ID: 1190636307

View in Genome Browser
Species Human (GRCh38)
Location X:52437423-52437445
Sequence AATCATAAACAGAGGGAGGC TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 330
Summary {0: 1, 1: 0, 2: 4, 3: 23, 4: 302}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1190636302_1190636307 -2 Left 1190636302 X:52437402-52437424 CCTCATCTCTCACCATATACAAA 0: 61
1: 1180
2: 2207
3: 2907
4: 4282
Right 1190636307 X:52437423-52437445 AATCATAAACAGAGGGAGGCTGG 0: 1
1: 0
2: 4
3: 23
4: 302
1190636301_1190636307 -1 Left 1190636301 X:52437401-52437423 CCCTCATCTCTCACCATATACAA 0: 6
1: 90
2: 594
3: 1496
4: 2564
Right 1190636307 X:52437423-52437445 AATCATAAACAGAGGGAGGCTGG 0: 1
1: 0
2: 4
3: 23
4: 302
1190636300_1190636307 24 Left 1190636300 X:52437376-52437398 CCACACGCAGATGAATGAAATTT 0: 1
1: 1
2: 21
3: 236
4: 1399
Right 1190636307 X:52437423-52437445 AATCATAAACAGAGGGAGGCTGG 0: 1
1: 0
2: 4
3: 23
4: 302

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1190636307 Original CRISPR AATCATAAACAGAGGGAGGC TGG Intergenic
900122161 1:1053433-1053455 AAGCAGGAAGAGAGGGAGGCGGG - Intronic
901342537 1:8508271-8508293 AGTCAAAAACAGAGAGAGGAAGG + Intronic
901796758 1:11684018-11684040 AATCACAAACAGAAGGAAGGTGG + Intronic
901866739 1:12111488-12111510 AGTCTTTAAAAGAGGGAGGCAGG + Intronic
902689938 1:18104805-18104827 CACCATGAACAGAGGGAGGCTGG + Intergenic
903437792 1:23365095-23365117 AAAAATAAAAAGAGGCAGGCCGG + Intronic
904576251 1:31506915-31506937 AATGAGAAGCAAAGGGAGGCAGG + Intergenic
905289397 1:36911182-36911204 AATAATAAACTGAGGGAGGGAGG + Intronic
905684732 1:39900712-39900734 AATAATCATCAAAGGGAGGCTGG + Intronic
907773904 1:57493725-57493747 AAGAAGAAAAAGAGGGAGGCAGG + Intronic
908399178 1:63754180-63754202 AATCTTTATAAGAGGGAGGCAGG + Intergenic
908471531 1:64448787-64448809 AATGATACACTGAAGGAGGCAGG - Intergenic
908901354 1:68959937-68959959 AAACATACACAGAGGGAGGCTGG - Intergenic
908910001 1:69062271-69062293 ACACAGAGACAGAGGGAGGCGGG + Intergenic
910027236 1:82670122-82670144 AATGATTAACAGGGAGAGGCTGG + Intergenic
910417648 1:87017431-87017453 AATTTTAAAAAGAGAGAGGCCGG - Intronic
916144849 1:161729137-161729159 AATTATACAGAGAGGCAGGCAGG + Intergenic
918311159 1:183286434-183286456 AGTCACAATCAGAGAGAGGCAGG - Intronic
918540615 1:185627986-185628008 AAGGCTAAAAAGAGGGAGGCTGG - Intergenic
919777969 1:201206413-201206435 AATCCCACAGAGAGGGAGGCTGG + Exonic
920551594 1:206866097-206866119 AATCATAAAAAGAGGCAGGCTGG + Intronic
921951851 1:220938366-220938388 AATCAAAGCCAGAGGTAGGCAGG - Intergenic
922173946 1:223180187-223180209 AATCATACAAAGAAAGAGGCTGG - Intergenic
1063705943 10:8430911-8430933 AGTCCTTAACAGAGGGAGGTGGG - Intergenic
1064296695 10:14085104-14085126 ATTTATAAACAGATGGAGGTGGG - Intronic
1065938656 10:30544141-30544163 AAACAAAAACAGAGAGAGACAGG - Intergenic
1066006421 10:31150166-31150188 AATTAGAAACAGAGGAAGTCAGG + Intergenic
1067150792 10:43731666-43731688 AAGCAGAAACAGAAGGAGGAAGG - Intergenic
1067233063 10:44425527-44425549 AATGAGAAACAGAGATAGGCTGG + Intergenic
