ID: 1190637099

View in Genome Browser
Species Human (GRCh38)
Location X:52446146-52446168
Sequence AAGGGGAGCCAGAGGGAGGA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 1912
Summary {0: 2, 1: 2, 2: 26, 3: 235, 4: 1647}

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1190637099_1190637114 26 Left 1190637099 X:52446146-52446168 CCTTCCTCCCTCTGGCTCCCCTT 0: 2
1: 2
2: 26
3: 235
4: 1647
Right 1190637114 X:52446195-52446217 GTTTGGCAAGTTAGCCTTATGGG 0: 2
1: 0
2: 0
3: 4
4: 63
1190637099_1190637115 30 Left 1190637099 X:52446146-52446168 CCTTCCTCCCTCTGGCTCCCCTT 0: 2
1: 2
2: 26
3: 235
4: 1647
Right 1190637115 X:52446199-52446221 GGCAAGTTAGCCTTATGGGCAGG 0: 2
1: 0
2: 0
3: 2
4: 43
1190637099_1190637108 2 Left 1190637099 X:52446146-52446168 CCTTCCTCCCTCTGGCTCCCCTT 0: 2
1: 2
2: 26
3: 235
4: 1647
Right 1190637108 X:52446171-52446193 GCAAGGGATGAAGCCATTTCTGG 0: 1
1: 0
2: 0
3: 13
4: 167
1190637099_1190637110 4 Left 1190637099 X:52446146-52446168 CCTTCCTCCCTCTGGCTCCCCTT 0: 2
1: 2
2: 26
3: 235
4: 1647
Right 1190637110 X:52446173-52446195 AAGGGATGAAGCCATTTCTGGGG 0: 2
1: 0
2: 3
3: 27
4: 294
1190637099_1190637113 25 Left 1190637099 X:52446146-52446168 CCTTCCTCCCTCTGGCTCCCCTT 0: 2
1: 2
2: 26
3: 235
4: 1647
Right 1190637113 X:52446194-52446216 GGTTTGGCAAGTTAGCCTTATGG 0: 2
1: 0
2: 1
3: 4
4: 63
1190637099_1190637111 9 Left 1190637099 X:52446146-52446168 CCTTCCTCCCTCTGGCTCCCCTT 0: 2
1: 2
2: 26
3: 235
4: 1647
Right 1190637111 X:52446178-52446200 ATGAAGCCATTTCTGGGGTTTGG 0: 1
1: 1
2: 1
3: 16
4: 227
1190637099_1190637109 3 Left 1190637099 X:52446146-52446168 CCTTCCTCCCTCTGGCTCCCCTT 0: 2
1: 2
2: 26
3: 235
4: 1647
Right 1190637109 X:52446172-52446194 CAAGGGATGAAGCCATTTCTGGG 0: 1
1: 0
2: 0
3: 16
4: 183

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1190637099 Original CRISPR AAGGGGAGCCAGAGGGAGGA AGG (reversed) Intergenic
900293917 1:1939229-1939251 GGGGGGAGAGAGAGGGAGGATGG + Intronic
900310831 1:2032472-2032494 AAGGTGAGCTCCAGGGAGGAGGG - Intergenic
900315058 1:2052268-2052290 AAAGCAAGGCAGAGGGAGGACGG - Intronic
900394232 1:2446567-2446589 CATTGGAGGCAGAGGGAGGAAGG + Intronic
900471371 1:2856665-2856687 AAGGGGAGGCGGAGGGAGGGAGG - Intergenic
900540628 1:3200928-3200950 AAGAGGAGCAGGAAGGAGGAAGG + Intronic
900610482 1:3542522-3542544 AAGAGGAGGCAGAGGAAGGCAGG + Intronic
900700782 1:4047487-4047509 AAGGGGAGGAAGGAGGAGGAAGG + Intergenic
900701238 1:4049781-4049803 AGGGGGAGAAAGAGGGAGGAAGG + Intergenic
900745400 1:4357266-4357288 TAGGGGAGCCAGAAGGGAGATGG - Intergenic
900875522 1:5340035-5340057 AAGGAGATTCAGAGGGAGCAGGG + Intergenic
901005972 1:6171690-6171712 AGATGGAGCCATAGGGAGGAGGG - Intronic
901175909 1:7298900-7298922 AAGGGAAGAGAGAGGAAGGAAGG - Intronic
901240410 1:7689782-7689804 AAGGGGAGGCAGACAGAGGGAGG - Intronic
901269566 1:7941457-7941479 CATGGGTGACAGAGGGAGGAAGG + Intronic
901647559 1:10724772-10724794 AAGAGGAGGCAGAGGAAGGCAGG + Intronic
901701131 1:11045263-11045285 AAGGGGAGCTGGAGGCAGCAGGG + Intronic
901773160 1:11541284-11541306 GAGGGGAGGCAGAGAGAGCAGGG + Intergenic
901798962 1:11696215-11696237 AAGGGGAGACAGAGGGAGTAAGG - Intronic
901834343 1:11914169-11914191 AAGGGTAGCCAGTCTGAGGATGG + Intergenic
901928860 1:12584057-12584079 CATAGGAGCCAGAGGTAGGATGG - Intronic
902099205 1:13971852-13971874 AGCAGGAGCAAGAGGGAGGAGGG - Intergenic
902388153 1:16087952-16087974 GTGGGGAGGCACAGGGAGGAGGG - Intergenic
902517633 1:16997875-16997897 AAGGGGAGGGGGAAGGAGGAGGG + Intronic
902816516 1:18919413-18919435 CAGGGGAGCCCGGGGGAGGGCGG + Intronic
903140100 1:21334289-21334311 GCTGGGAGCCAGAGAGAGGAGGG - Intronic
903153798 1:21430714-21430736 AAGGAGAGCCAGGGTGGGGAGGG - Intergenic
903331712 1:22600058-22600080 AAGGGGGGATGGAGGGAGGAAGG + Intronic
903510796 1:23873628-23873650 AAGCAGAGCAAGTGGGAGGAGGG - Exonic
903772491 1:25772703-25772725 AAGGGAAGCCAGAGAGGAGAGGG - Intronic
903844756 1:26272297-26272319 CAGGAGAGTCAGTGGGAGGAAGG + Intronic
903977081 1:27157441-27157463 GAGATAAGCCAGAGGGAGGAAGG + Intronic
904008789 1:27378307-27378329 CAGGAGAGCCTGAGAGAGGAAGG + Intergenic
904128704 1:28260151-28260173 AGGGGGAGAGGGAGGGAGGAGGG - Intronic
904463118 1:30692274-30692296 AAGGAAGCCCAGAGGGAGGAGGG + Intergenic
904767995 1:32864923-32864945 AACAGGAGCCAGAGGGCAGAGGG - Intronic
904813291 1:33178146-33178168 CAGGAGAGGGAGAGGGAGGAAGG - Intronic
904883780 1:33720444-33720466 AAGGGGATTCAGAAGGATGAAGG + Intronic
905168302 1:36096425-36096447 AATTGGAACCAGAGGGTGGAAGG + Exonic
905352357 1:37356493-37356515 AAGGGCTGCAAGAGAGAGGAGGG + Intergenic
905481881 1:38267627-38267649 AAGGAGAGACGGAGGGAAGAAGG - Intergenic
905780041 1:40700888-40700910 AAGGGGACACAGTGGGAGGATGG - Intronic
905875218 1:41427881-41427903 GCGGGGAGAGAGAGGGAGGAGGG - Intergenic
906699691 1:47848944-47848966 ATGGGGACCCACAGGGATGAAGG - Intronic
906735818 1:48126045-48126067 AAGTGGAGAGGGAGGGAGGAAGG + Intergenic
906751580 1:48267498-48267520 ATGGGGAGCTAGAAGGGGGATGG + Intergenic
906753798 1:48290086-48290108 AAGGGCAGCCAGAGAAAGGTTGG + Intergenic
906764803 1:48418856-48418878 GAGGGGAAGGAGAGGGAGGAAGG + Intronic
906953205 1:50350783-50350805 ATGGGGAGTCAGAAGGGGGATGG - Intergenic
907007149 1:50926425-50926447 AAGGGCAGTGAGAGGGAGAATGG + Intronic
907357856 1:53891127-53891149 AAGGGGAGAGAGAAGGAGGGGGG + Intergenic
907394291 1:54178531-54178553 ATGTGGAGTCAGAGGGAGGAGGG + Intronic
907490396 1:54805658-54805680 AAGGAGAGCCAGAGGGTGGAGGG - Intergenic
907683751 1:56589933-56589955 AAAGAGAGAGAGAGGGAGGAAGG + Intronic
907716800 1:56933625-56933647 AAGGGGAAGCAGAGAGAAGATGG - Intronic
907977392 1:59445137-59445159 AGGGAGAGAAAGAGGGAGGAGGG + Intronic
908114171 1:60924918-60924940 AAGGGCAGAGAGAGAGAGGACGG - Intronic
908167606 1:61473888-61473910 GAGGGGAACCAGAGGGAGCCAGG - Intergenic
908382122 1:63606544-63606566 CAGGGGAGAAAGATGGAGGAAGG + Intronic
908780967 1:67689347-67689369 CAGGGGAGCCATAAGGGGGACGG - Intergenic
908800893 1:67879630-67879652 AAAGGGAGAGAGAGGAAGGAAGG - Intergenic
909005056 1:70265911-70265933 AAGGAAAGAGAGAGGGAGGAAGG + Intronic
909156402 1:72083301-72083323 AAGGGAGGAGAGAGGGAGGATGG - Intronic
909183690 1:72457785-72457807 GAGGGGAGAGGGAGGGAGGAAGG - Intergenic
909296364 1:73954286-73954308 GACGGGAGACAGAGGAAGGAAGG - Intergenic
909700386 1:78514862-78514884 GAGGGGAGCAAGAAGGAGAAGGG - Intronic
909742288 1:79045379-79045401 TAGGGGAGCCAGAAGGGAGATGG + Intergenic
909816977 1:80006789-80006811 AAGGGGAGACAGAGGGGGCGGGG - Intergenic
909862997 1:80632646-80632668 ATGGGGAGCCAGAGGGGAGATGG - Intergenic
910214592 1:84830330-84830352 AGGGCAAGCCAAAGGGAGGAGGG + Intronic
910285184 1:85545775-85545797 GAGGAGATGCAGAGGGAGGAGGG + Intronic
910338045 1:86155821-86155843 AAGGGTCGCCAGCGGGGGGAAGG - Intronic
910465273 1:87492596-87492618 CATGGAAGCCAGAAGGAGGATGG + Intergenic
910547955 1:88440609-88440631 AGGGGGAGAGAGAGAGAGGAAGG + Intergenic
910634800 1:89395189-89395211 AAGGGGAGAGAGAGAGAGGAAGG + Intergenic
910735040 1:90444360-90444382 AAGGAGAGAAAGAGGAAGGAAGG + Intergenic
910841965 1:91569766-91569788 AAGGAGAGCCACAGGAAGGAAGG + Intergenic
911121283 1:94299742-94299764 TAAGGGAGCCAGAGGGAGGAAGG + Intergenic
911430028 1:97773781-97773803 ATGGGGAGCTAGAAGGGGGATGG - Intronic
911519271 1:98909103-98909125 AAGGAGGGACAGAGGGAGGAAGG + Intronic
911764448 1:101657004-101657026 ATGGGGAGCCAGAAAGGGGATGG + Intergenic
912248793 1:107989771-107989793 AAGGGTAGACAGTGGGAGAAGGG + Intergenic
912269360 1:108193327-108193349 AAGGGGGGAGGGAGGGAGGAGGG - Intronic
912520836 1:110243621-110243643 AAGAGGAGGAAGAGGGAGAAGGG + Intronic
912567329 1:110597469-110597491 ATGGGGAGACAGAGGGAGAGGGG + Intronic
913387675 1:118277644-118277666 AAGAGGACCTAGAGGCAGGAGGG - Intergenic
914191971 1:145419633-145419655 AGTGGGAGCCAGTGCGAGGAGGG - Intergenic
914246028 1:145886194-145886216 AGCGGCAGCCAGAGGCAGGAGGG + Intergenic
914360099 1:146927668-146927690 CATGGAAGCCAGAAGGAGGATGG + Intergenic
914456413 1:147841146-147841168 CAGGGAACCCAGAGGGAGGCGGG - Intergenic
914493648 1:148172228-148172250 CATGGAAGCCAGAAGGAGGATGG - Intergenic
914704789 1:150161731-150161753 CAGGGGAGCCAGAAGATGGAGGG + Intronic
914724441 1:150315922-150315944 AGAAGGATCCAGAGGGAGGAAGG - Intergenic
914830581 1:151168153-151168175 AAAGGGAGACAGAGGGACCAGGG - Exonic
915100372 1:153495039-153495061 GAGGGCAGGCAGAGGAAGGAGGG - Intergenic
915118989 1:153616909-153616931 AAGGGCAGCCTGATGGAGGGAGG + Exonic
915128931 1:153683890-153683912 GTGGGGACCCAGAGGGAAGAGGG + Intronic
915267118 1:154726847-154726869 CAGGGGAGCCCGGGGGAGGGTGG + Intronic
915488892 1:156240812-156240834 CAGGGCAGCCAAAGGCAGGATGG + Intronic
915652901 1:157332211-157332233 CAGGGGAGGCAGAGGGAGACAGG - Intergenic
915662501 1:157415878-157415900 AAGGAGAGTCAGACGGAGGCAGG - Intergenic
915716565 1:157950148-157950170 GAGGGGAAACAGAGGGAGGGAGG + Intergenic
915941441 1:160120892-160120914 ACGGCCAGCCTGAGGGAGGAAGG - Exonic
915973536 1:160370632-160370654 AGGGGGAGGAAGGGGGAGGAAGG - Exonic
916037162 1:160932622-160932644 AAGGAGAGTGAGAGGGAGGGGGG - Intergenic
916223152 1:162464578-162464600 AAGGGGAACCTAAAGGAGGAGGG - Intergenic
916282267 1:163064714-163064736 AAGAGGAGTAAGAGGCAGGAGGG + Intergenic
916303492 1:163302598-163302620 CAAGGGAGCCAGAGGTAGGAGGG - Intronic
916348371 1:163820478-163820500 CAGATAAGCCAGAGGGAGGAAGG + Intergenic
