ID: 1190635365

View in Genome Browser
Species Human (GRCh38)
Location X:52427403-52427425
Sequence AGTGAGACTCACCATAAGGG TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 101
Summary {0: 1, 1: 0, 2: 0, 3: 7, 4: 93}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1190635365 Original CRISPR AGTGAGACTCACCATAAGGG TGG (reversed) Intergenic
904203571 1:28837701-28837723 GGTGAGACTCTCCATAAAAGAGG - Intronic
905627811 1:39499819-39499841 AGTGAGACACACCAGCTGGGGGG - Intronic
913484798 1:119324371-119324393 AGTGAGAGTCACACTAAGGGAGG + Intergenic
1068486287 10:57663304-57663326 AGTGAAACTGCACATAAGGGAGG - Intergenic
1073519314 10:104111730-104111752 AGTGACACTCAACATAATGGTGG - Intergenic
1078540784 11:12211446-12211468 AGTGAGAATCAGCATGAGGCTGG + Intronic
1084266547 11:68008184-68008206 AGTGAGGCTCCCCCCAAGGGAGG - Intergenic
1088933889 11:114379417-114379439 TGTGAGACTCCCCAGAAAGGAGG - Intergenic
1095366984 12:41419216-41419238 TGTGAGAGTCACCATAAAGCTGG + Intronic
1096537183 12:52282606-52282628 AGTGAGAGTGACCATAGGGCAGG + Intronic
1100560290 12:95741848-95741870 AGTGAAACTGCACATAAGGGAGG + Intronic
1102005556 12:109587239-109587261 TGTGAGAGTCACCATGATGGAGG + Intronic
1102122361 12:110451574-110451596 TGTGAGACTGACCATGAGGAAGG - Intergenic
1103155019 12:118677239-118677261 AGGGAGGCTCACCTTAAAGGGGG + Intergenic
1104451090 12:128868561-128868583 AGTGAGAAATACCATTAGGGAGG + Intronic
1112312224 13:98328968-98328990 AGCAAGACTGACGATAAGGGAGG + Intronic
1113247918 13:108419713-108419735 AGGGAGAAACACCATAAGGTAGG + Intergenic
1114271303 14:21101975-21101997 AGTAAGACCCACCACAAGGGAGG + Exonic
1114693849 14:24608727-24608749 AGAGAGACTCACTAAAAAGGAGG - Intronic
1115331805 14:32205532-32205554 AGTAAGACTCATCGTGAGGGTGG - Intergenic
1118563117 14:67108352-67108374 GGTGAGACTCAGCCAAAGGGAGG - Intronic
1126485645 15:49177651-49177673 AGTGAGAATCACCAGGAGTGTGG + Intronic
1127671994 15:61204199-61204221 GCTGAGACTCACCAGATGGGTGG + Intronic
1127765025 15:62177260-62177282 AGTAAGACTCACCAGGAAGGAGG - Intergenic
1129646246 15:77436470-77436492 AGTGAGACTCTCCATCTTGGGGG - Intronic
1129826835 15:78640177-78640199 ATAGAGACCCACCATAGGGGAGG - Intronic
1130087695 15:80791851-80791873 AGTGAGACTCCCCTTTGGGGAGG + Intronic
1139248625 16:65472901-65472923 AGTGAGACTCCGCCTCAGGGGGG + Intergenic
1144028351 17:11298294-11298316 AGTGGGACACACAATAAGAGAGG + Intronic
1147608894 17:41789900-41789922 AGGGGCATTCACCATAAGGGAGG - Intergenic
1154246433 18:12703154-12703176 ATGGAGACTCACCATTAGGAGGG - Exonic
1154296559 18:13155719-13155741 AGTGTGATTCATCATAAGTGAGG + Intergenic
1155559469 18:27060441-27060463 AGTGCAGCTCACCAGAAGGGCGG + Intronic
1157586974 18:48807205-48807227 AGTGATTCTCACGAGAAGGGTGG - Intronic
1161561634 19:4976337-4976359 AGACAGCCTCACCATAAAGGAGG + Intronic
1165098037 19:33420859-33420881 AGAGAGACTGACCAGGAGGGGGG - Intronic
1168487255 19:56774420-56774442 AGTGATACTCATCGTGAGGGAGG - Intergenic
926216787 2:10910924-10910946 AGTGAAACGTACCATAATGGCGG - Intergenic
932368141 2:71166261-71166283 ACAGAGACCCACCATAGGGGTGG - Intergenic
936394939 2:112118404-112118426 AGTGAGACCCACCCTGATGGGGG - Exonic
936669761 2:114643552-114643574 AGTGACCCTCACCTTAAAGGAGG - Intronic
937524650 2:122753551-122753573 AATCACACTCACCAAAAGGGTGG + Intergenic
939910890 2:147981487-147981509 AGTGAAACTGAGGATAAGGGAGG + Intronic
940014208 2:149086501-149086523 AGTAAGACTCAGCAAAAGGAAGG - Intronic
941511089 2:166411134-166411156 AGTGAGACTTCAGATAAGGGGGG - Intronic
944165592 2:196716582-196716604 TGTGAGAATCACCAGAAGTGTGG + Intronic
948238159 2:236405979-236406001 AGTGAAACTGAGAATAAGGGGGG + Intronic
1175099499 20:56568494-56568516 ATTGAGACCGACCAAAAGGGAGG - Intergenic