1068836800 10:61564271-61564293 TATCATTCACATAGGGAGGCAGG - Intergenic
1068978784 10:63038712-63038734 AATGAAAAACAGAGAGAAGCTGG + Intergenic
1070485454 10:76926285-76926307 AATTAGAAACAGAAAGAGGCAGG - Intronic
1072548289 10:96457304-96457326 AGTCCTATATAGAGGGAGGCTGG - Intronic
1073135110 10:101216011-101216033 AATCAGAGACTGAAGGAGGCGGG + Intergenic
1073393121 10:103195329-103195351 AATAATAAAAAGAATGAGGCCGG + Intergenic
1074712572 10:116189448-116189470 AATCAAAAAAAGAGGGAAGAAGG - Intronic
1075250516 10:120866832-120866854 AATCATAAAAATAGGAGGGCTGG + Intronic
1075301490 10:121328596-121328618 AATCAAAATCACAGTGAGGCCGG - Intergenic
1077355440 11:2114669-2114691 AATCACAAGCAGAGAGTGGCGGG + Intergenic
1078601873 11:12739745-12739767 AATCAGTAACAGAGGGAGAGAGG - Intronic
1079946964 11:26755858-26755880 ACTCATGAACAGAGGGAAGGGGG + Intergenic
1081087431 11:38819205-38819227 CATCATAAACTGTGGTAGGCTGG - Intergenic
1081698555 11:45136844-45136866 AATCAAAAACAGATGGGGGCCGG + Intronic
1082890051 11:58129529-58129551 GATCAAAACCAGAGGGAGGTTGG - Intronic
1083222166 11:61259478-61259500 AGCCATGAACGGAGGGAGGCAGG + Intronic
1083233923 11:61339969-61339991 AATAAAAAAAAGAGGAAGGCAGG - Intronic
1084643625 11:70441383-70441405 AATCAAAACCACATGGAGGCTGG + Intergenic
1084738712 11:71123501-71123523 CATCATAAGGAGAGGGAGGGAGG + Intronic
1086234315 11:84609706-84609728 AATCATAAAAAAGGGAAGGCAGG - Intronic
1087502165 11:98971482-98971504 AATCTTAGACAGAAGGAAGCAGG + Intergenic
1088139281 11:106595981-106596003 AATCAGAGAGACAGGGAGGCAGG + Intergenic
1089316011 11:117591930-117591952 AGTTCTAAACAAAGGGAGGCAGG + Intronic
1089399682 11:118157256-118157278 AAACAGAAACAGAGGAAGGGAGG - Intergenic
1091061591 11:132468099-132468121 AAGCAGAAAGAGAGGGAGGCTGG - Intronic
1091284679 11:134402034-134402056 AAGCAGGAACAGAGGGAGCCAGG - Intronic
1091750924 12:3020812-3020834 AAGCAGAAACAGAGGGAGAGGGG - Intronic
1092290493 12:7157244-7157266 GAACAAACACAGAGGGAGGCAGG - Intronic
1095797665 12:46237967-46237989 CATTATAACCAGAGGGAGGAGGG + Intronic
1096757081 12:53808657-53808679 AACAAAAAAAAGAGGGAGGCTGG - Intergenic
1098446011 12:70566233-70566255 AATCAGAAACAGAGTGTGGTGGG + Intronic
1099091011 12:78308118-78308140 AATCATGCCCAGAGGCAGGCTGG - Intergenic
1100474293 12:94921639-94921661 AATAAAAAACAAATGGAGGCAGG - Intronic
1101294892 12:103411871-103411893 ACACATACACAGAGGGAGACAGG + Intronic
1103996387 12:124833108-124833130 GATCTTTGACAGAGGGAGGCAGG - Intronic
1104280553 12:127372658-127372680 AATGAGAGAAAGAGGGAGGCAGG + Intergenic
1104668668 12:130665973-130665995 ATTCAGAAAAAGAGGGAGACAGG - Intronic
1104678905 12:130735376-130735398 AAACAAAAACAGAGGGAACCAGG - Intergenic
1104709535 12:130975939-130975961 AAACATTCACAGAGGGAGGAAGG - Intronic
1105464350 13:20623769-20623791 AAACATAAATAAATGGAGGCTGG - Intronic
1106139251 13:26997830-26997852 AAACAGAAGCAGATGGAGGCTGG - Intergenic
1106421519 13:29589675-29589697 AGCCAGAAACAGAGGGACGCAGG + Intronic