916694273 1:167220838-167220860 GAGGGGAGCCAGAGCGAGGGAGG + Exonic
916869866 1:168901903-168901925 AAGGGAAGGAAGAGGAAGGAAGG + Intergenic
916939457 1:169664085-169664107 AAGGGGAGCTATAGGGAGGCTGG - Intronic
917141733 1:171841893-171841915 AGCGGGAGCCAGAGGGTGGATGG + Intronic
917227510 1:172800470-172800492 AAGGGGAGCTATAGGGAGGCTGG - Intergenic
917281082 1:173378770-173378792 AAGGGGAGCTATAGGGAGGCTGG - Intergenic
917306076 1:173626936-173626958 AAGGAAAGAAAGAGGGAGGAGGG + Intronic
917337300 1:173938772-173938794 CAGAGGACCCTGAGGGAGGAGGG - Exonic
917539566 1:175899694-175899716 TAAAGGAGACAGAGGGAGGATGG + Intergenic
917967975 1:180190502-180190524 AAGAGGACCCACAGGGAGCAGGG - Exonic
918290150 1:183099587-183099609 GGGGGCAGCCAGAGGGAGGAAGG - Intronic
918761847 1:188420536-188420558 AGGGAGAGACAGAAGGAGGAAGG - Intergenic
918943331 1:191028591-191028613 AAGGGCAGCCAGAGAGTGAAAGG + Intergenic
919048162 1:192480347-192480369 ATGGGGAGCTAGAAGGGGGATGG - Intergenic
919110888 1:193217436-193217458 TAGGGGAGCCAGAAAGGGGATGG + Intronic
919567403 1:199206202-199206224 AAGATGTGCCAGAGGAAGGACGG + Intergenic
919593269 1:199530588-199530610 AAAGGGAACAAGAGTGAGGATGG - Intergenic
919741046 1:200981824-200981846 TAGGGGAGCGAGAAGGAGGCTGG + Intronic
920053167 1:203175521-203175543 AAGGTGGGGCAGGGGGAGGAGGG - Intronic
920098743 1:203503372-203503394 AAGAGGAGCCCCAGGGGGGATGG - Intronic
920110500 1:203583857-203583879 AAGGAGAGAGAGAAGGAGGAAGG + Intergenic
920110526 1:203583962-203583984 AAGGAGAGAGAGAAGGAGGAAGG + Intergenic
920258442 1:204672672-204672694 AAGGAGAGCAAGAGGGAGCTAGG - Intronic
920303854 1:205006436-205006458 AAGGGGAGATTCAGGGAGGAGGG + Intronic
920313577 1:205062380-205062402 CACAGGAGCCACAGGGAGGAGGG - Intronic
920367359 1:205455214-205455236 ATGGGGAGGCAGTGGGAGGCAGG + Intronic
920440761 1:205979092-205979114 GAGGGGAGACACAGGGAAGAAGG - Intronic
920573430 1:207035831-207035853 ACAGGGAGCAAGAGAGAGGAAGG + Intronic
920578208 1:207078843-207078865 ATGGGGAGGTTGAGGGAGGAGGG + Intronic
920756452 1:208738385-208738407 ATGGGGAGCCAGAAGGGGGATGG + Intergenic
920910031 1:210207674-210207696 AGGGAGGGACAGAGGGAGGAAGG + Intergenic
921137221 1:212272665-212272687 GAGGGGTGTCAGAGGAAGGAAGG - Intergenic
921176183 1:212596665-212596687 AAGGGGAGCCAGTGGGTGAGAGG - Intronic
921266347 1:213423794-213423816 GAGGGGAGGCGGCGGGAGGAGGG + Intergenic
921403533 1:214753476-214753498 ATGGGGAGCCAGAAGAGGGATGG - Intergenic
921759713 1:218899048-218899070 AAGAGCAGGCAGAGAGAGGAAGG - Intergenic
921771918 1:219050528-219050550 AGGGGGAGATGGAGGGAGGAAGG + Intergenic
921833995 1:219759366-219759388 AGGGAGAGAGAGAGGGAGGAGGG + Intronic
921838120 1:219799134-219799156 AAGGAGAGAGAGAGGGAGGGAGG + Intronic
921957612 1:221000477-221000499 AGGGGAAGGAAGAGGGAGGAAGG - Intergenic
921980808 1:221256818-221256840 TTGTGGAGCCAGAGGGAAGAGGG + Intergenic
922229760 1:223675474-223675496 AGTGGGAGCAAGAGGAAGGAGGG + Intergenic
922617162 1:226967680-226967702 ATGGGTAGCCAGAGGGAGCCTGG + Intronic
922651339 1:227341601-227341623 AAGGAGAAGCAGAGGGATGAGGG + Intergenic
922756163 1:228098020-228098042 AAGAGGAGTGAGAGGGAGGGGGG - Exonic
922876058 1:228940700-228940722 CAGGGGACCCAGTGGGACGAGGG - Intergenic
922974202 1:229770090-229770112 AAGGGGAGATGGAGGGAGGGAGG - Intergenic
923177420 1:231480555-231480577 GATGGGAGCTAGAGGGAGAAGGG - Intergenic
923252676 1:232191852-232191874 AGGGGAAGCCAGAAGGGGGATGG - Intergenic
923289636 1:232531861-232531883 AAAGGAAGGGAGAGGGAGGAGGG + Intronic
923372775 1:233328836-233328858 AAGTGGGGCCAGAGGGAGGTGGG + Intronic
923510016 1:234642804-234642826 AAGGGGAGACAAAGGGAGTGGGG + Intergenic
923529594 1:234803128-234803150 AAGGGGAGGAGGAGGGGGGAAGG - Intergenic
923569584 1:235101642-235101664 AAGGGGAGAGGGAGGGAGGGAGG + Intergenic
924158583 1:241206915-241206937 AAGGAGAGAGAGAGGGAGGGAGG - Intronic
924608658 1:245556254-245556276 AAGAGGAGGAGGAGGGAGGAAGG - Intronic
924653781 1:245954317-245954339 AAGATGAGCCAGAGGCAGTAAGG + Intronic
924888618 1:248248473-248248495 AGGGAGTGACAGAGGGAGGAAGG + Intergenic
1062805310 10:415383-415405 AAGGAGAGGCAGCAGGAGGAGGG + Intronic
1062812525 10:477426-477448 GGGGGGAGGCAGGGGGAGGAAGG + Intronic
1062880040 10:970798-970820 AAGCAGAGCCAGAGGGATTAGGG + Intergenic
1063044100 10:2373887-2373909 AAGGAGAGACAGAGGCTGGAAGG - Intergenic
1063525282 10:6778981-6779003 AAGGAGAGAGGGAGGGAGGAAGG + Intergenic
1063691884 10:8295568-8295590 AAGGGGAGAGAGAGGAAGGAAGG - Intergenic
1063736853 10:8766782-8766804 AAGTGAAGACGGAGGGAGGAAGG - Intergenic
1063907063 10:10792032-10792054 AAGGAGGGAGAGAGGGAGGAAGG + Intergenic
1063938942 10:11107803-11107825 AGGGGGAAGAAGAGGGAGGAGGG - Intronic
1064104841 10:12492199-12492221 AAGGGCAGCCCGAGAGTGGAAGG - Intronic
1064333260 10:14414422-14414444 AAGGAGAGAGAGAGGGAGGGAGG + Intronic
1064364689 10:14697055-14697077 ATGGGGAGGCACAGGGAGAAAGG + Intronic
1064504703 10:16015825-16015847 GAAGGGAGAGAGAGGGAGGATGG + Intergenic
1065169264 10:23010702-23010724 AAGGGGAGGGAAAGGAAGGAGGG - Intronic
1065494979 10:26318554-26318576 AAGGAGAGAAAGAGGGAGAAAGG + Intergenic
1065550114 10:26861223-26861245 AAGCGGAGACCGAGGGTGGAGGG + Intergenic
1065638278 10:27753155-27753177 AAGGGGGGAGAGAGGAAGGAAGG - Intergenic
1065658778 10:27983012-27983034 AAAGGCTGGCAGAGGGAGGAGGG + Intronic
1065736560 10:28758296-28758318 AAGTAGAGACAGAAGGAGGAAGG - Intergenic
1065821568 10:29530364-29530386 CAGGTGGGCCAGAGGCAGGAGGG + Intronic
1065857984 10:29845892-29845914 CTGGGGAGGCAGAGGCAGGAGGG - Intergenic
1065909099 10:30285956-30285978 AAGGGGATCGAGTGGGAAGAAGG - Intergenic
1065916589 10:30358517-30358539 AAGGGGAGGAAGATGGAGGGAGG - Intronic
1066235643 10:33481624-33481646 TAGGGGAGCCTGCAGGAGGAGGG + Intergenic
1066598498 10:37078147-37078169 AGGGGCAGGGAGAGGGAGGAAGG - Intergenic
1066728907 10:38419098-38419120 AGGGAGAGAGAGAGGGAGGAAGG - Intergenic
1066818845 10:39456609-39456631 CACGGGAGCCAGAGGCAGGGAGG + Intergenic
1067293862 10:44963189-44963211 GAGTTGAGCCAGAGGGATGATGG + Intronic
1067460406 10:46454056-46454078 AAGGGAAGAGAGAGGGAGGATGG + Intergenic
1067530681 10:47069395-47069417 AAGGAGAGGCAGAGGGAGACAGG - Intergenic
1067557928 10:47285362-47285384 AAGGGAGGCCAGAGGAAAGAAGG + Intergenic
1067626786 10:47930547-47930569 AAGGGAAGAGAGAGGGAGGATGG - Intergenic
1067908608 10:50320757-50320779 AAGTGGAGATAGAGGGAGGAAGG - Intronic
1068803870 10:61172757-61172779 AAGGAGGGACGGAGGGAGGATGG + Intergenic
1068850354 10:61731749-61731771 GAGGGAGGACAGAGGGAGGAAGG + Intronic
1068854288 10:61781801-61781823 AAAGGTAGCTAGATGGAGGATGG - Intergenic
1068876462 10:62001665-62001687 AAGGGAAGACAGAGAGAGGAAGG + Intronic
1068924076 10:62516756-62516778 AAGGGGAGGAAGAGGAAGCAGGG - Intronic
1068946091 10:62730238-62730260 TGGGACAGCCAGAGGGAGGATGG - Intergenic
1069047885 10:63762200-63762222 AAGGGTGGCCACAGGGAAGAGGG + Intergenic
1069646751 10:70005226-70005248 AGAGAGAGCCAGAGAGAGGAAGG + Intergenic
1069726107 10:70580152-70580174 GATGGGAGACAGAAGGAGGAAGG - Intergenic
1069787671 10:70998982-70999004 AGGGGGAGCAAGAGAGAGGAAGG - Intergenic
1069835432 10:71305019-71305041 AAGTAGAGACAGAGGAAGGAGGG - Intergenic
1070311850 10:75279513-75279535 AAGGGGAGCAAGAGAGAAAAAGG - Intergenic
1070637091 10:78137705-78137727 AAGAGGAGAAAGAGGAAGGAAGG - Intergenic
1070748832 10:78951890-78951912 AAGGTGGGCCTGAGTGAGGAGGG - Intergenic
1070760945 10:79024098-79024120 AAGGGTAGACAGAGGGGGGGGGG + Intergenic
1070967127 10:80536482-80536504 AAGAGGAGACAAGGGGAGGAAGG - Intergenic
1071203814 10:83251734-83251756 AAGAGGAGGAGGAGGGAGGAGGG + Intergenic
1071444889 10:85736261-85736283 AAGGAGAGAAGGAGGGAGGAGGG + Intronic
1071843138 10:89493689-89493711 AAGGGGAGCCAATCCGAGGAAGG - Intronic
1072050207 10:91696550-91696572 AAGGGAAGAGAGAGGGATGATGG + Intergenic
1072055532 10:91751215-91751237 AAGGGCAGCCAGAGAAAGGTCGG + Intergenic
1072073948 10:91949737-91949759 AAAGAGAGCCAGAGAGAAGAGGG - Intronic
1072233049 10:93429202-93429224 AAAGGGAGCAAGAGAGAAGAGGG - Intronic
1072444573 10:95487519-95487541 AAAGGCAGTCAGACGGAGGAAGG + Intronic
1073086732 10:100895874-100895896 AAGGAGAGAGAGAGGGAGGGAGG - Intergenic
1073127901 10:101163469-101163491 AAAGAGAGCGAGAGGAAGGAAGG + Intergenic
1073152771 10:101323104-101323126 AAGTGGAGGCAGAGGGAGGTAGG + Intergenic
1073240672 10:102055930-102055952 GAGGGGAGAGGGAGGGAGGACGG - Intronic
1073277377 10:102324158-102324180 AAGGGGAGAGAGAGGAAGGGAGG - Intronic
1073331678 10:102674142-102674164 AAGTGGAGACGGAGGGAGGGAGG + Exonic
1073496475 10:103896089-103896111 AAAGGGAGTGAGAGGGAGGATGG + Intronic
1074508448 10:114091931-114091953 AAATGGAGCCAGATGGAGGTGGG + Intergenic
1074827996 10:117228491-117228513 AAGGGGAGAAGGAGGGAGGGAGG - Intergenic
1074828014 10:117228543-117228565 AAGGAGAGAGAGAGGGAGGGAGG - Intergenic
1074828022 10:117228571-117228593 AAGGAGAGAAAGAGGGAGGGAGG - Intergenic
1074828036 10:117228631-117228653 AGGGAAAGACAGAGGGAGGAAGG - Intergenic
1074909990 10:117899718-117899740 AAGGAGGGACAGAGGGAGGGAGG + Intergenic
1075076303 10:119352935-119352957 CAGGGGAGAGAGAGGGAGGACGG - Intronic
1075559518 10:123458441-123458463 GAAGGGAGGCAGAGAGAGGAGGG - Intergenic
1076024706 10:127101696-127101718 AAGGGGAGCCAGCAGCAGGTGGG + Intronic
1076090429 10:127680805-127680827 CAGGGAAGCCAGCTGGAGGAAGG + Intergenic
1076120483 10:127933028-127933050 CAGGAGAGCCAGAGAGATGAGGG - Intronic
