:27957994-27958016 GATCTATTAGACCACTTTCAAGG - Intronic
1022184965 7:27958474-27958496 GCTGTATTAGACTGCTGTCAAGG - Intronic
1022671884 7:32463365-32463387 GCTAAATTTGACCACTGTGAAGG + Intergenic
1027634210 7:80649380-80649402 GTAGGATATGACCACTTTCAAGG + Intronic
1028860180 7:95640380-95640402 GATGTATTTGAACACTTCTAAGG + Intergenic
1032856139 7:135835020-135835042 GCTGGATTTGCCCAAGTTCATGG - Intergenic
1034188526 7:149196635-149196657 GTTGTGTTTGATCATTTTCAGGG + Intronic
1034258659 7:149739823-149739845 GCTGTATTAGCCTATTTTCATGG + Intergenic
1035698177 8:1616589-1616611 GATGTTTTTGATCACTTTAAAGG - Intronic
1040532876 8:48279861-48279883 GATGTATTTGCTCAGTTTCAGGG + Intergenic
1040738661 8:50543859-50543881 GCTTTATTGAACCACTTTAATGG + Intronic
1041475167 8:58257107-58257129 GTTGTAATTTACCATTTTCAAGG - Intergenic
1044444165 8:92254425-92254447 GATGAATTTGATAACTTTCAAGG + Intergenic
1046163472 8:110397426-110397448 CCTGTGTTTCACCAGTTTCATGG + Intergenic
1046986602 8:120395342-120395364 ACTGCATTTGAGCATTTTCATGG - Intronic
1047234936 8:123032619-123032641 GTTTTATTTTAGCACTTTCAAGG + Intronic
1049479350 8:142813348-142813370 GCTGACCTTGACCACTTCCATGG - Intergenic
1058018189 9:100060363-100060385 GTTTTATTTGACCAATTTCTAGG - Intronic
1185604829 X:1362620-1362642 CCTGTATTAGTCCATTTTCATGG + Intronic
1185859241 X:3562307-3562329 TTCGTATTTGACCACTGTCATGG - Intergenic
1187239126 X:17496397-17496419 TCCGTTTTTGACCACTTTCTGGG + Intronic
1188380543 X:29486345-29486367 TCAGTATTTTACCACTCTCAAGG + Intronic
1188421809 X:29999088-29999110 GCTTAAATTGATCACTTTCATGG - Intergenic
1188809249 X:34632467-34632489 GCTGTATTTCATCAGTTTTATGG - Intronic
1189662247 X:43312749-43312771 GTTATATGTGACCATTTTCATGG + Intergenic
1190344333 X:49323118-49323140 GCTATATTCGATCACTTCCATGG - Intronic
1190345426 X:49332662-49332684 GCTATATTCGATCACTTCCATGG - Intronic
1190346525 X:49342228-49342250 GCTATATTCGATCACTTCCATGG - Intronic
1190347771 X:49533256-49533278 GCTATATTCGATCACTTCCATGG - Intronic
1190348872 X:49542812-49542834 GCTATATTCGATCACTTCCATGG - Intronic
1190349974 X:49552368-49552390 GCTATATTCGATCACTTCCATGG - Intronic
1190351077 X:49561921-49561943 GCTATATTCGATCACTTCCATGG - Intronic
1190352178 X:49571479-49571501 GCTATATTCGATCACTTCCATGG - Intronic
1190353279 X:49581028-49581050 GCTATATTCGATCACTTCCATGG - Intronic
1190355484 X:49600099-49600121 GCTATATTCGATCACTTCCATGG - Intronic
1190365889 X:49694824-49694846 GCTATATTCGATCACTTCCATGG + Intronic
1190629403 X:52369939-52369961 GCTGTATTTGACCACTTTCATGG - Intronic
1190633288 X:52410486-52410508 GCTATATTTGACCACTTTCATGG + Intergenic
1190642872 X:52496710-52496732 ACTAGATTTGACCGCTTTCATGG - Intronic
1190644801 X:52516157-52516179 ACTAGATTTGACCGCTTTCATGG + Intronic
1190681283 X:52829328-52829350 GCTATATTTGAGCACTTCCATGG + Intergenic
1190953929 X:55172641-55172663 GCTATATTTGGCCACTTCTATGG - Intronic
1190998447 X:55635718-55635740 GCTATATTTGAGCACTTCCATGG + Intergenic
1191605579 X:63058491-63058513 GCTGCATTTCACCTCTTTCATGG - Intergenic
1191929428 X:66353390-66353412 GTTGATTTTGACAACTTTCATGG + Intergenic
1193285637 X:79711929-79711951 TCTGTATTTGACTTCTTCCAAGG - Intergenic
1194426055 X:93739504-93739526 GCTGTAGTTGAGCACTGTCATGG - Intergenic
1194860071 X:98987634-98987656 GCTATATTTGATAACTCTCATGG - Intergenic
1194961783 X:100244483-100244505 CCTCTATTTAAACACTTTCAGGG + Intergenic
1198957058 X:142144959-142144981 TCTGTAGTAGACCTCTTTCATGG - Intergenic