1106749829 13:32750836-32750858 ACACACACACAGAGGGAGGCCGG - Intronic
1107838836 13:44435325-44435347 AATCACGAAAAGAGGGGGGCGGG - Intronic
1108141578 13:47428065-47428087 AATAATAAAAAGGGGGAGGTGGG + Intergenic
1108529881 13:51318950-51318972 AATCATAAAAAGATGGAGGAAGG - Intergenic
1109843899 13:67958307-67958329 ATTCACAAACAGAGGGATTCTGG - Intergenic
1111614644 13:90647061-90647083 AACCACTAACACAGGGAGGCTGG + Intergenic
1113258113 13:108529569-108529591 AAACATAATCAGAGGCAGACTGG + Intergenic
1113347587 13:109495178-109495200 AATCATAAACAGGGGCGGCCAGG - Intergenic
1115936154 14:38555056-38555078 AATCCTTATAAGAGGGAGGCAGG + Intergenic
1116863393 14:50012268-50012290 AATTATAAATTGTGGGAGGCAGG - Intergenic
1116992383 14:51290059-51290081 AATAATCAACAGAGGTAGGTAGG + Intergenic
1116995075 14:51314837-51314859 TATAATAAACAGTGGGAGGGAGG + Intergenic
1117518359 14:56525232-56525254 AAACAGAAACAGTGGGAGGCTGG + Intronic
1119111872 14:71982306-71982328 AAAAATAAACAGAAGGAGGGAGG - Intronic
1124204397 15:27704696-27704718 AATCATACACAGCAGGAGGATGG + Intergenic
1126564900 15:50084839-50084861 GATCCTTATCAGAGGGAGGCAGG - Intronic
1127506021 15:59598644-59598666 AATCAGAAAGACAGGGAGGCAGG + Intronic
1128608782 15:69057847-69057869 AAACAGAGACAGAGGGAGCCAGG - Intronic
1128658955 15:69483888-69483910 AATCAAAAGCAGATGGAGGGCGG - Intergenic
1129632216 15:77273055-77273077 AATCATACATAAAGGGATGCTGG - Intronic
1130001019 15:80046816-80046838 AATCATAAAGAGGGGAAGGTTGG - Intergenic
1130898353 15:88188202-88188224 AATCAGAAACAGAGAGTGGAGGG + Intronic
1132344218 15:101098374-101098396 AATAATTAAAAGATGGAGGCCGG + Intergenic
1134848590 16:17461684-17461706 ATGCATAAATAGATGGAGGCAGG + Intronic
1135186123 16:20317109-20317131 AATTATAAACGCAGGGAGGGTGG - Intronic
1135824623 16:25715788-25715810 AATCATGGACAGAGGGACTCCGG - Intronic
1135832413 16:25787641-25787663 AATCAAAAATAGAGGAAGCCAGG + Intronic
1136220925 16:28828288-28828310 AATCATTAACAGTTGCAGGCCGG + Intronic
1136418722 16:30118805-30118827 AATAATAAACTGTGGGAGGCAGG + Intronic
1136688313 16:32009146-32009168 AACCATCCACACAGGGAGGCGGG - Intergenic
1136788914 16:32952701-32952723 AACCATCCACACAGGGAGGCAGG - Intergenic
1136880898 16:33901233-33901255 AACCATCCACACAGGGAGGCAGG + Intergenic
1140049595 16:71468354-71468376 AAATATAGCCAGAGGGAGGCTGG - Intronic
1140741746 16:77947754-77947776 CCTCAAAAACAGAGGGAGGTAGG - Intronic
1141138428 16:81481869-81481891 AAAAAAAAAAAGAGGGAGGCGGG - Intronic
1141455601 16:84139642-84139664 AAGGATAAACAGTGGGAGGAAGG + Intronic
1141725810 16:85787574-85787596 ATTCATCAACAAAGGGAGGCAGG + Intronic
1142371967 16:89687437-89687459 AATCATTAACAGATCGTGGCTGG + Intronic
1203091111 16_KI270728v1_random:1214190-1214212 AACCATCCACACAGGGAGGCGGG - Intergenic
1142942243 17:3390240-3390262 AATAAGAAAGAGAGGGAGGGAGG + Intergenic
1143606288 17:7988286-7988308 AAACATACAGAGAAGGAGGCCGG - Intergenic
1143695098 17:8608782-8608804 AATCATAGACAGAGGAAGATGGG - Intronic
1144273268 17:13640565-13640587 AATCAGAGAGACAGGGAGGCAGG - Intergenic