1076252414 10:128994952-128994974 AAAGGGAGAGAGAGGAAGGAAGG + Intergenic
1076625272 10:131818004-131818026 AAGGGGAGCAGGAAGAAGGAAGG + Intergenic
1076652776 10:132001374-132001396 AAGAGGAGCCCGCGGGAGGTAGG + Intergenic
1077084016 11:738718-738740 AAGAGGAGCCAGAGACAGGAGGG + Intergenic
1077155486 11:1089148-1089170 CTGGGGAGGCAGAGGGAGGCCGG - Intergenic
1077159988 11:1108307-1108329 AAGGGCAGGCTGAAGGAGGAGGG - Intergenic
1077163264 11:1123143-1123165 AAGGAAAGACGGAGGGAGGAAGG - Intergenic
1077233167 11:1467750-1467772 AAACGGAGGCAGAGGCAGGAAGG + Intergenic
1077268567 11:1664602-1664624 AAGGGAAGGGGGAGGGAGGAGGG + Intergenic
1077378194 11:2215496-2215518 AGGAGTAGCCAGAGGGAGCACGG + Intergenic
1077901987 11:6497234-6497256 CGGGGGAGCCAGAAAGAGGAGGG - Intronic
1078076531 11:8166928-8166950 AGGGAGGGACAGAGGGAGGAAGG + Intronic
1078113927 11:8426178-8426200 ATGGGGAGCCAGAAGGGAGATGG + Intronic
1078436956 11:11333199-11333221 AAGGTGAGAGAGAGGGGGGAAGG + Intronic
1078714740 11:13829104-13829126 GTGGGGAGACAGAGGGAGAAGGG - Intergenic
1078850714 11:15160463-15160485 AAGAGGAGGGAGTGGGAGGAGGG + Intronic
1078854094 11:15192179-15192201 AGAGGGAGCCAGAGGGAGGGAGG - Intronic
1079002598 11:16770363-16770385 AATGGAAGGCAGAGGGTGGAGGG + Intergenic
1079601377 11:22316158-22316180 CAGGGGAGACAGAGGCAGGAGGG - Intergenic
1079955415 11:26856859-26856881 AGGGGGAGCAAGAGGGAAAAAGG + Intergenic
1080352488 11:31401448-31401470 AAGAGGAGACAGCGGGAGAAGGG - Intronic
1080419163 11:32094803-32094825 AATGGGGACCAGAGGCAGGACGG + Intronic
1081114211 11:39177937-39177959 AAGGAAAGCGGGAGGGAGGATGG + Intergenic
1081451531 11:43175304-43175326 GCGGGGAGCCAGGGAGAGGAAGG - Intergenic
1081533802 11:43983012-43983034 AAGGGGTGCAAGACAGAGGAGGG + Intergenic
1081578586 11:44335214-44335236 AGGGAGAGAGAGAGGGAGGAAGG - Intergenic
1081736382 11:45407519-45407541 GGGAGGAGTCAGAGGGAGGAGGG - Intergenic
1081747228 11:45481784-45481806 AAAGAGAGCCAGAGAAAGGAAGG - Intergenic
1081751422 11:45513867-45513889 AAGTGAAGGCAGAGGGAGGAAGG + Intergenic
1081851029 11:46275452-46275474 AAGGGGTGGCAGGGGGAGGAGGG - Intergenic
1081896063 11:46587657-46587679 AAGGGCTGACAGAGGGAAGAAGG - Intronic
1082099710 11:48162392-48162414 AAAGGGAGGGAGAGGGAGGAGGG - Intronic
1082710365 11:56547301-56547323 ATGGGGAGCCAGAAAGGGGACGG - Intergenic
1082718673 11:56646561-56646583 CAGGGGAGACAGAAGAAGGATGG - Intergenic
1082892401 11:58154095-58154117 AAGGGGAGGAGGAAGGAGGAGGG + Intronic
1083309068 11:61775333-61775355 AAAGGGAGCCACAGGGTGGAGGG - Intronic
1083699009 11:64462213-64462235 AAGGTGAGCCAGTGGTAGGTTGG + Intergenic
1083742508 11:64718334-64718356 GAGGAGAGCCAGAGGGAGGCCGG - Intronic
1083944242 11:65915331-65915353 AAGGGGTGCCCGAGGGAAGCGGG + Intergenic
1084164733 11:67370312-67370334 AACATGAGCCTGAGGGAGGATGG - Intronic
1084170337 11:67397869-67397891 AAGGTGAGCCTGAGGGAGACAGG - Exonic
1084210943 11:67622095-67622117 AAGGGGAGCTATAGGGAGGCTGG - Intergenic
1084347629 11:68565928-68565950 GATGGGAGCCAGAGGGAGTGAGG + Intronic
1084441481 11:69176598-69176620 AGAGGGGGCAAGAGGGAGGAAGG - Intergenic
1084596967 11:70122757-70122779 ACAGAGAGACAGAGGGAGGAAGG - Intronic
1084650090 11:70484403-70484425 AGGGGGAGCAAGAGGGAGTCGGG - Intronic
1084705761 11:70815248-70815270 AGGAGGAGGCACAGGGAGGAAGG + Intronic
1084919555 11:72458124-72458146 AAAGTGAGGGAGAGGGAGGAAGG + Intergenic
1084970957 11:72771810-72771832 AGGGGGAGCCAGACAGAGAAGGG + Intronic
1085047099 11:73359974-73359996 CTGGGGAGCCAGAGGGTGGGAGG + Intronic
1085217253 11:74843692-74843714 AAGGAGAGCCAGCGTGAGGCAGG - Intronic
1085308169 11:75500171-75500193 AGGAGAGGCCAGAGGGAGGAGGG - Intronic
1085541059 11:77270165-77270187 AAGGAGACCCAGAGAGAAGAAGG + Intronic
1085544168 11:77301684-77301706 AAGGGCAGCCCGAGGGAGGCGGG + Intronic
1086114239 11:83230387-83230409 TAGGGGAGTCAGAGGGAGGTAGG - Intronic
1086598199 11:88600295-88600317 AAGGGGAGGGAGAGGGGGAAGGG - Intronic
1086696979 11:89858904-89858926 AGGGGAAGCCAGAGAGAAGAGGG + Intergenic
1086709179 11:89985583-89985605 AGGGGAAGCCAGAGAGAAGAGGG - Intergenic
1087335526 11:96839605-96839627 ATGGGGAGCCAGAAGGGAGATGG + Intergenic
1087624940 11:100585477-100585499 AAGCAGAGGCAGAGAGAGGATGG - Intergenic
1087763866 11:102128952-102128974 TAGGGAAGCGAGAGGGAGGGAGG - Intronic
1087850285 11:103019843-103019865 AAGGGGAGTGAGAAGGAAGAAGG + Intergenic
1088197677 11:107293864-107293886 AAGGAGGGCAAGAGGAAGGAGGG + Intergenic
1088246629 11:107824769-107824791 AGGGCGAGCCAGAGGAAGGAAGG - Intronic
1088257748 11:107916796-107916818 ATGTGGAGCCAGAAGGAGGATGG - Intronic
1088321173 11:108555961-108555983 AAGGGGAGCCAGAGTGAAGCAGG - Intronic
1088327702 11:108617584-108617606 AAGGGGAGGCGAAGGGAAGAGGG + Intergenic
1088461585 11:110088971-110088993 AAGAGCAGCTAGAGGGAGGATGG - Intergenic
1088466731 11:110147701-110147723 AAGGGGAGGCAAAAGGAGTAAGG - Intronic
1088882463 11:113982686-113982708 AAGAGAAGCCAGAGTCAGGATGG + Intronic
1088920266 11:114255477-114255499 ACGGGGAGCCAGAGGGAGGAGGG - Intergenic
1089051372 11:115548898-115548920 ATGGTGAGCCAGAGGAAGGAGGG + Intergenic
1089295628 11:117465529-117465551 AAGGAGTGCCAGAGAGAGGCAGG - Intronic
1089399546 11:118156547-118156569 AAGAGGAGGGAGAGGGAGGCAGG - Intergenic
1089612535 11:119677485-119677507 AAGGAGAGGAGGAGGGAGGAGGG + Intronic
1089647473 11:119889687-119889709 AAGGACTCCCAGAGGGAGGATGG - Intergenic
1090098002 11:123762851-123762873 AGGGGGAGCAAGAGAGAGGAAGG + Intergenic
1090135852 11:124198752-124198774 AAGGGGAGCTGGAAGGGGGATGG - Intergenic
1090319883 11:125833065-125833087 CAGGGAAGGCAGAGGGAGGATGG + Intergenic
1090554123 11:127855597-127855619 ATGGGGAGCTAGAAAGAGGATGG + Intergenic
1090580403 11:128152885-128152907 AAGGAGGGAGAGAGGGAGGAAGG + Intergenic
1090580420 11:128152929-128152951 AAGGAGGGAGAGAGGGAGGAAGG + Intergenic
1090939635 11:131375644-131375666 AGGGGGAGCACTAGGGAGGATGG + Intronic
1091026927 11:132149734-132149756 AAGGGCATCCTGGGGGAGGAGGG + Intronic
1091070620 11:132559184-132559206 GAGAGGAGCCAAAGGGAGGAAGG + Intronic
1091113810 11:132995462-132995484 AAGGAGAGACAGAGGGAAGAAGG - Intronic
1091215340 11:133898025-133898047 ATCAGGAGCCAGTGGGAGGAAGG + Intergenic
1091241170 11:134053404-134053426 AAAGGGAGGGAGAGGCAGGAAGG + Intergenic
1091551210 12:1536213-1536235 AAGGGAAGGAAGAGGGAGGCAGG + Intronic
1091583440 12:1802393-1802415 AAGGGGAGCCGGGGGCAGGAGGG - Intronic
1091637234 12:2206230-2206252 AAGGAGATCCAGAGGGAAGAAGG + Intronic
1091776335 12:3187363-3187385 AAAGGCAGGCAGAGGAAGGAAGG - Intronic
1091864958 12:3825371-3825393 TAAGGGAGCCATAGGGAAGATGG - Intronic
1092056537 12:5512388-5512410 AGGGGAAGCCAGAGGGAAGTGGG + Intronic
1092228429 12:6764108-6764130 AAGGGGAGGCGGAGGGAGCCGGG - Intronic
1092239474 12:6828352-6828374 AAGGGGAGGGAGGGGGAGGAAGG - Intronic
1092882889 12:12901487-12901509 AAGGGGAGTCAGGAGGAGGACGG - Intronic
1093267447 12:17020312-17020334 AGGGAGAGACACAGGGAGGAAGG - Intergenic
1093509651 12:19911379-19911401 AGAGGGAGAGAGAGGGAGGAAGG - Intergenic
1093992734 12:25608727-25608749 AAGGGCAGCCAGAGAAAGGTCGG - Intronic
1094122294 12:26987096-26987118 AAGGGGAGGCAGAGGTGGAAGGG - Intronic
1094406473 12:30121538-30121560 ATGGGGAGCCAAAAGGGGGATGG - Intergenic
1094615134 12:32029577-32029599 AAGGAAAGAAAGAGGGAGGAAGG + Intergenic
1095484881 12:42674421-42674443 AAGGGCAGCCAGGAGCAGGATGG - Intergenic
1095816606 12:46429418-46429440 AGGGAGAGACAGAGGGAGCAAGG + Intergenic
1096016365 12:48279516-48279538 AAAGAGAGGCAGAGGGAGGATGG - Intergenic
1096078296 12:48818270-48818292 AGAGAGAGGCAGAGGGAGGACGG - Intronic
1096109385 12:49020158-49020180 AGGGGGAGCCAGAGGGTGATGGG - Exonic
1096255328 12:50058737-50058759 GAGGGGATCCTGGGGGAGGAGGG - Exonic
1096322369 12:50626382-50626404 AAGAAGAGCAAGAGGGAGGAAGG + Intronic
1096414430 12:51401379-51401401 TAGGGGAGCCAGAAGGGAGATGG + Intronic
1096416140 12:51415761-51415783 AAGGGGAGAGAGTGGGAGGGAGG + Intronic
1096556832 12:52409023-52409045 AGGGAGAGGGAGAGGGAGGAGGG - Intergenic
1096761001 12:53841949-53841971 ATGGGGAGCAAGAGTGAGGAGGG - Intergenic
1096838804 12:54369024-54369046 AAAGGGAGCGAGAAGGAGGAGGG - Intergenic
1096867116 12:54571176-54571198 AAGTGGAGGCAGAGGATGGATGG - Intronic
1096966135 12:55629561-55629583 ATCGGGAGACAGAGGGAGCAAGG + Intergenic
1097283934 12:57863401-57863423 AAGGGGAGACAGAGGCAGCTGGG - Intergenic
1097340110 12:58427601-58427623 AAGGGCAGCCAGAGAAAGGTCGG + Intergenic
1098022957 12:66174420-66174442 AAGGTGAGGGCGAGGGAGGAGGG - Intergenic
1098081508 12:66790887-66790909 AAGGGGAAGGAGCGGGAGGAAGG + Intronic
1098285540 12:68903789-68903811 AAGGAGAGACAGAGGGAGGGAGG - Intronic
1098460812 12:70731119-70731141 AAGGAGAGAGAGAGGAAGGAAGG + Intronic
1098816013 12:75163140-75163162 AAGGGGAGAGAGAGGGAGATTGG + Intronic
1099653284 12:85456736-85456758 ATGGGGAGCCAGAAAGGGGATGG - Intergenic
1100096737 12:91048536-91048558 AAGGGGAGTGAGAGGAACGAGGG - Intergenic
1100103428 12:91138639-91138661 AATGGGAGACAGAGGGAGTAAGG + Intergenic
1100206373 12:92354412-92354434 ATGGGGAGCCAGCAGGGGGATGG - Intergenic
1100787049 12:98089787-98089809 AAGAAAAGACAGAGGGAGGATGG + Intergenic
1101215846 12:102581667-102581689 AAGGCGAGAGAGTGGGAGGAGGG - Intergenic
1101255551 12:102973594-102973616 AGAGGGAGGCAGTGGGAGGAAGG - Intergenic
1101348157 12:103905251-103905273 GGGGGGAGGGAGAGGGAGGAAGG + Intergenic
1101594510 12:106152113-106152135 AAGGGCATCCAGTGAGAGGAGGG + Intergenic