1184292427 22:43505118-43505140 AGTGATGATCACGATAAGGGTGG + Intronic
953165015 3:40457353-40457375 AGTAAGACTCACCATGTTGGCGG - Exonic
953480856 3:43250770-43250792 CCTGAGACCCACCATAAGGATGG + Intergenic
957370326 3:79285656-79285678 TGTGAAATTCACCCTAAGGGAGG + Intronic
960296201 3:115947523-115947545 AGTGATACTGACCACAAGAGAGG + Intronic
961362841 3:126378931-126378953 AATGAGACTTACCTAAAGGGAGG - Intergenic
963428298 3:145161395-145161417 AGTGAGACACACAAAAATGGAGG - Intergenic
964344237 3:155739967-155739989 ATTGGGATTTACCATAAGGGGGG - Intronic
964854811 3:161135427-161135449 AGTGACACTCAAAATAAAGGTGG + Intronic
966927187 3:184652439-184652461 TGTGGGCCTCACCATAAGGGAGG - Intronic
970353759 4:15232259-15232281 ATTGAGACACACCATAATGGAGG + Intergenic
971008963 4:22409058-22409080 AGTGAGAGACATCAAAAGGGTGG + Intronic
972269077 4:37492394-37492416 AGTGAGAATCACCATCAGTGAGG - Intronic
973280390 4:48354478-48354500 AGCGAGACTCAGCCTGAGGGGGG - Intronic
974699650 4:65424052-65424074 GGTGGGACTCACCATTAGAGTGG - Intronic
975613523 4:76223842-76223864 AGGGAGACTCACTCTGAGGGTGG - Intronic
976424153 4:84881017-84881039 AGTAAGACTTACCATCAGGTTGG - Intronic
977120790 4:93098386-93098408 AGGCAGACTCACCATCAGAGAGG + Intronic
978904874 4:113993994-113994016 AGTGAAACTGAGCCTAAGGGTGG - Intergenic
980994343 4:139766100-139766122 AGTGAGACTCACTTTGTGGGAGG - Intronic
984259789 4:177430586-177430608 AGTCAGATTCTCCATAAGTGAGG - Intergenic
993777592 5:92019756-92019778 AGTGAAACTGAAGATAAGGGAGG + Intergenic
1001671464 5:173477621-173477643 AGTCAGACTCTCCATAAAGCAGG - Intergenic
1002092932 5:176815366-176815388 GGTGAGACTCCCCAGAAGGCAGG - Intronic
1008394986 6:50995614-50995636 AGTTAGACTTCCCAAAAGGGAGG - Intergenic
1009563173 6:65275028-65275050 AGTGGGACCCATAATAAGGGAGG + Intronic
1011330284 6:86197307-86197329 AATGAGAATCACAATGAGGGGGG + Intergenic
1012713281 6:102635904-102635926 AATTAGACTCACCATAAGGTAGG - Intergenic
1012992521 6:105940279-105940301 AGGGGAGCTCACCATAAGGGAGG + Intergenic
1015771648 6:136774020-136774042 AATGAGTCTCTCCATAAGGAAGG - Intronic
1019644730 7:2122983-2123005 AGCCAGACTCAGCAGAAGGGAGG - Intronic
1020193956 7:6022668-6022690 AGTGAGACACAGCTCAAGGGGGG + Exonic
1022260422 7:28699008-28699030 CGAGATACTCACAATAAGGGAGG + Intronic
1030849531 7:114465915-114465937 AGTGAGCCTCAACAGATGGGAGG - Intronic
1031619746 7:123921937-123921959 AGTGATACTCACCATCACTGAGG + Intergenic
1036567905 8:9953478-9953500 AGAGAGATTCAACAGAAGGGAGG - Intergenic
1037908421 8:22728986-22729008 AGTGTGCATCACCATATGGGTGG - Intronic
1042480829 8:69300962-69300984 AGTAAAATTCACCATAAGGTTGG + Intergenic
1042599226 8:70481730-70481752 AGTGAAACTCACCAGGAGAGGGG - Intergenic
1043575064 8:81647143-81647165 TGTGAGAATCACCATAAATGGGG - Intergenic
1050006159 9:1132933-1132955 AGTGAAACTATGCATAAGGGAGG + Intergenic
1050190661 9:3022130-3022152 AGTGAAATTCAACATACGGGTGG + Intergenic
1053380875 9:37649367-37649389 AGACAGAAGCACCATAAGGGTGG - Intronic
1060003368 9:119978482-119978504 AGTGGGGCTCACAAAAAGGGTGG - Intergenic
1061827834 9:133273061-133273083 GGTGAGACCCACCAGAATGGAGG + Intronic
1062171158 9:135135614-135135636 AGTGAGCCTCTCCATATGTGTGG - Intergenic
1187721397 X:22154652-22154674 AATGAGCCTTACCATAAGGCAGG - Intronic
1189046659 X:37600080-37600102 AGTGAAACTGAGGATAAGGGGGG - Intronic
1189339077 X:40190858-40190880 AGGGAGACACACCAAGAGGGAGG + Intergenic
1189395712 X:40621084-40621106 AGTGAGACTCCCTCTCAGGGGGG - Intergenic
1190635365 X:52427403-52427425 AGTGAGACTCACCATAAGGGTGG - Intergenic
1194040225 X:88932016-88932038 TGTGAGATTCACCAAAAGAGAGG + Intergenic
1201362295 Y:13166103-13166125 AGTGAAACTAAGCATAAGTGGGG - Intergenic