1145230493 17:21170161-21170183 AGGGATAAACAGTGGGAGGCAGG - Intronic
1149143833 17:53466034-53466056 ATGCATAAACAGAGGAAGGAAGG + Intergenic
1150919799 17:69470715-69470737 AAACAAAAACAGAGGTAAGCAGG - Intronic
1151385113 17:73750437-73750459 CAGCACAAACAGAGGGAGGTGGG + Intergenic
1151580879 17:74977838-74977860 AATCAAAAAAAGAGAGAGGAGGG + Intergenic
1151689269 17:75671271-75671293 AAACATCAACACAGGAAGGCAGG - Intronic
1151885897 17:76923308-76923330 CATCATAAGCAGAGTCAGGCTGG - Intronic
1152663389 17:81553186-81553208 CTTCTTAAACGGAGGGAGGCGGG - Intronic
1155043529 18:22084726-22084748 AATCTTTAACAGAGGAAGACTGG - Intergenic
1155125027 18:22865836-22865858 AAGCATAAACAGTAGGAGGCAGG - Intronic
1155520320 18:26661322-26661344 AATTATAAACAGGTGGTGGCTGG - Intergenic
1156245761 18:35296330-35296352 TATCAGGAACAGAGGGAGCCTGG + Intergenic
1157404056 18:47408869-47408891 ATTCATAACAAGAGGGAGGAGGG + Intergenic
1158215639 18:55097842-55097864 AATCCTAACCAGAGAGAAGCTGG - Intergenic
1159095635 18:63898395-63898417 TAAAATATACAGAGGGAGGCAGG - Intronic
1160164516 18:76498016-76498038 AATTATAAATAGAGGGTGGGGGG - Exonic
1161518695 19:4711470-4711492 AGTCCTTATCAGAGGGAGGCAGG + Intronic
1161704573 19:5813236-5813258 AAAAAAAAACAGATGGAGGCTGG + Intergenic
1161719460 19:5895025-5895047 ACTGATGCACAGAGGGAGGCCGG + Intronic
1162923066 19:13914903-13914925 TATCACAAAGAGAGGGAGGGAGG - Intronic
1163572527 19:18090846-18090868 GATCAGGAACAGATGGAGGCCGG + Intronic
1164889759 19:31813117-31813139 GATTATAAACAGAGGCAGGAAGG + Intergenic
1167820405 19:51922511-51922533 AAGGATAAACAGAGCGAGTCTGG + Intronic
926825164 2:16898903-16898925 AAGGATAAGCAGATGGAGGCTGG + Intergenic
926987780 2:18642466-18642488 AATGATAAACATAAGAAGGCTGG + Intergenic
927381151 2:22480422-22480444 AGTCTTAAAAAGAGGCAGGCAGG + Intergenic
929536465 2:42787289-42787311 AAGCAAAGACAGAGGGAGACAGG + Intronic
929870269 2:45753228-45753250 AATCAGAAACATGGGGAGGAGGG - Intronic
931233478 2:60393902-60393924 ATTCATAAAGACAGGGGGGCAGG + Intergenic
931573826 2:63698734-63698756 ACTCAGAAAAAGAGGGAGGGGGG + Intronic
931677302 2:64710006-64710028 ATTTAAAATCAGAGGGAGGCTGG - Intronic
932603153 2:73144049-73144071 AAATATAAGCAGAGGGAGTCTGG - Intronic
932925987 2:75975133-75975155 AATCATCAGCAGAGGGAAGAGGG + Intergenic
933379580 2:81525831-81525853 AATAATAAACAGAGTGATCCAGG - Intergenic
933740853 2:85532800-85532822 AAAGATAAAGAGAGGGAGGGAGG - Intergenic
934940968 2:98501680-98501702 AATCATAGACTGGGGGAGGGAGG + Intronic
935014200 2:99164478-99164500 ACTCATAAACAGAGGGAGCTGGG - Intronic
935512186 2:103989913-103989935 AATCAGAAACAGAGGGAAAAGGG - Intergenic
936025360 2:109027528-109027550 TATCATAAACAGAGGGTGGATGG - Intergenic
936066730 2:109338026-109338048 CATCAAAAACAGAAGGAGCCTGG - Intronic
937621315 2:123990938-123990960 TATAAGAAAAAGAGGGAGGCAGG + Intergenic
938657418 2:133448253-133448275 AAAAAAAAAAAGAGGGAGGCGGG + Intronic
938965909 2:136388356-136388378 AATCATAAACAGATCAAAGCAGG - Intergenic