1101598528 12:106188690-106188712 GAGAAGAGCCAGAGGGGGGAGGG + Intergenic
1101642176 12:106594902-106594924 AGGGGGACCCCAAGGGAGGATGG + Intronic
1102349770 12:112183965-112183987 AAGGGGAGCCAGAGGGCTCAGGG - Intronic
1102501151 12:113353538-113353560 AAGGAGGGAGAGAGGGAGGAAGG - Intronic
1102531147 12:113547428-113547450 AGAGGGAGGCAGAGGGAGGAGGG + Intergenic
1102598741 12:114012875-114012897 AGGGAGAGGGAGAGGGAGGAGGG + Intergenic
1102907196 12:116685908-116685930 AAGGAGAGAGAGAGGGAGGGAGG + Intergenic
1102990704 12:117313809-117313831 TAGGGGAGCCAAAAGGAGAAAGG - Intronic
1102994958 12:117342121-117342143 AAGGAGAGAAAGAGGGAGGGAGG - Intronic
1103014478 12:117483024-117483046 CTGGGGAGTCAGAGGGAAGAAGG + Intronic
1103195785 12:119042674-119042696 AAGGGCAGGAAGAGGGAGGAAGG + Intronic
1103244699 12:119446599-119446621 AGGGAGAGGGAGAGGGAGGACGG + Intronic
1103367028 12:120390820-120390842 AAGGAAAGGAAGAGGGAGGAAGG + Intergenic
1103540350 12:121661886-121661908 AAGGAGAGAGGGAGGGAGGAAGG + Intronic
1103663457 12:122541324-122541346 AGGGAGAGACAGAGGAAGGACGG - Intronic
1103992111 12:124806213-124806235 GTGGGGAGCAAGAGAGAGGAAGG + Intronic
1104206180 12:126641100-126641122 AAGGGCAGCTAGAGAGAGGTCGG - Intergenic
1104232505 12:126898716-126898738 AAGGGGAGAGAGAGGGAGAGAGG + Intergenic
1104238305 12:126961237-126961259 ATGGGGAGCCAGAAGGGAGATGG + Intergenic
1104254442 12:127124886-127124908 AGGGGGGGACAGAGGGAGGGGGG + Intergenic
1104316227 12:127704394-127704416 AAGAGGAGGAGGAGGGAGGAGGG + Intergenic
1104428372 12:128696364-128696386 AAGGAGAATCAGAGGTAGGATGG - Intronic
1104451652 12:128873878-128873900 AAAGGGAGCAAGAGAGAGGAAGG - Intronic
1104668851 12:130666976-130666998 AGGGAGGGACAGAGGGAGGAAGG + Intronic
1104670671 12:130677939-130677961 AGAGGGAGCCAGGTGGAGGAGGG - Intronic
1104814476 12:131637830-131637852 TGGGGCAGTCAGAGGGAGGAGGG + Intergenic
1104981983 12:132577275-132577297 ACAGGGAGCCCCAGGGAGGAGGG - Intronic
1105273948 13:18904052-18904074 GAGGGTGGCGAGAGGGAGGAGGG - Intergenic
1105679963 13:22715979-22716001 AAGGGAAGGAAGAGAGAGGAAGG - Intergenic
1105717858 13:23085049-23085071 ATGAGGAGCCAGAGACAGGAGGG - Intergenic
1105755465 13:23459759-23459781 AAAGGGAGGAAGAGGGAGGGAGG - Intergenic
1105887713 13:24656452-24656474 GAGGGGAGAGAGAGGAAGGAGGG - Intergenic
1105966340 13:25388181-25388203 AAGGAGAGAAAGAAGGAGGAAGG + Intronic
1106938561 13:34750705-34750727 AAGGGGTGGAAGAGGGAGGGAGG + Intergenic
1107213060 13:37881428-37881450 AAGGAGAGAGAGAGAGAGGACGG + Intergenic
1107737871 13:43417123-43417145 CAGGGGAGCCCGAGGCAGGGAGG + Intronic
1108155049 13:47576227-47576249 AATGGGAGCAAGAGGGGGGCGGG + Intergenic
1108794767 13:54017808-54017830 AAGGGGAGGGAAAGGGAGGGAGG + Intergenic
1108907138 13:55490553-55490575 AAGGAGAGAGGGAGGGAGGAAGG + Intergenic
1109377922 13:61522833-61522855 ATGGAGAGCCAGAAGGTGGAGGG + Intergenic
1109476909 13:62891404-62891426 AAGGAGAGGCAGAGAGAGGGAGG - Intergenic
1109571957 13:64204579-64204601 AAGAGGAGGCAATGGGAGGAAGG - Intergenic
1109683568 13:65784293-65784315 AAGGAGCGCCGGAGGGAGGCCGG - Intergenic
1109943635 13:69404518-69404540 GTGGGGAGCCAGAAAGAGGATGG - Intergenic
1110175785 13:72553948-72553970 AAGGGGAGCTGGAAGGGGGATGG + Intergenic
1110903413 13:80854343-80854365 AAAAGGAGCCAGAGGTATGAGGG - Intergenic
1110939751 13:81334834-81334856 AGGGGGAGAGAGAGAGAGGAAGG - Intergenic
1111206720 13:85020445-85020467 ATGGGTAGCCAGAAGGAGGAGGG - Intergenic
1111262489 13:85760395-85760417 ATGGGGAGCCAGAAGGGGTATGG + Intergenic
1111409345 13:87854049-87854071 AATGGGAACCACAGGGAGAAAGG + Intergenic
1111413810 13:87912463-87912485 ATGGGGAGCCAGAAGGGGGATGG - Intergenic
1111452600 13:88438685-88438707 AGGGAGGGACAGAGGGAGGAAGG + Intergenic
1111824313 13:93249374-93249396 AAGGGAAGCCAAAGGCAGAAAGG - Intronic
1112184313 13:97113420-97113442 AAAGAGAGAGAGAGGGAGGAAGG - Intergenic
1112251534 13:97785076-97785098 AAGGCAGGCCAGAGTGAGGAGGG - Intergenic
1112446763 13:99471581-99471603 GAGGGAAGGAAGAGGGAGGAAGG + Intergenic
1112879370 13:104087092-104087114 AGAGGGAGCGAGAGAGAGGAAGG - Intergenic
1112924546 13:104657552-104657574 AGGGAGAGACAGAGGGAGAAAGG - Intergenic
1112929240 13:104714023-104714045 ATGGGGAGCCAGAAGGGGGATGG - Intergenic
1113179788 13:107612091-107612113 GAGGGGAGGGGGAGGGAGGAAGG + Intronic
1113365155 13:109669034-109669056 GAGAGGAGCCTGAGGGAGGAAGG + Intergenic
1113588316 13:111480780-111480802 ATGGGGAGCCAGAAGAAGGAGGG - Intergenic
1113613296 13:111663323-111663345 AAGGTGAGGAAGAAGGAGGAGGG - Intronic
1113618497 13:111697375-111697397 GAAGGGAGGCAGAGAGAGGAAGG - Intergenic
1113624026 13:111782636-111782658 GAAGGGAGGCAGAGAGAGGAAGG - Intergenic
1113754760 13:112803765-112803787 GAGGGGAGGGAGAGGAAGGAGGG - Intronic
1113861779 13:113491326-113491348 GAGGGGAGCCCCAGGGAGGGAGG - Intronic
1113861816 13:113491414-113491436 GAGGGGAGCCCCAGGGAGGGAGG - Intronic
1113861852 13:113491497-113491519 GAGGGGAGCCCCAGGGAGGGAGG - Intronic
1113967829 13:114164392-114164414 AAGGAGAGGCAGATGGGGGAAGG + Intergenic
1114231902 14:20790718-20790740 ATGGGGAGCCAGAAGAGGGAAGG - Intergenic
1114460591 14:22883815-22883837 AAAGGGGGCTAGAGGGAGGCTGG - Intronic
1114525323 14:23364490-23364512 AAGAGAAGACAGAGGGAGGAGGG - Intronic
1114630400 14:24155846-24155868 AAAGGGAAGCAGAGGGAGGGAGG + Intronic
1114702544 14:24693722-24693744 GAGGGGAGCCAGAGGCAGCAGGG - Intergenic
1114822452 14:26037816-26037838 AATGGGAGTCAGTGGGAGTATGG - Intergenic
1114996939 14:28365485-28365507 ATGGGGAGCCAGAAAGGGGATGG - Intergenic
1115013119 14:28574424-28574446 AAGGAGAGGCAGAGAGATGAGGG + Intergenic
1115123985 14:29971189-29971211 TAGGGGAGCCAGAAGGGCGATGG + Intronic
1115952783 14:38739931-38739953 TGGGGGAGCCAAGGGGAGGAGGG + Intergenic
1115979138 14:39030262-39030284 ATGGGGAGCCAGAAGGGAGATGG + Intergenic
1116052693 14:39824431-39824453 AAGGGCAGCCAGAGGAAGGTCGG - Intergenic
1116715146 14:48417400-48417422 AATGGGAGCAAGAGAGAGAAGGG - Intergenic
1116967375 14:51028918-51028940 AAGGGGAGCCAGGGTCAGGGTGG - Intronic
1117450564 14:55845706-55845728 AAGGGGAGCTGGAAGGGGGATGG + Intergenic
1117501620 14:56358055-56358077 AAGAGGAGCCACAGCCAGGATGG - Intergenic
1117620136 14:57577097-57577119 AAGAGGAGCCAAAGGCAAGATGG + Intronic
1117912855 14:60650893-60650915 AAGGGAAGCCAAATGGTGGAAGG + Intronic
1118355249 14:65008402-65008424 CAGGGAAGCCAGAGTGAGCAAGG + Intronic
1118381226 14:65219196-65219218 AAATAGAGCCAGAAGGAGGAAGG - Intergenic
1118416998 14:65550217-65550239 AAGGGGTGCAAGAGAGAGAAGGG + Intronic
1118772461 14:68951358-68951380 AGAGGAAGCCAGAGTGAGGAGGG + Intronic
1119046285 14:71320994-71321016 GAGGGGGGCCCGAGGGAGGCGGG - Intronic
1119117920 14:72044491-72044513 AAGGAGAGGGAGAGGGAGGAAGG - Intronic
1119165475 14:72488922-72488944 TAAGGAAGCAAGAGGGAGGAGGG + Intronic
1119184764 14:72632578-72632600 AAGGAGAGAGAGAGGAAGGAGGG + Intronic
1119184856 14:72632864-72632886 AAGGGGAGGGGAAGGGAGGAAGG + Intronic
1119199471 14:72742133-72742155 AAGGGGAGCTGGAGCGAGGTGGG - Intronic
1119436690 14:74602008-74602030 AAGAGGGGCCTGTGGGAGGAAGG + Intronic
1119480429 14:74954937-74954959 CAGGGAAGCCACAGGGAGGGAGG - Intronic
1119757873 14:77131550-77131572 AATGGGAGGGAGAGGGAGGAGGG - Exonic
1120128189 14:80772418-80772440 ATGGGGAGCTGGAGGGGGGATGG - Intronic
1120491152 14:85180126-85180148 AAGGGGAGCTAGAAAGGGGATGG - Intergenic
1120617341 14:86723619-86723641 AAGGAAAGGCAGTGGGAGGATGG + Intergenic
1120677908 14:87443410-87443432 AAGGAAAGAAAGAGGGAGGAAGG + Intergenic
1120716200 14:87843510-87843532 GAGGGGAGAAGGAGGGAGGAAGG - Intronic
1121034468 14:90688930-90688952 AGGGGAAGCCAGACAGAGGAGGG - Intronic
1121216384 14:92251582-92251604 AAGGAGAGCCAGAGAGAGAAGGG - Intergenic
1121242527 14:92440735-92440757 CAGGGGAGCCAAAGGGAGAGGGG + Intronic
1121270283 14:92633111-92633133 TAGGGGAACCAGAGGGGTGAGGG + Intronic
1121409268 14:93737969-93737991 CAGGGGATGCTGAGGGAGGAAGG + Intronic
1121409351 14:93738434-93738456 AAGGGGATGATGAGGGAGGAAGG + Intronic
1121625895 14:95385197-95385219 ACTGGGGGCCAGAGTGAGGAAGG + Intergenic
1121854470 14:97254204-97254226 AAGGAGACACAGAAGGAGGAAGG - Intergenic
1121882585 14:97514316-97514338 AAGGAGGGAGAGAGGGAGGAAGG - Intergenic
1121962071 14:98270121-98270143 AAAGGGAGAGAGAGGGAGGGAGG - Intergenic
1122079218 14:99255436-99255458 CAGGGGGGCCAGGGGGTGGAAGG + Intronic
1122122584 14:99562294-99562316 CAGGGGTGCCAGAGGAGGGAGGG - Intronic
1122221007 14:100239139-100239161 GAAGGAAGGCAGAGGGAGGAAGG - Exonic
1122322242 14:100862073-100862095 AGGGGGAGGGAGAAGGAGGAAGG - Intergenic
1122448021 14:101782541-101782563 AAGGGGAGAAAGAGAGAGGGAGG - Intronic
1122529834 14:102417926-102417948 CAGGGGAGCCGCAGGGAGGCAGG + Intronic
1122672331 14:103382256-103382278 AAGGGGAAAAAGAGAGAGGAAGG + Intergenic
1122893577 14:104744212-104744234 AAGTGGAGCCTGGGGGAGCAGGG + Intronic
1123490607 15:20777377-20777399 AAAGAGAGACAGAGGGAGGGAGG - Intergenic
1123547109 15:21346464-21346486 AAAGAGAGACAGAGGGAGGGAGG - Intergenic
1124391910 15:29267007-29267029 AAGGGGACCAGGAGGCAGGAAGG + Intronic
1124490274 15:30151100-30151122 AAGGGGAGGAAGATGGAGGGAGG + Intergenic
1124753259 15:32387229-32387251 AAGGGGAGGAAGATGGAGGGAGG - Intergenic
1124866675 15:33499174-33499196 AAGGGGAGGGAGAGAGAGGGAGG - Intronic
1124887504 15:33700963-33700985 ACGGGGAGGCTGAGGGAGGAGGG - Exonic
1124914090 15:33951412-33951434 AAGGGGTGGGGGAGGGAGGAGGG + Intronic
1124974999 15:34522929-34522951 AAGGGGAGGAAGATGGAGGGAGG - Intergenic
1125685071 15:41559163-41559185 GAAGGGAGCGGGAGGGAGGAGGG - Exonic
1125747045 15:42004367-42004389 AAAGGGAGAAAAAGGGAGGAAGG + Intronic
1125832609 15:42727587-42727609 CAGGGAAGCCAAAGGGAGTAGGG + Intronic
1125915842 15:43486565-43486587 AAAGGGAGCAAGGGTGAGGAAGG + Intronic
1126370194 15:47937933-47937955 AAGGAGGGAAAGAGGGAGGAAGG + Intergenic
1126946230 15:53823471-53823493 AAGAGAAAACAGAGGGAGGAAGG + Intergenic
1127027633 15:54824997-54825019 ATGGGGAGCTAGAAGGGGGATGG + Intergenic
1127137553 15:55940476-55940498 AAGGAGGGAGAGAGGGAGGAAGG - Intronic
1127418027 15:58776295-58776317 ATGGGGAGACTGAGGCAGGATGG - Intronic
1127799212 15:62463067-62463089 AAGGGCTGCCAGAGGCAGGGGGG - Intronic
1128078012 15:64840620-64840642 AAGGAGAGAGAGAGGAAGGAGGG - Intergenic
1128157784 15:65402523-65402545 CAGGGGGGCCACAGGGAGGGTGG + Intronic
1128190469 15:65689604-65689626 AGGAGCTGCCAGAGGGAGGAGGG - Intronic
1128338411 15:66803143-66803165 ATGGGGAGGCAGGGGGAGGAGGG - Intergenic
1128349543 15:66879891-66879913 CTGGGGAGCCAGAGGGAGATGGG - Intergenic
1128396198 15:67228979-67229001 GAGGGGAGACAGTAGGAGGAGGG + Intronic
1128412607 15:67414433-67414455 AAGGGGAGGCAGAGGAGGGCAGG + Intronic
1128498297 15:68210592-68210614 AACTGAGGCCAGAGGGAGGAGGG - Intronic
1128690534 15:69721436-69721458 AAGGGGAGACAGAGAGAGGGAGG - Intergenic
1128926713 15:71662934-71662956 AAGGGAAGGCAGAGGGAAAATGG + Intronic
1129210434 15:74064976-74064998 AAGGGGAGGAAGATGGAGGGAGG - Intergenic
1129231392 15:74199037-74199059 TGGGAGAGCCAGAGGGAGGGTGG + Intronic
1129265956 15:74393180-74393202 CAGTGCAGCCAGAGAGAGGAGGG - Intergenic
1129403581 15:75300397-75300419 AAGGGGAGGAAGATGGAGGGAGG + Intergenic
1129461365 15:75701614-75701636 AAGGAGGGCCAGAGGGAGTGTGG - Intronic
1129524747 15:76206614-76206636 AAGGTGAGCCTGGAGGAGGAGGG - Intronic
1129681796 15:77662342-77662364 AAGGGCGGTCAGAGGGAGGAAGG + Intronic
1129684172 15:77675883-77675905 TTGGGGAGCCAGAGTGGGGATGG - Intronic
1129723469 15:77890193-77890215 AAGGAGGGCCAGAGGGAGTGTGG + Intergenic
1129727627 15:77909607-77909629 AAGGGGAGGAAGATGGAGGGAGG - Intergenic
1129901669 15:79156361-79156383 GAGGGGAGACAGAGAGATGAGGG - Intergenic
1129905653 15:79185468-79185490 AAGGAGAGAGAGAGGAAGGAAGG - Intergenic
1129988413 15:79939643-79939665 AAGAAAAGACAGAGGGAGGAAGG + Intergenic
1130069806 15:80636840-80636862 AAGGGGAGCAGAGGGGAGGAGGG + Intergenic
1130073751 15:80671052-80671074 ATGGGGAGCCAGAAGGGGGATGG - Intergenic
1130148256 15:81292028-81292050 CAGGGTAGACAGAGGGAGGACGG + Intronic
1130430439 15:83842031-83842053 ATGGGGAGGCAGAAGGGGGATGG - Intronic
1130995802 15:88903328-88903350 ACTGAGAGCCAGAGAGAGGAAGG - Intronic
1131010843 15:89017360-89017382 AAGGGGAGGCAAAGAGAGGAAGG - Intergenic
1131014207 15:89043710-89043732 AAGAGGAGGGAGAAGGAGGAGGG + Intergenic
1131074488 15:89486722-89486744 CAGGTGAGCCTGAGGGAGGAGGG - Intronic
1131116630 15:89799986-89800008 AGGGGGACCCACAGGGAGGAAGG - Intronic
1131144255 15:90001452-90001474 GAGAGGAGCCGGAGGGAGGGCGG + Exonic
1131303677 15:91222168-91222190 AAGGGGTTCCAAAGGAAGGAGGG - Intronic
1131374717 15:91914181-91914203 AAGGTCAGCCAGAGTCAGGATGG + Intronic
1131393362 15:92067305-92067327 CACGGGAAGCAGAGGGAGGAGGG - Intronic
1131442683 15:92470858-92470880 ACAGGGAGCCAGAGGGAGGAGGG - Intergenic
1131557746 15:93414248-93414270 ATGGGGGGCCAGAAGGGGGACGG + Intergenic
1131785409 15:95906591-95906613 AAGGGGAGGGTGAGGGAGGAGGG + Intergenic
1132169926 15:99640500-99640522 AAGGAGGGAGAGAGGGAGGAAGG - Intronic
1132185338 15:99798349-99798371 AAGGGGAGGAAGAAGGAGGGAGG + Intergenic
1132226997 15:100150571-100150593 GAGGAGGGACAGAGGGAGGAAGG - Intronic
1132399460 15:101496556-101496578 AAGGGGCGGCAGGGGCAGGAAGG - Intronic
1202955439 15_KI270727v1_random:73680-73702 AAAGAGAGACAGAGGGAGGGAGG - Intergenic
1132699147 16:1214905-1214927 AGTGGGAGCCAGGGGGAAGAGGG + Intronic
1132997912 16:2832896-2832918 AAGTGGAGACAAAGGGAGGAGGG + Intronic
1133342714 16:5047137-5047159 AGGGGGAGACAGAGAGAGGAAGG - Intronic
1133354139 16:5123625-5123647 TGGGGGAGCCAGAAGGAAGATGG + Intergenic
1133392855 16:5423096-5423118 AGGAGGAGGGAGAGGGAGGAAGG + Intergenic
1133589546 16:7229541-7229563 AAGGAGAGAGAGAGGAAGGAAGG + Intronic
1133589558 16:7229580-7229602 AAAGGGAGAGAGAGGAAGGAAGG + Intronic
1133589574 16:7229640-7229662 GAAGGGAGAGAGAGGGAGGAAGG + Intronic
1133589602 16:7229747-7229769 GAAGGGAGAGAGAGGGAGGAAGG + Intronic
1133589611 16:7229783-7229805 GAAGGGAGAGAGAGGGAGGAAGG + Intronic
1133589620 16:7229819-7229841 GAAGGGAGAGAGAGGGAGGAAGG + Intronic
1133589625 16:7229837-7229859 GAAGGGAGAGAGAGGGAGGAAGG + Intronic
1133589634 16:7229873-7229895 GAAGGGAGAGAGAGGGAGGAAGG + Intronic
1133589639 16:7229891-7229913 GAAGGGAGAGAGAGGGAGGAAGG + Intronic
1133589644 16:7229909-7229931 GAAGGGAGAGAGAGGGAGGAAGG + Intronic
1133589649 16:7229927-7229949 GAAGGGAGAGAGAGGGAGGAAGG + Intronic
1133589654 16:7229945-7229967 GAAGGGAGAGAGAGGGAGGAAGG + Intronic
1133589659 16:7229963-7229985 GAAGGGAGAGAGAGGGAGGAAGG + Intronic
1133589664 16:7229981-7230003 GAAGGGAGAGAGAGGGAGGAAGG + Intronic
1133597103 16:7303851-7303873 AAGGATAGCGAGAGGGAGGGAGG - Intronic
1133720364 16:8488966-8488988 GGGGGGAGGCAGAGGGAGGAAGG + Intergenic
1133758649 16:8781035-8781057 AAGGAGAGAGGGAGGGAGGAAGG + Intronic
1133820528 16:9232287-9232309 AAAGGGAGGGAGAGGGAGGAGGG - Intergenic
1134012765 16:10867486-10867508 AAAGGGAGGGAGAGGAAGGAAGG + Intergenic
1134255303 16:12605473-12605495 AAGGGCAGCCAGAGAAAGGTCGG + Intergenic
1134523643 16:14929199-14929221 ACAGGGAGGCAGAGGGAGGGTGG - Intronic
1134549254 16:15131737-15131759 ACAGGGAGGCAGAGGGAGGGTGG + Intronic
1134617544 16:15663145-15663167 TAGGGGAGCTAGAGGGAGTCTGG - Intronic
1134682381 16:16135311-16135333 AAGTGGGGACAGATGGAGGAGGG - Intronic
1134711235 16:16327684-16327706 ACAGGGAGGCAGAGGGAGGGTGG - Intergenic
1134718963 16:16370596-16370618 AAGGGGAGAGAGATGGAGAAAGG - Intergenic
1134719089 16:16370986-16371008 ACAGGGAGGCAGAGGGAGGGTGG - Intergenic
1134948338 16:18340899-18340921 ACAGGGAGGCAGAGGGAGGGTGG + Intergenic
1134955594 16:18381009-18381031 ACAGGGAGGCAGAGGGAGGGTGG + Intergenic
1135186057 16:20316902-20316924 AAGGGAAGAGAGAGGGAGAAAGG - Intronic
1135640238 16:24113517-24113539 AAGGGGGGAGGGAGGGAGGAAGG - Intronic
1135694693 16:24575754-24575776 AAAGAGAGGGAGAGGGAGGAGGG + Intergenic
1135694706 16:24575793-24575815 GAGGAGAGGGAGAGGGAGGAGGG + Intergenic
1135694758 16:24575915-24575937 GAGGAGAGGGAGAGGGAGGAGGG + Intergenic
1135708701 16:24696773-24696795 AAGGGGAGGGGGAGGGAGGGAGG + Intergenic
1135768088 16:25195202-25195224 AAGAGGGGCCAGAGACAGGAGGG + Intergenic
1135848367 16:25939798-25939820 TAGGGCAGCCAGAATGAGGAAGG + Intronic
1135892127 16:26366665-26366687 AAGCAGAGGGAGAGGGAGGAGGG + Intergenic
1135920023 16:26641541-26641563 CAGGGGAGGGAGATGGAGGATGG - Intergenic
1135920390 16:26644087-26644109 AAAGGGAGAAGGAGGGAGGAAGG - Intergenic
1136031194 16:27504301-27504323 AGGGGATGGCAGAGGGAGGAAGG + Intronic
1136073427 16:27802596-27802618 CAGGGGAGCCAGAGGCCGGTGGG - Intronic
1136112843 16:28075655-28075677 AAGGGCAGCCAGACACAGGAAGG - Intergenic
1136417568 16:30113150-30113172 AGGTGAGGCCAGAGGGAGGATGG - Intronic
1136551610 16:30985197-30985219 AGGAGGAGCCAGCGGAAGGACGG + Exonic
1136678642 16:31939275-31939297 AAGGGCAGCCAGAGAAAGGTTGG + Intergenic
1136779247 16:32886425-32886447 AAGGGGAGGCGGAGGGCTGAGGG - Intergenic
1136891370 16:33975093-33975115 AAGGGGAGGCGGAGGGCTGAGGG + Intergenic
1136920519 16:34267532-34267554 AAGGGAGGGCAGAGGGAGAATGG - Intergenic
1137239415 16:46642249-46642271 AAGGGCAGCCAGAGAAAGGCTGG + Intergenic
1137289589 16:47042893-47042915 AGGGGGAGGCAGAGGGCAGAGGG + Intergenic
1137322170 16:47396287-47396309 AATGGGAGCAAAAGGGAGGGAGG + Intronic
1137570502 16:49563285-49563307 AGAGGGAGCAAGAGGGAGGGGGG - Intronic
1137758794 16:50923963-50923985 AAGGAGAAAAAGAGGGAGGATGG + Intergenic
1137977260 16:53042295-53042317 GAGGGGAGACGGAGGGAGGAAGG - Intergenic
1138130622 16:54476602-54476624 GAGGGGAGACAGAGGGAGGGGGG + Intergenic
1138265727 16:55658071-55658093 AAGGGAGGTCAGAGGGAGGAAGG + Intronic
1138628944 16:58278217-58278239 AAGGAGAGGAAGAGGAAGGAGGG + Intronic
1138653127 16:58473139-58473161 AAGGGAAGAGAAAGGGAGGAAGG - Intronic
1138988513 16:62361525-62361547 AAGGGGAGAGAGAGGGAGGGAGG + Intergenic
1139029147 16:62858355-62858377 AGGGGGGGGCAGAGAGAGGATGG - Intergenic
1139274655 16:65716354-65716376 AAGGGGAGGGAGAGGAAGGAAGG + Intergenic
1139284455 16:65798071-65798093 ATGGGGAGCCAGAAGGGGGATGG - Intergenic
1139303108 16:65961978-65962000 AAGGAGGGAGAGAGGGAGGAAGG + Intergenic
1139797902 16:69497887-69497909 AAGATGAGGCAGAGGGAGGGAGG + Intergenic
1139846387 16:69924644-69924666 AAGGGGAGACAGGGGAAAGAAGG - Intronic
1140306131 16:73804911-73804933 GAGGGGAGGGAGAGGGAGGGAGG + Intergenic
1140328236 16:74026885-74026907 AAAGGGAGAGAGAGGGAGGAAGG + Intergenic
1140339112 16:74139790-74139812 ATGGGGAGCTAGAAGGGGGATGG + Intergenic
1140748141 16:77999146-77999168 ATGGGCAGCCAGAAGGGGGATGG + Intergenic
1140772964 16:78222962-78222984 GAGGGGAGCCAGAGGAATGCAGG + Intronic
1140818926 16:78645601-78645623 AAAGGGAGCAAGAGAGGGGAGGG + Intronic
1140914615 16:79482953-79482975 AAGGAGGGACAGAGGGAGGGAGG - Intergenic
1140914668 16:79483088-79483110 AAGTAGGGACAGAGGGAGGAAGG - Intergenic