940182359 2:150949013-150949035 AATCATAGACTTTGGGAGGCAGG - Intergenic
940342014 2:152591303-152591325 AAATATTACCAGAGGGAGGCCGG - Intronic
940906399 2:159173783-159173805 TATCATCAACAGAGGAAAGCTGG - Intronic
942333475 2:174853817-174853839 AATCCTAAACAGATGAATGCAGG + Intronic
944122848 2:196259629-196259651 AACCTTAAGCAGAGAGAGGCTGG - Intronic
945013102 2:205485813-205485835 AAGGATAAAGAGAGGGTGGCTGG - Intronic
945969054 2:216218635-216218657 AATCTTTAAAAGAGGGAGCCAGG - Intergenic
946063414 2:216965746-216965768 AATCAGAGACAGAGAGAGGAAGG + Intergenic
946669665 2:222089320-222089342 AACCATCAACTGAGGGAGGACGG + Intergenic
947094622 2:226551718-226551740 AAGCATAGCCAGAGGGAGGCAGG + Intergenic
947182504 2:227423972-227423994 AACCATAAACAGTGTGATGCAGG + Intergenic
1171105594 20:22429749-22429771 ACTGATAAACAGATGGGGGCTGG + Intergenic
1171156524 20:22879545-22879567 AATCTTAGACAGAGACAGGCTGG + Intergenic
1171248510 20:23632154-23632176 AAGCAGACACACAGGGAGGCTGG + Intronic
1172380890 20:34490372-34490394 AATCAAAACCACAGTGAGGCTGG + Intronic
1172598339 20:36166058-36166080 AATCATCAGGAGAGGCAGGCTGG + Intronic
1173393065 20:42652456-42652478 AATCATAACCAGATGCAGGCTGG - Intronic
1173948351 20:46969516-46969538 AAACAAAGACAGAGGAAGGCAGG - Intronic
1175319343 20:58074399-58074421 AAGCAGAAAGAGAGGGAGGAGGG + Intergenic
1175483398 20:59327254-59327276 AATCAGAGACCGTGGGAGGCAGG + Intergenic
1175653051 20:60745392-60745414 AATCCTAAGCAGATGGAGGAGGG - Intergenic
1175658483 20:60792326-60792348 GATCCTTAACAGAGGGAGGCAGG - Intergenic
1175950148 20:62579093-62579115 AGACAGAGACAGAGGGAGGCAGG - Intergenic
1179001441 21:37463555-37463577 AATCATTGAGAGAGGGAGGGAGG - Intronic
1179599324 21:42465585-42465607 CACCATTAATAGAGGGAGGCAGG - Intergenic
1180915005 22:19479820-19479842 AATCAGAAAGAAAGGAAGGCTGG + Exonic
1181406574 22:22689212-22689234 AAAAATAAGTAGAGGGAGGCTGG + Intergenic
1182282281 22:29224538-29224560 AATGAAAACCAGAGGGAGGCTGG - Intronic
1182515826 22:30858440-30858462 AATAAAAAACAAAGTGAGGCCGG - Intronic
1184003798 22:41694334-41694356 AATAGAAACCAGAGGGAGGCTGG + Exonic
1184182858 22:42842765-42842787 AGTTATAAACAAAGGGCGGCTGG - Intronic
1185264525 22:49893400-49893422 AACCTTAAGCAGAGGGAGGGAGG + Intergenic
949327212 3:2880202-2880224 ATTTATAGACAGAGAGAGGCTGG + Intronic
951554360 3:23905860-23905882 AATCAAAACCAGGGAGAGGCCGG + Intronic
951581368 3:24167715-24167737 AATGAGAAAGAGAGGGAGCCAGG - Intronic
952190044 3:31013251-31013273 ATACCTAAACAGAGGCAGGCAGG - Intergenic
952371103 3:32723681-32723703 AATGACAAACAGAGGTGGGCAGG + Intronic
952722404 3:36546809-36546831 AATCACAAAGAGAGGAAGCCTGG - Exonic
952812541 3:37417395-37417417 AATAATAAACAGAGGAAGGCGGG + Exonic
953274739 3:41483808-41483830 GATCCTCATCAGAGGGAGGCAGG + Intronic
953354892 3:42247619-42247641 AATCCTCAACAGAGAGAAGCTGG + Intergenic
955631269 3:60978089-60978111 AATCATAAACAACAGGAGTCAGG - Intronic
955872127 3:63450498-63450520 CATTTTAAACAGAGGAAGGCTGG + Intronic
956296037 3:67714610-67714632 AAGCAAAAAAAGTGGGAGGCAGG + Intergenic