1140967696 16:79983111-79983133 GAGGGAAGAGAGAGGGAGGAAGG - Intergenic
1141079893 16:81040949-81040971 CAGGGGAGCATGAGGGAGGTTGG + Intronic
1141141657 16:81500382-81500404 AAGGAGAGAGAGAAGGAGGAAGG - Intronic
1141161081 16:81629545-81629567 AAGGAGACAGAGAGGGAGGAAGG - Intronic
1141177152 16:81728554-81728576 AAGGAGAGAGAGAGGAAGGAAGG - Intergenic
1141372442 16:83500480-83500502 AGGGGGAGGAGGAGGGAGGAAGG - Intronic
1141492070 16:84380502-84380524 TGGGGGAGGCGGAGGGAGGAAGG + Intronic
1141636196 16:85315194-85315216 AAGGGGTGGCTGAGGGAGCAGGG + Intergenic
1141700154 16:85638743-85638765 AAGGGGTGGCAGTGGGTGGAGGG - Intronic
1141757035 16:85998143-85998165 CAGGGGTGGCAGAGGGAGGAGGG - Intergenic
1141773024 16:86102331-86102353 AAGGAGAGGGAGAGGAAGGAAGG - Intergenic
1141812337 16:86383785-86383807 AAGGAGGGACAGAGGGAGAAAGG + Intergenic
1141850661 16:86643268-86643290 AAGGGGTGGCAGAAGGAAGATGG - Intergenic
1141927401 16:87178520-87178542 AGAGGGAGGCAGAGAGAGGAGGG - Intronic
1141927409 16:87178553-87178575 AGAGGGAGGCAGAGAGAGGAGGG - Intronic
1141955292 16:87366749-87366771 GAGGGGAGGCAGAGGGCAGACGG + Intronic
1141983695 16:87565903-87565925 GAGGGGAGGGACAGGGAGGAAGG - Intergenic
1142267783 16:89072474-89072496 ATGGGGAGCCAGGGAGAGGGAGG + Intergenic
1203081663 16_KI270728v1_random:1148513-1148535 AAGGGGAGGCGGAGGGCTGAGGG - Intergenic
1142562934 17:821822-821844 AGGGGGAGGAAGGGGGAGGATGG - Intronic
1142869317 17:2809921-2809943 CAGAGGAGCCAGCGGGAGGAAGG - Intronic
1142958158 17:3535183-3535205 AGGAGGAGGGAGAGGGAGGAAGG - Intronic
1142958222 17:3535383-3535405 GAGAGGAGGGAGAGGGAGGAGGG - Intronic
1143036295 17:4001160-4001182 AAGAGGAGGAAGAGGCAGGATGG + Intergenic
1143071202 17:4294993-4295015 AAGGAGAGACGGAGGGAGGGAGG + Intronic
1143373173 17:6453059-6453081 AAAGGAAGACAGAGAGAGGAAGG - Exonic
1143449825 17:7029454-7029476 ATGGGGAGAAAGAGGGAAGAGGG - Exonic
1143503688 17:7352585-7352607 GAGGGCAGCCAGAGAGGGGAAGG - Exonic
1143763817 17:9124372-9124394 GAGAGAAGCCGGAGGGAGGAGGG - Intronic
1143784036 17:9243696-9243718 AGGAGGGGGCAGAGGGAGGAGGG - Exonic
1143924056 17:10353906-10353928 AAGGAGAGAGAGAGGAAGGAAGG + Intronic
1144247770 17:13384392-13384414 AAGGAGGGAGAGAGGGAGGAAGG + Intergenic
1144302859 17:13939090-13939112 ATGGGGAGCCAGAAAGGGGATGG - Intergenic
1144320844 17:14117926-14117948 ATGGGGAGCCAGAAGGGGGATGG + Intronic
1144560967 17:16320137-16320159 AAGGGAAGGGAGAGAGAGGAAGG + Intronic
1145124018 17:20285766-20285788 AAGGGGAGAGAGAAGGAGGGAGG - Intronic
1145404199 17:22571229-22571251 GAGGGTAGCAAGAGGGAGCAGGG + Intergenic
1146289741 17:31598710-31598732 AAGGAGCTCCAGAGGGTGGAGGG + Intergenic
1146297166 17:31659198-31659220 AGGGGGAGGGAGAGGGAGAAAGG + Intergenic
1146422215 17:32698289-32698311 AGGGGGAGGGAGAGGGGGGAAGG - Intronic
1146608028 17:34278771-34278793 AAGGGCAGCCAGAGAGAGAAAGG + Intergenic
1146722535 17:35133244-35133266 AAAGGGAGGCAGAGGAAGGCAGG + Intronic
1146736710 17:35244337-35244359 AAGGGATGCTTGAGGGAGGATGG + Intronic
1146963075 17:37001334-37001356 AAGGAGAGAGGGAGGGAGGAAGG + Intronic
1147050143 17:37788239-37788261 AAGGGGAGAGGGAGGGAGGAGGG - Intergenic
1147122573 17:38344175-38344197 AAGGGCAGGCAGAGGGAGGGAGG - Intergenic
1147129105 17:38395616-38395638 TATTGCAGCCAGAGGGAGGAAGG + Intronic
1147167621 17:38601868-38601890 AGGGGTGGTCAGAGGGAGGAAGG + Intronic
1147169237 17:38608538-38608560 AAGTGGAGCCAGAGGACAGATGG + Intergenic
1147418665 17:40311223-40311245 GAGGGAAGCCAGTGGGAGGATGG + Intronic
1147533092 17:41298589-41298611 CGGGGGAGCCAGAAGGGGGATGG - Intergenic
1147588434 17:41666229-41666251 AGGGGGAGCAGGAGAGAGGAAGG - Intergenic
1147656739 17:42095431-42095453 AAGGGCAGCCAGAGGGATGGTGG + Intergenic
1147759936 17:42791028-42791050 AGGTGGAGGCAGAGGCAGGAAGG - Intronic
1147770351 17:42863765-42863787 AAGGAGAGAGAGAGGGAGGGAGG - Intergenic
1147842404 17:43381328-43381350 AAGGGCAGCCAGAGGAGGAATGG - Intergenic
1147906333 17:43825500-43825522 AAAGGGAACCAGGGGAAGGAAGG + Intronic
1148084506 17:44985807-44985829 TGGGGGAGCCAGAAGGGGGATGG - Intergenic
1148194762 17:45705439-45705461 AGGGGGAGCCAGTGGGAGACTGG - Intergenic
1148343788 17:46890122-46890144 AAGAGGAGCGAGGAGGAGGAGGG - Intergenic
1148354882 17:46969117-46969139 GAGGGGAGCCAGAGCGAGATCGG - Intronic
1148551235 17:48551832-48551854 GAGGGCAGCTAGAGGGAGGAGGG + Intronic
1148561379 17:48608719-48608741 AAGGGGTGCAAGTGGGATGAGGG + Intronic
1148694223 17:49549421-49549443 CAGGGCAGGCAGAGGGAGAAAGG + Intergenic
1148774799 17:50089285-50089307 AAGGGGACACTGGGGGAGGAGGG - Exonic
1148996450 17:51714469-51714491 AAAGAGCTCCAGAGGGAGGAAGG - Intronic
1149297492 17:55273772-55273794 AAGGGAAGCGAGGGGGAGGAGGG - Intronic
1149298871 17:55285965-55285987 AAGGGTGGCCCGAGGAAGGAAGG - Intronic
1149937159 17:60819707-60819729 AAGGGGAGGGGAAGGGAGGAAGG - Intronic
1150000694 17:61437134-61437156 AAGGAGAGGGAGAGGGAGGAAGG - Intergenic
1150078309 17:62213262-62213284 AAAGAGAGAGAGAGGGAGGAAGG - Intergenic
1150148155 17:62788327-62788349 AGGGAGAGCCAGGGGCAGGAAGG - Intronic
1150477868 17:65488166-65488188 AAGGAGAGAGAGAGGGAGGGAGG + Intergenic
1150477915 17:65488386-65488408 AAGGAGAGAGAGAGGGAGGGAGG + Intergenic
1150598389 17:66627439-66627461 AAGGAGGGAGAGAGGGAGGAAGG + Intronic
1150637999 17:66929756-66929778 AAGAGGAGAGAGAGGAAGGAGGG + Intergenic
1150645689 17:66976317-66976339 GAGGAAAGACAGAGGGAGGAGGG - Intronic
1150646089 17:66978392-66978414 GAGGGGACCCAGAGTGAAGATGG + Intronic
1150888425 17:69114753-69114775 AAGTGGAACAAGAGGTAGGAGGG - Exonic
1150984815 17:70184433-70184455 AAGGAGGGAGAGAGGGAGGAAGG - Intergenic
1150999025 17:70352137-70352159 ATGGGGAGCCAGAAGGGGGATGG - Intergenic
1151194926 17:72424636-72424658 CAGGGCGGCCAGTGGGAGGAGGG - Intergenic
1151200164 17:72462063-72462085 AAGGGAAGGGAGAGGAAGGAAGG - Intergenic
1151266436 17:72959569-72959591 GAAGGGTGGCAGAGGGAGGAGGG + Intronic
1151331345 17:73411055-73411077 GGGGGGAGGCAGAGGAAGGAAGG - Intronic
1151350165 17:73527145-73527167 CAGGGGAGCTCCAGGGAGGAAGG + Intronic
1151401366 17:73857996-73858018 GAGGGGGCCCTGAGGGAGGAGGG - Intergenic
1151429832 17:74055007-74055029 AAAGGGAGAGAGAGGGAGAAAGG - Intergenic
1151762322 17:76112290-76112312 GGAGGGAGACAGAGGGAGGAAGG + Intronic
1152089242 17:78237822-78237844 ATGGGGAGGCTGAGGGAGGGAGG - Intronic
1152139571 17:78528575-78528597 AAGGGGAGAGGGCGGGAGGAGGG + Intronic
1152456044 17:80416739-80416761 AAAGAGAGACAGAGAGAGGAAGG - Intronic
1152811827 17:82386042-82386064 AGGGGAAGACGGAGGGAGGATGG - Intergenic
1152811912 17:82386322-82386344 AGGGGAAGGCGGAGGGAGGACGG - Intergenic
1152811966 17:82386513-82386535 AGGGGAAGGCGGAGGGAGGATGG - Intergenic
1152859083 17:82685215-82685237 ATGGGGAGGGGGAGGGAGGACGG + Intronic
1153820065 18:8825158-8825180 AAGCAGAGCCAGAGGGAGCCCGG + Exonic
1153883972 18:9446706-9446728 AAGGGGAGCAGGAGAGAGAAAGG - Intergenic
1153987778 18:10368551-10368573 GAGGAGAGGGAGAGGGAGGAAGG + Intergenic
1153987797 18:10368627-10368649 AAGGAGAGAGAGAGGGAGGAAGG + Intergenic
1154145205 18:11861247-11861269 AAGGAGAGCCAGCAGGAGGGAGG - Intronic
1154183244 18:12156079-12156101 AAAGGGAGGGAGAGGGAGGGGGG - Intergenic
1154465614 18:14641105-14641127 GAGGGTGGCGAGAGGGAGGAGGG - Intergenic
1155219228 18:23669403-23669425 AAGGAGAGAGAGAGGGAGGGAGG - Intergenic
1155374478 18:25140646-25140668 ATGGGGAGACAGAGGGGAGAAGG + Intronic
1155392695 18:25352208-25352230 GCGGGGAGCGGGAGGGAGGAGGG + Intergenic
1155524492 18:26702710-26702732 AAAGAGAGAGAGAGGGAGGAAGG - Intergenic
1157175019 18:45443702-45443724 AATGAGAGGCAGAGAGAGGAGGG + Intronic
1157220307 18:45824805-45824827 AAGAGGAGGCAGAGAGAGTATGG + Intergenic
1157470126 18:47982529-47982551 AGGGGGAGGGAGAGGGAGGGAGG + Intergenic
1157551124 18:48582505-48582527 GAGGGGACCCTGAGGCAGGAGGG - Intronic
1157609824 18:48949463-48949485 AAGGGGGTGCAGAGGGAGGTGGG - Intronic
1157681465 18:49610672-49610694 AAGGGGAGACAGGGGGCGTAGGG + Intergenic
1157762840 18:50276795-50276817 AAGGTGAGCCAGATGGGTGAGGG - Intronic
1157778692 18:50418347-50418369 CAGGGGAGCCCGAGGCAGGGAGG + Intergenic
1157824736 18:50802542-50802564 CAGGTAAACCAGAGGGAGGAGGG + Intronic
1158678704 18:59547080-59547102 AAAGGGAGAGAGAGGGAGGTAGG + Intronic
1158851129 18:61496295-61496317 AGGGGGAGAGAAAGGGAGGAGGG - Intronic
1158968542 18:62644671-62644693 AAGGGGAGCTGGAAAGAGGATGG - Intergenic
1159118263 18:64139945-64139967 AAAGAGGGCAAGAGGGAGGATGG - Intergenic
1159122084 18:64182879-64182901 AGGGAGAGGCAGAGGGAGGGAGG - Intergenic
1159417604 18:68173259-68173281 ATGGGGAGCCAGAAGGGGGATGG + Intergenic
1159451197 18:68604329-68604351 AGGGGGAGAGAGAGGGAGGGAGG + Intergenic
1159664432 18:71140809-71140831 AAGGGGAGAGAGAGAGAGGAAGG + Intergenic
1159923523 18:74247107-74247129 ATGGGGAGACAATGGGAGGATGG - Intergenic
1160178624 18:76615804-76615826 ATGGGGAGGCAGAGGGACCAAGG + Intergenic
1160466882 18:79085146-79085168 AAAGGGAGCAAGAGAGAGAATGG + Intronic
1160498592 18:79389930-79389952 AGGGGGAGGCAGAGGGAGGCAGG + Intergenic
1160623526 18:80187609-80187631 CAGGGGAGCCAGGAGGTGGATGG - Intronic
1160698923 19:497144-497166 AAGGGGCGCAGGAGAGAGGAGGG + Intronic
1160758788 19:772121-772143 AAGGGGGGAGACAGGGAGGAGGG - Intergenic
1160869995 19:1273338-1273360 TAGGGGAGCCAGGCGGGGGACGG + Intronic
1160965788 19:1746339-1746361 AGGGGGAGGAAGGGGGAGGATGG + Intergenic
1161023826 19:2025515-2025537 AAGGAGAGAGAGAGGAAGGAGGG - Intronic