957185659 3:76938421-76938443 AATCAGATAAAGAGGGAAGCAGG - Intronic
957379191 3:79403121-79403143 AAACAGAAACAGAGGGTGGGAGG - Intronic
958022167 3:88011117-88011139 AAGCAGAAACTGTGGGAGGCAGG + Intergenic
959856358 3:111163132-111163154 AAACACAAACAGATGGGGGCTGG + Intronic
962371926 3:134827951-134827973 AAGCATAAACAAAGAGATGCTGG - Intronic
964408980 3:156378863-156378885 ACCCAAAAACAGAGGGAGGAGGG + Intronic
965087277 3:164114652-164114674 GATTATAAACAGTGGGAGGTAGG + Intergenic
966191542 3:177276298-177276320 CAACAAAAACACAGGGAGGCAGG - Intergenic
966916581 3:184587607-184587629 AATGAGAAACAGAGAGGGGCAGG - Intronic
967154293 3:186678407-186678429 AATAATAAATAGGGGGAGGGTGG - Intergenic
967393408 3:188979742-188979764 ATTCATAATCAGAGGGAGGAGGG - Intronic
967569179 3:191008144-191008166 AATAATAAAAAAAGGGAGGGAGG + Intergenic
969957250 4:10903558-10903580 AATCAGAATTAGAGAGAGGCTGG + Intergenic
971480821 4:27113519-27113541 AATCACAGACAGAGGGAATCAGG + Intergenic
974005899 4:56556950-56556972 AATGCTAAACAGAGAGAGGCCGG + Intronic
976763026 4:88570482-88570504 AAACAAAAACAGGGGAAGGCAGG - Intronic
978283399 4:107044689-107044711 ACTCAGAAACAGAGGCAGGTAGG + Intronic
979582348 4:122375688-122375710 AATCACAAATAAAGGGAAGCAGG + Intergenic
980889912 4:138803939-138803961 AATCCTCAACAGAGGGATGCGGG + Intergenic
980896494 4:138865591-138865613 AATGATAAAGAGAAGGAGGAAGG + Intergenic
982230163 4:153201258-153201280 AATCAAAAACACAATGAGGCTGG - Intronic
982330222 4:154173519-154173541 AATAATAAACAAAGGAAAGCTGG - Intergenic
983307745 4:166014694-166014716 AATCATAAAATGAGGCAGGAGGG + Intronic
984922455 4:184777794-184777816 AGACAGAGACAGAGGGAGGCAGG + Intronic
985088945 4:186343834-186343856 AAACATAAACAGAAGGGGCCGGG - Intergenic
985236874 4:187884808-187884830 ACACAAAAAGAGAGGGAGGCAGG - Intergenic
985258202 4:188090533-188090555 TATCAGAAAGAGAGGTAGGCCGG + Intergenic
985814246 5:2114844-2114866 AATGATCTGCAGAGGGAGGCAGG - Intergenic
986630375 5:9766809-9766831 AAGCATACAGAGAGGGAGGGAGG + Intergenic
986810929 5:11359423-11359445 GACCATTAACAGGGGGAGGCGGG - Intronic
987105787 5:14637616-14637638 ACTAGGAAACAGAGGGAGGCAGG + Intergenic
990295660 5:54399031-54399053 AATAGTGAACAGAGGGAGGAAGG - Intergenic
991612750 5:68465885-68465907 AAACAAAAACAGAGAGATGCTGG - Intergenic
992085483 5:73274732-73274754 AAACATAAACATAAGGAGGCAGG - Intergenic
994047959 5:95330509-95330531 AAGAATAAAGAGAGGGAGGAAGG + Intergenic
994247836 5:97500849-97500871 AATAAGGAAGAGAGGGAGGCAGG - Intergenic
994852020 5:105067835-105067857 GATCATTATAAGAGGGAGGCAGG - Intergenic
995079278 5:108028991-108029013 AATCAAATACAGAGGAAAGCAGG + Intronic
995100673 5:108299669-108299691 AATCATGAACAGGGGCAGGCTGG - Intronic
996199487 5:120653560-120653582 AATCTTAATCAGAGGTAGGAAGG + Intronic
996733302 5:126736550-126736572 AATTAGAAACAGCTGGAGGCAGG - Intergenic
997160772 5:131607053-131607075 AATTATAAACTGAGGGAGTGGGG - Intronic
998198710 5:140099663-140099685 AATCAGAAACTGAGGTAAGCTGG - Intergenic