1161256042 19:3310237-3310259 AGGGGGAGAGAGAGGGAGGGAGG - Intergenic
1161319291 19:3633576-3633598 CAAGAGAGGCAGAGGGAGGAAGG + Intronic
1161322173 19:3646368-3646390 TAGGGGAGGCTGAGGCAGGATGG + Intronic
1161403991 19:4081763-4081785 AGGGGGAGTAGGAGGGAGGAAGG - Intergenic
1161643367 19:5437303-5437325 GAGGGTAGGCAGAGGCAGGAGGG + Intergenic
1161657172 19:5523421-5523443 AAGGGGAGGCAGGGAGGGGACGG - Intergenic
1161684804 19:5697487-5697509 AGGCTGAGGCAGAGGGAGGAGGG + Intronic
1161689176 19:5720892-5720914 AAGGGGAGCCTCAGTGAGGTTGG - Intronic
1161756619 19:6138587-6138609 GAGGGAAGAGAGAGGGAGGAAGG + Intronic
1161851842 19:6741200-6741222 AAGGGGAGACAGAGGTAGGAGGG - Intronic
1162149090 19:8632197-8632219 TAGAGGAGCCAGAGGGAGGCAGG + Intergenic
1162178182 19:8847249-8847271 ATGGGGAGCTAGAAGGGGGATGG + Intergenic
1162417239 19:10545128-10545150 GAGGTGAGCCATAGGGGGGAAGG + Exonic
1162803405 19:13123436-13123458 AGGAGGAGCGAGTGGGAGGAGGG + Intronic
1162861009 19:13505870-13505892 GAGGGGAGGCGGAGGGAGGAGGG + Intronic
1162937996 19:13991284-13991306 AAGGTGGGGCAGAGGGAGAATGG + Intronic
1163207420 19:15813828-15813850 AAGTGGAGAGAGAGGGAGGTGGG + Intergenic
1163283474 19:16331522-16331544 AGAGGGAGAGAGAGGGAGGAAGG - Intergenic
1163548541 19:17952680-17952702 GAGGGGACAGAGAGGGAGGAGGG - Intronic
1163584514 19:18156539-18156561 CAGGAGGACCAGAGGGAGGAAGG + Intronic
1163637721 19:18445163-18445185 CATGGGAGCTGGAGGGAGGAGGG - Intronic
1163760805 19:19135436-19135458 AAAGGGAAGAAGAGGGAGGAGGG - Intronic
1163779753 19:19240065-19240087 ATGAGGAGCAGGAGGGAGGAGGG - Intronic
1164425998 19:28142463-28142485 AAGGGGAGAGGGAGGGAGAACGG + Intergenic
1164580277 19:29430482-29430504 AGAGGGAGCCAGAGAGAGCAAGG - Intergenic
1164581656 19:29438780-29438802 AGGGAGAGACAGAGGGAGGGAGG + Intergenic
1164684387 19:30157315-30157337 GGGGAGAGCCAGGGGGAGGAAGG + Intergenic
1164802692 19:31090752-31090774 AAGGGGAGACAGAGAGAAGGAGG + Intergenic
1164834470 19:31348963-31348985 AATGGGTGCGAGAGGGAAGAGGG + Intronic
1164934238 19:32198700-32198722 AAGGGGTTCAAGAGAGAGGACGG - Intergenic
1164956615 19:32392142-32392164 AGGGGGAGGGAGAGGAAGGAAGG + Intergenic
1165157003 19:33795380-33795402 TCGGGGTGCCAGTGGGAGGAAGG - Intergenic
1165194858 19:34093922-34093944 AACAGGAGCAAGAGGGAGGTGGG + Intergenic
1165322639 19:35095762-35095784 AAAGGGAGAGAGAGGAAGGAAGG + Intergenic
1165412877 19:35673209-35673231 CTGGGGAGACAGAGGGAGGACGG - Intronic
1165474613 19:36023354-36023376 ATGGAGACCCAGAGGCAGGAAGG - Intronic
1165885344 19:39074138-39074160 AAGGAGAGAGAGAGGAAGGAAGG + Intergenic
1165940023 19:39410281-39410303 GAGGGAAGTGAGAGGGAGGAGGG - Intergenic
1165944839 19:39435828-39435850 AAGGTGAGCCAGACGCCGGATGG - Exonic
1166091524 19:40512541-40512563 AAGGGGCGCCCAAGAGAGGATGG - Intronic
1166184215 19:41128838-41128860 AGGGAGAGGGAGAGGGAGGAGGG + Intergenic
1166302569 19:41920898-41920920 AGGGAGAGACAGAGGGAGGGGGG - Intronic
1166473951 19:43104456-43104478 AAGGAGAGAGAGAGAGAGGAAGG + Intronic
1166548572 19:43649632-43649654 AAAGAGAGAGAGAGGGAGGAAGG + Intronic
1166573109 19:43811720-43811742 AAGGAGAGAGGGAGGGAGGAAGG + Intronic
1166621610 19:44306272-44306294 AGGGGGAGCCAGAAGGGAGATGG + Intergenic
1166855226 19:45779938-45779960 AAGGGGAGACAGACAGAGGGTGG - Exonic
1166948034 19:46409127-46409149 AAGGGGAGGGAGAGGGAGAGGGG + Intergenic
1167060649 19:47143627-47143649 AAGGGGAGCCAGAGCAGGGGAGG - Intronic
1167466275 19:49652387-49652409 AGGTGGAGCCAGAGGGCGGCGGG - Exonic
1167483738 19:49748065-49748087 AAGGTGAGCCAGTGGGACGCAGG - Exonic
1167597646 19:50435865-50435887 GAGGGGAACCCGGGGGAGGAGGG + Intronic
1167636083 19:50656566-50656588 AAGGGGAGGCTGAGGGGGGCAGG + Intronic
1167669139 19:50839458-50839480 CTGGGGAGTCTGAGGGAGGAGGG + Intergenic
1168059603 19:53883469-53883491 AAGGGGAGCTGAAGGGGGGAAGG + Intronic
924967803 2:94029-94051 AAGGGCAGCCAGAGAGATGTAGG + Intergenic
925079362 2:1051141-1051163 AGGGGGAGAGGGAGGGAGGAAGG - Intronic
925188727 2:1866564-1866586 AAGGGGAGAGAGAGAGAGGCAGG + Intronic
925198961 2:1950872-1950894 AAGGAGAGCTAGATGGTGGAAGG + Intronic
925372940 2:3360932-3360954 AAGGGGAGGAGAAGGGAGGAGGG + Intronic
925833289 2:7917637-7917659 AGGGAGAGAGAGAGGGAGGAAGG + Intergenic
926123665 2:10258251-10258273 AAGGTGAGCAAGGAGGAGGAAGG - Intergenic
926126709 2:10276742-10276764 AAGGGGAGGCACAGGGTGGCGGG - Intergenic
926142662 2:10377604-10377626 CACGGGAGCCAGGGGGAGGAGGG - Intronic
926166567 2:10524873-10524895 AAGGGGAGCCAGAGAAAGAGAGG + Intergenic
926663716 2:15496654-15496676 AAGGAGGGAGAGAGGGAGGAAGG + Intronic
926697724 2:15782454-15782476 CAGGGGTGGGAGAGGGAGGATGG - Intergenic
926920752 2:17937451-17937473 GAGGGGAGCCAAGGGGAGGTGGG - Intronic
927049808 2:19316193-19316215 TTGGAGAGTCAGAGGGAGGAGGG - Intergenic
927192054 2:20523774-20523796 AAAGGAAGCCAGAGAGAGCAGGG + Intergenic
927287512 2:21371705-21371727 AAGGGGAGAGAAAGGGAGGGAGG + Intergenic
927468242 2:23352527-23352549 AAGGGGAAAGAGAGGGAGGATGG + Intergenic
927713311 2:25339047-25339069 AAGGAGAGGCAGTGTGAGGAGGG - Intronic
928009643 2:27595043-27595065 CAGGGGAGCCCGAGGTAGGGAGG + Intronic
928194623 2:29206279-29206301 AGGGGGAGAGAGAGGGAGGGAGG - Intronic
928239372 2:29573114-29573136 AAGGGGAGGGAGAGAAAGGAGGG - Intronic
928316815 2:30252813-30252835 CAGGGCTGGCAGAGGGAGGAAGG + Intronic
928773735 2:34733320-34733342 AAGGGGAACGAAAGGAAGGAAGG - Intergenic
928813106 2:35253641-35253663 AAGGGGAGCTGGAAGGAGAATGG - Intergenic
928819341 2:35342186-35342208 ATGGGGAGCCAGAAGGGAGATGG - Intergenic
929011508 2:37449839-37449861 AAGGGGAGGCAGGGCGTGGATGG - Intergenic
929100584 2:38308458-38308480 AAAGGTAGTCAGAGGGTGGAGGG + Intronic
929336664 2:40756438-40756460 AAGGAAAGAAAGAGGGAGGAAGG - Intergenic
929435172 2:41923275-41923297 AAGGGGTGCCCAAAGGAGGAGGG - Intergenic
929475448 2:42242646-42242668 AAGGAGAGAGGGAGGGAGGAAGG - Intronic
929609277 2:43257917-43257939 CAGAGAAGCCAGTGGGAGGAAGG + Intronic
929778885 2:44944773-44944795 GAGGGGAAGGAGAGGGAGGAGGG - Exonic
929834478 2:45382489-45382511 ATGGGGTAACAGAGGGAGGAAGG - Intergenic
930002576 2:46870967-46870989 AAGAGGAGCCACAGGGCAGAGGG - Intergenic
930371012 2:50501192-50501214 AAGGGGAGACGGATGAAGGAAGG + Intronic
930752757 2:54948618-54948640 AAGGTTAAGCAGAGGGAGGAGGG + Intronic
931450377 2:62363226-62363248 TAGGGGAGTCTGAGGAAGGATGG - Intergenic
931597695 2:63967766-63967788 AAGGGGTAGCAGAGGGATGAGGG + Intronic
931800682 2:65755340-65755362 AAGGGGAGCAAGAGAGAAGCAGG + Intergenic
931812900 2:65872382-65872404 AAGGGGACAAAGAGGAAGGAGGG + Intergenic
931819277 2:65935241-65935263 AAGGAGAGCCAGAAGGACAAAGG + Intergenic
932379025 2:71265188-71265210 AAAGGGAGGGAGAGGAAGGAAGG - Intergenic
932451409 2:71813000-71813022 CAGGTGGGCCAGAGGGAGGAGGG - Intergenic
932623921 2:73283833-73283855 AACAGGGGCCAGAGGGAGGGGGG - Intronic
932742904 2:74305692-74305714 AAAGGGAGTTGGAGGGAGGAAGG - Intronic
932893065 2:75612621-75612643 ATGGGGAGCCAGATGGGTGAGGG - Intergenic
932957155 2:76365991-76366013 AAGGAGAGAGAGAGGAAGGAAGG - Intergenic
933140894 2:78792221-78792243 ATGGGGAGCCAGATGAGGGATGG + Intergenic
933141438 2:78795743-78795765 ATGGGGAGCCAGAAGGAGGATGG + Intergenic
933315222 2:80706815-80706837 CGGGGGAGCCAGAAGGAAGATGG - Intergenic
933378528 2:81513385-81513407 AAGATGAGAAAGAGGGAGGAGGG + Intergenic
933441092 2:82315363-82315385 AAAGGGAGAGAGAGGGAAGAGGG - Intergenic
933628861 2:84633713-84633735 AAGGGAAGCCAGCAGGAAGAAGG - Intronic
933746804 2:85577685-85577707 AAGAGGAGCCAGAGGGGGCTTGG + Intronic
933783860 2:85822563-85822585 ATGTGGAGAGAGAGGGAGGAAGG - Intergenic
933990244 2:87628651-87628673 CAAGGGAGACAGAGGGTGGAGGG + Intergenic
934049965 2:88201528-88201550 AAGAGGAGAGAGAGAGAGGAAGG + Intergenic
934049997 2:88201838-88201860 AAGAGGAGAGAGAGAGAGGAAGG + Intergenic
934066051 2:88343017-88343039 GAGGGGTGCCAGTGGGAGGCTGG - Intergenic
934138590 2:89022044-89022066 GAGGGGAGACAAAGGGAGGAAGG - Intergenic
934189316 2:89771671-89771693 AGGAGGAGGGAGAGGGAGGAAGG + Intergenic
934230655 2:90178519-90178541 GAGGGGAGACAAAGGGAGGAAGG + Intergenic
934605721 2:95693793-95693815 AAAGGGAGCGACAGGGAGGACGG - Intergenic
934729410 2:96647153-96647175 AAGGTGAGGCAGAGAGAGGCAGG + Intergenic
934765040 2:96875931-96875953 ACAGGGAGACAGAGGAAGGAGGG + Exonic
934781290 2:96971291-96971313 AAGGAGAGAGAGAGGGAGGTGGG - Intronic
934859457 2:97751802-97751824 AAAGGGAGGAAGAGGGAGGTGGG + Intergenic
934871658 2:97872040-97872062 AGGGGGAGGGAAAGGGAGGAAGG + Intronic
935138819 2:100333142-100333164 ATGGGGAGCCAGAAGGGGGATGG - Intergenic
935147439 2:100405465-100405487 AAGGTGGGGCAGAGAGAGGATGG + Intronic
935224940 2:101045336-101045358 ATGGGGAGACAGAGAGAGAAAGG - Intronic
935296671 2:101655988-101656010 AAGTGGGGCCAGGGGGAGGGGGG - Intergenic
935341261 2:102061630-102061652 AAGGGCAGCCTGATGGAGGGAGG - Intergenic
935358447 2:102226659-102226681 AAAGAGAGAGAGAGGGAGGAAGG + Intronic
935555843 2:104508744-104508766 ATGGGGACCCACATGGAGGAAGG + Intergenic
935653250 2:105399417-105399439 CGGGGGAGGCGGAGGGAGGAGGG + Intronic
935677458 2:105608340-105608362 AGGAGGAGCCAGAGGCAGTAAGG - Intergenic
935788016 2:106566690-106566712 AAGGGGAGAGGAAGGGAGGAAGG - Intergenic
936152665 2:110030181-110030203 GAGGGGAGCAGGCGGGAGGAAGG + Intergenic
936192015 2:110341231-110341253 GAGGGGAGCAGGCGGGAGGAAGG - Intergenic
936291306 2:111225975-111225997 AAGGGGAACCAGTGGGAGGGAGG + Intergenic