998858597 5:146420782-146420804 AATAAAAAAGAGACGGAGGCTGG + Intergenic
999180425 5:149666364-149666386 AGTCACACACAGTGGGAGGCAGG + Intergenic
999545004 5:152618182-152618204 AAACATATACAGATGGAGGTGGG - Intergenic
999582286 5:153052303-153052325 AATTATTAACAGAAGGAGGAAGG + Intergenic
1000197687 5:158975522-158975544 AATGAAAGACAGAGAGAGGCAGG + Intronic
1000769729 5:165337721-165337743 AATCATGAATAGATGAAGGCAGG + Intergenic
1002119828 5:176994108-176994130 ACACATAAACACTGGGAGGCTGG + Intronic
1002155541 5:177275727-177275749 AATAATAAGAAAAGGGAGGCCGG - Intronic
1004255236 6:14057733-14057755 AAAAATAAATAGAGGCAGGCAGG + Intergenic
1006027801 6:31158414-31158436 AATCAGAAAAAGTGGAAGGCGGG + Intergenic
1006112158 6:31754020-31754042 AAAAAAAAAAAGAGGGAGGCCGG - Intronic
1006638761 6:35478153-35478175 ATTCAAAAATAGAGGGATGCAGG - Intronic
1007425073 6:41741245-41741267 AATCATAAACAGAGGTGGAGAGG + Intronic
1008003565 6:46386300-46386322 AATCAAAACCACAAGGAGGCCGG + Intronic
1008129199 6:47701318-47701340 AATCATGCACAGAAAGAGGCGGG + Intronic
1009502382 6:64431156-64431178 TATCAAAAAAATAGGGAGGCAGG - Intronic
1011471664 6:87714025-87714047 AAATATAATCAGAGGCAGGCCGG - Intergenic
1011675577 6:89730013-89730035 AATCATTAACATAGAGAGGGCGG + Intronic
1012669493 6:102024232-102024254 AAAGAGAAACAGAGGTAGGCTGG + Intronic
1013072872 6:106744787-106744809 TATCAGAAACAAAGGGAGGGAGG + Intergenic
1013751703 6:113414687-113414709 AATTACCAACAGAGGGAGCCTGG + Intergenic
1013788333 6:113808024-113808046 TATCATAAACAGAGGTATGGAGG + Intergenic
1014940262 6:127429834-127429856 AAACAATAACAGAAGGAGGCTGG + Intergenic
1017061570 6:150490127-150490149 AACCATCTTCAGAGGGAGGCTGG - Intergenic
1017238515 6:152141772-152141794 AAAAATAAGCAGAGGTAGGCTGG + Intronic
1018858403 6:167692106-167692128 GATCAGAAACAGAGGGGGGTGGG + Intergenic
1018941710 6:168312823-168312845 AATCATTACAAGAGAGAGGCAGG + Intronic
1019083925 6:169456644-169456666 AATCATCAACTGTGGGAGGAGGG + Intergenic
1020462194 7:8438496-8438518 AGGCATAAACAGAGTGATGCAGG - Intronic
1021028979 7:15705707-15705729 ATTCATAAATTGAGGGAGGGAGG + Intergenic
1021636397 7:22698399-22698421 AACCAGAAACAGAGTCAGGCTGG - Intergenic
1023113122 7:36834267-36834289 AGTCACACACAGAGGGAGGGTGG + Intergenic
1023648904 7:42348159-42348181 CATCAGAAAGAGAGGGAGACAGG + Intergenic
1023704658 7:42929056-42929078 AATAATAAAGAGACCGAGGCAGG - Intronic
1026865539 7:73821913-73821935 AAGCATAAAGGGAGGGAGGGAGG + Intronic
1027719048 7:81715065-81715087 AATCACAAACCAAGGGAGCCAGG - Intronic
1027722210 7:81758447-81758469 AAAAATAAACAGAGGGAGGAAGG + Intronic
1028061225 7:86319262-86319284 ACTACTAAACAGAGGGAGGAAGG + Intergenic
1029175865 7:98664106-98664128 AATCATAAAGGGTGAGAGGCTGG - Intergenic
1031158852 7:118142431-118142453 ACCCATATACAGAGGGTGGCTGG - Intergenic
1031469982 7:122157308-122157330 AATCATGAAAAGAGGAAGGTGGG + Intergenic
1031895746 7:127346758-127346780 AAGGATAAACAGAAGGAAGCAGG + Intergenic
1032403272 7:131638344-131638366 AAACATCTAGAGAGGGAGGCTGG - Intergenic
1033570257 7:142620697-142620719 AAGCACCAAAAGAGGGAGGCAGG + Intergenic
1033972162 7:147055665-147055687 AATCAGACACTGCGGGAGGCAGG + Intronic
1034751551 7:153573353-153573375 AATTATAAAAAAAGGCAGGCCGG - Intergenic
1037740478 8:21604987-21605009 AATCATAACCAGGAGGAGGTGGG + Intergenic
1037871621 8:22502824-22502846 AATCATTAACAGTGGGAGGTTGG + Intronic
1038680065 8:29658553-29658575 AATAATAAACAGAAATAGGCAGG - Intergenic
1039566143 8:38553875-38553897 AAGCAGGAACAGAGGGAGGGGGG + Intergenic
1039795067 8:40905923-40905945 CATCATAAAAAGGGGGAGGAGGG + Intergenic
1039879529 8:41615926-41615948 AATGATAAACAGTGAGTGGCTGG - Intronic
1041395142 8:57382856-57382878 ATATATAAAGAGAGGGAGGCAGG + Intergenic
1041995574 8:64053227-64053249 AATCAGAAACTGTGGGAGTCAGG + Intergenic
1042049663 8:64689862-64689884 AATTAGAAACAGAAGCAGGCCGG - Intronic
1044499518 8:92936459-92936481 GAGGATGAACAGAGGGAGGCAGG + Intronic
1045452685 8:102344224-102344246 AAACATATACAGAGAAAGGCAGG + Intronic
1045865468 8:106860517-106860539 AATAAAAAAGAGAAGGAGGCCGG + Intergenic
1047021664 8:120781657-120781679 ATTCATAAAAAGAGGTAGGTTGG - Intronic
1048494779 8:134925973-134925995 AATCATAAACAAAGGGAGACAGG - Intergenic
1048618778 8:136108863-136108885 TATCAGAAACAGAGGGTGGTGGG - Intergenic
1049300578 8:141867377-141867399 CATCATCAACAGAGGCAGGACGG - Intergenic
1049358579 8:142200952-142200974 AAAGAAAAAGAGAGGGAGGCAGG + Intergenic
1050746266 9:8879779-8879801 AAACACAAACGGAGAGAGGCTGG + Intronic
1051088472 9:13379323-13379345 AATCAGAAACTCAGGGAGTCGGG - Intergenic
1051569277 9:18537497-18537519 AATCAAAACCAGAGGTAGGTGGG + Intronic
1051993575 9:23184689-23184711 GATCAGAGACAGAGGGAGGGGGG - Intergenic
1053116521 9:35509051-35509073 AATCAGAATCAGAATGAGGCTGG + Intronic
1054853296 9:69871236-69871258 AATAATAAACAAAGGCAGGGAGG + Intronic
1056558700 9:87711021-87711043 AAGAATAAAAAGATGGAGGCGGG + Intergenic
1057171875 9:92967867-92967889 AGCCTTAAACAGAAGGAGGCCGG - Intronic
1057214754 9:93221504-93221526 AATCATATGTAGAAGGAGGCAGG - Intronic
1057477354 9:95414070-95414092 AATCATTAACATGAGGAGGCAGG - Intergenic
1058354759 9:104071204-104071226 AATGACAAAAAGAGGGAGGTAGG + Intergenic
1059795351 9:117688793-117688815 CATCAGAAACAATGGGAGGCCGG + Intergenic
1061998620 9:134204289-134204311 AATCAGAAACAGAAGGAGCAGGG - Intergenic
1062060186 9:134491199-134491221 AATAACAAAAAGAGAGAGGCGGG + Intergenic
1185950831 X:4432020-4432042 AATGAGGAAGAGAGGGAGGCAGG - Intergenic
1187614655 X:20980162-20980184 AATCTTAACCAGTGGAAGGCTGG - Intergenic
1189201477 X:39199659-39199681 CCTCATAAACAGAGGAAGTCAGG - Intergenic
1189432393 X:40959162-40959184 TGTCATATAGAGAGGGAGGCAGG - Intergenic
1190394925 X:49972350-49972372 ACACAAAAACAGAGGGAGGAAGG - Intronic
1190636307 X:52437423-52437445 AATCATAAACAGAGGGAGGCTGG + Intergenic
1198058678 X:133021329-133021351 ACTCAGGAACAGAGGGAGTCAGG + Intergenic
1198751923 X:139944706-139944728 AGTGATAAAAGGAGGGAGGCAGG - Intronic
1198915367 X:141664923-141664945 AATCATAAGCAGATGAATGCAGG - Intronic