936303602 2:111322173-111322195 CAAGGGAGACAGAGGGTGGAGGG - Intergenic
936514695 2:113174259-113174281 AGGGGTAGGCTGAGGGAGGAGGG - Intronic
936539185 2:113336319-113336341 AAAGGGAGCGACAGGGAGGATGG - Intergenic
936673184 2:114683539-114683561 AGGGAGAGAGAGAGGGAGGAAGG - Intronic
937064432 2:119006514-119006536 AAGGAGACCCAGAGCAAGGATGG + Intergenic
937140042 2:119592132-119592154 AAGAGGAGAAAGAGGGAGGCTGG + Intronic
937470141 2:122167617-122167639 AAGAGCAGCCAGGGGGAGGTGGG - Intergenic
937476653 2:122221245-122221267 AAGGAGAGAGAAAGGGAGGAAGG - Intergenic
937508898 2:122570722-122570744 ATGGGGAGCCAGAAGGGGGATGG + Intergenic
937651664 2:124326131-124326153 AAGTGGAGACAGAGGAGGGAAGG + Intronic
937743712 2:125386501-125386523 ATGGGGAACCAGAAGGGGGAAGG + Intergenic
937793793 2:125993248-125993270 AAGGGGAGCGGGCGGGAGGGGGG - Intergenic
937970463 2:127545391-127545413 GATGGGAGCCTGAGGAAGGAGGG - Intronic
938063023 2:128266961-128266983 AAGGAGAGCCAGGGTGGGGAGGG + Exonic
938089561 2:128422376-128422398 GAGGGGAGCTAGAGAGGGGATGG + Intergenic
938095116 2:128456516-128456538 AAGGGGAGGCAGGGGGATGAGGG - Intergenic
938105353 2:128526312-128526334 CAGGAGAACCAGAGGGAGGGTGG - Intergenic
938381294 2:130837699-130837721 CAGGTGAGCCAGCGGGAGGGCGG + Intronic
938779825 2:134575091-134575113 ATGGGAGGCCAGAGGGAGGAAGG + Intronic
938816006 2:134904772-134904794 AATGTGAGGAAGAGGGAGGAAGG + Intergenic
939223862 2:139339892-139339914 GAGGGGAGAGAGAGAGAGGAGGG + Intergenic
939403693 2:141729113-141729135 AAGGTGAGCCAAAGGGAGCCTGG + Intronic
939451164 2:142376416-142376438 ATGGGGAGCCAAAAGGTGGATGG - Intergenic
939738487 2:145879248-145879270 AATGAAAGCCAAAGGGAGGATGG + Intergenic
939783352 2:146476964-146476986 AAAAGCAGCCAGAGGAAGGAAGG + Intergenic
939870889 2:147524620-147524642 AAGGGTAGCTAGAAGGAGGAAGG + Intergenic
940029334 2:149244313-149244335 AAGGGAAGAAAGAGGGAGGAGGG - Intergenic
940139132 2:150474143-150474165 TAGGGAGGCCAGTGGGAGGAAGG - Intronic
940386471 2:153079185-153079207 ATCAGGAGCTAGAGGGAGGAGGG + Intergenic
940393537 2:153161492-153161514 AAGGGGATCAGGAGGGATGAGGG + Intergenic
940575120 2:155493716-155493738 AAGGAGAGAGAGAGGAAGGAAGG - Intergenic
940629634 2:156221414-156221436 AAGGGAAGCCAGAGAGAAGAAGG + Intergenic
940777330 2:157898402-157898424 AGGGGGAGAGAGAGGAAGGAAGG + Intronic
940925009 2:159355071-159355093 AAGGGGAGCCAAAGGAAAGATGG - Intronic
941010769 2:160297197-160297219 CAGGGGAGAAAGATGGAGGAGGG + Intronic
941284869 2:163598231-163598253 TGGGGGAGGCAGAGTGAGGAAGG - Intronic
941309619 2:163912599-163912621 ATGGGGAGCCAGAAGAGGGATGG - Intergenic
941464971 2:165814663-165814685 AAGGAGAGAAGGAGGGAGGAAGG + Intergenic
941695409 2:168545894-168545916 AAGGGGAGGATGAGGGAGGGCGG + Intronic
941809214 2:169738953-169738975 AAGGGGGAGGAGAGGGAGGAGGG - Intronic
942983174 2:182106525-182106547 ATGGGGAGCCAGAAGTGGGATGG - Intronic
943406128 2:187489175-187489197 AAAGGGAGCGAGAGAGAGAAGGG + Intronic
943453277 2:188072548-188072570 ATGGGGAGCCAGAAAGAGGTTGG - Intergenic
943499254 2:188666190-188666212 AAGGAGAGAGAGAGGGAGGGAGG - Intergenic
943516917 2:188899999-188900021 AAGAGGAGCCAGAGGGAGATCGG - Intergenic
943731381 2:191306689-191306711 AAGGGGGATCAGAGGGAGAAAGG + Intronic
943794321 2:191972535-191972557 AAGGGGACACAGAGGAAGCAGGG + Intronic
943812728 2:192209579-192209601 AAGGGGATCCAGAGAGGAGATGG + Intergenic
943997179 2:194784720-194784742 AAGGAGAGACAAAGGGAGGAAGG + Intergenic
944122252 2:196252546-196252568 AGTGGGAGCCAGAGAGAGCAGGG - Intronic
944142050 2:196467366-196467388 AGGGGGAGGGAGAGGAAGGAGGG + Intronic
944362741 2:198877544-198877566 AGGGGATGCTAGAGGGAGGATGG - Intergenic
944394913 2:199255587-199255609 AAGGGAACCAAGAGGGATGATGG - Intergenic
944962599 2:204892086-204892108 AGGGGGAGCCAGAGGGGACAAGG + Intronic
944969707 2:204978081-204978103 AAAGGCAGCCAGAGGGAAAATGG + Intronic
945245362 2:207712135-207712157 GAGGTGAGCCCGAGGGCGGATGG - Intronic
945942668 2:215965470-215965492 CAGGGGATACAGAGGGAGGAAGG + Intronic
945996717 2:216443257-216443279 TATGGGAGACTGAGGGAGGAGGG + Intronic
946065137 2:216981114-216981136 AAGGGCAGCCAGAGAAAGGTCGG - Intergenic
946153623 2:217792733-217792755 AAAGGGAGCCAGGGGGAGGTGGG - Intergenic
946210469 2:218143535-218143557 ATGGGGAGCCAGAAGGAGGATGG + Intergenic
946276085 2:218632912-218632934 GAAGGGAGGCAGAGGGAGAAGGG + Intronic
946391543 2:219419408-219419430 CAGTGTAGCCAGAGGGAGAAGGG + Intronic
946396131 2:219444600-219444622 AGTTGGAGGCAGAGGGAGGAGGG + Intronic
946428019 2:219609620-219609642 AGGGGGAGCCCTAGGGAGAAGGG + Intronic
946434095 2:219640642-219640664 AAGGGGATCCAGAGGGATCTGGG + Intronic
946482887 2:220073811-220073833 AAGGGGAGGCAGAAGGAAAATGG + Intergenic
946748475 2:222869337-222869359 CAGGGGAGCCAGAGAGATGAAGG - Intronic
946971627 2:225099290-225099312 AAGGAAAGAAAGAGGGAGGAAGG - Intergenic
947029942 2:225782598-225782620 AGGGAGAAACAGAGGGAGGAAGG - Intergenic
947066955 2:226237811-226237833 AGGGGGAGCAGGAGGAAGGATGG + Intergenic
947094622 2:226551718-226551740 AAGCATAGCCAGAGGGAGGCAGG + Intergenic
947159084 2:227193869-227193891 AAGGAGAGAGGGAGGGAGGAAGG + Intronic
947159101 2:227193936-227193958 AAGGAGAGAGGGAGGGAGGAAGG + Intronic
947597889 2:231425516-231425538 AAGGGGAGCCAAAGGGTAGGAGG + Intergenic
947675785 2:231978648-231978670 AATGGGTTCCAGAGTGAGGATGG - Intronic
947736776 2:232459300-232459322 AAGGGGATGCGGAGGGAAGAAGG - Exonic
947749575 2:232525400-232525422 AAGGGGAGCCCGAGGGACCCTGG + Exonic
947998014 2:234544777-234544799 AAGGAGAGAGGGAGGGAGGAAGG + Intergenic
948293942 2:236847267-236847289 AGAGGGAGCCAGAGGGAGGCAGG + Intergenic
948612117 2:239176374-239176396 AAGGCCAGGCAGAGGGAGGGAGG - Intronic
948694257 2:239725271-239725293 CAGGGGAGCCTGAGGAGGGAAGG + Intergenic
948870244 2:240794159-240794181 CAGGGAAGCCTGACGGAGGAAGG - Intronic
948902311 2:240962940-240962962 ATGGGGGGGCAGTGGGAGGAGGG - Intronic
949032212 2:241802549-241802571 AGGCGGGGCCAGAGGGAGGCCGG + Intronic
949049349 2:241888741-241888763 AGGGGGAGCCAGTGAGAGGGAGG - Intergenic
1168842224 20:916854-916876 ACATGGAACCAGAGGGAGGAAGG - Intergenic
1168893998 20:1311317-1311339 AGCAGGAGCCAGAGGGTGGATGG - Intronic
1169137102 20:3203949-3203971 ATGGGGGGAAAGAGGGAGGATGG + Intronic
1169325603 20:4673107-4673129 AGAGGGAGAGAGAGGGAGGAAGG - Intergenic
1169440128 20:5626927-5626949 AAGGGGAGCCAGAAGGGGGATGG - Intergenic
1169525998 20:6426323-6426345 AAGGGGAGGGAGAGAGAGGGAGG - Intergenic
1169841669 20:9944540-9944562 AATGGGAGCAAGAGGGGGGCAGG + Intergenic
1170034311 20:11973852-11973874 AAGAGGAGGAAGAAGGAGGAAGG + Intergenic
1170351652 20:15448004-15448026 AAGGGGAGGCAGAGATGGGATGG - Intronic
1170465751 20:16621141-16621163 ACAGGTAGCCTGAGGGAGGATGG - Intergenic
1170494461 20:16911838-16911860 AAGGGTAGCCAGAGAGAAAAAGG - Intergenic
1170608810 20:17895134-17895156 AAAGGGAGCCAGAGCAGGGAGGG - Intergenic
1170633915 20:18088464-18088486 AAGGAGAGAAGGAGGGAGGAAGG - Intergenic
1170678322 20:18502658-18502680 ACTGGGAGCCAGGGGGATGATGG + Intergenic
1170919853 20:20667748-20667770 AAGGGGAAACAGATGGAGAAAGG + Intronic
1171151431 20:22829501-22829523 GAGGGGAGAGAGCGGGAGGAGGG - Intergenic
1171178985 20:23077589-23077611 GAAGGGAGGGAGAGGGAGGAGGG - Intergenic
1171178993 20:23077607-23077629 GAAGGGAGGGAGAGGGAGGAAGG - Intergenic
1171362729 20:24600466-24600488 AAGGGCAGCGATAAGGAGGAAGG - Intronic
1171442446 20:25176279-25176301 ATGTGGAGCCTGAGGCAGGAGGG - Intergenic
1172408011 20:34703857-34703879 GAGGTGAGCCAGAGGGGGGAGGG + Intronic
1172408752 20:34707263-34707285 AAAGGGGGTCAGAGGGGGGAGGG + Intronic
1172479027 20:35260203-35260225 AGGGGGAGACAGAGGGAGCAGGG - Intronic
1172546517 20:35765994-35766016 GTGGAGAGCCAGAGGAAGGAAGG - Intergenic
1172554886 20:35832236-35832258 AAGGGGATCGAGTGAGAGGAGGG - Intronic
1172804878 20:37604632-37604654 AATGGGAGCCAGAGGAAACAAGG - Intergenic
1172869250 20:38125667-38125689 AAGGAGGGGCAGAGGGTGGAAGG - Intronic
1172884632 20:38222843-38222865 AGGGGGAGCCAGAGGGCAGCAGG - Intronic
1173313060 20:41917655-41917677 AAGGAGAGGCAGAGGGAGAAGGG + Intergenic
1173389955 20:42623063-42623085 ATGGGGAGCTAGAGGGGGAATGG - Intronic
1173733193 20:45342480-45342502 AAGGGGAGGCAGGGAGAGGCTGG - Intronic
1173738288 20:45377405-45377427 GAGCGGAGCCAGAGGCAGGCAGG - Intronic
1174008900 20:47433051-47433073 AGGGGGAGAGAGAGTGAGGAAGG + Intergenic
1174221545 20:48959530-48959552 AAGGAGGGACAGAGGGAGGGAGG - Intronic
1174359331 20:50018040-50018062 AAGGGAAGGAAGAGAGAGGAAGG - Intergenic
1174361459 20:50031416-50031438 AAGGGGAGCAGTAGGGAAGATGG + Intergenic
1174445511 20:50588198-50588220 AAGGAGAGCGTGAGGGAGGCAGG - Intronic
1174532066 20:51222048-51222070 AGAGAGAGCCAGGGGGAGGAGGG + Intergenic
1174763503 20:53229768-53229790 AAGGAGGGAGAGAGGGAGGAGGG + Intronic
1174856529 20:54050705-54050727 AAGGGGAGGCAGAGCGTGGACGG - Intronic
1175024644 20:55888987-55889009 AAGAGGAGCCAAAGGATGGAAGG + Intergenic
1175171378 20:57083884-57083906 CAGAGCAGCCAGAGTGAGGATGG - Intergenic
1175176658 20:57116412-57116434 AAGAGAAGCCAGAGGTTGGATGG - Intergenic
1175605906 20:60312011-60312033 AAGGGGAGGCAGCAGGAGGCAGG + Intergenic
1175657774 20:60786927-60786949 AAGGGGAGGAGGAAGGAGGAGGG - Intergenic
1175723088 20:61299316-61299338 AATGGGTCCCAGAGGGAGCACGG + Intronic
1175790319 20:61736592-61736614 AAGGGGAGAGGGAGGGAGGAAGG + Intronic
1176047346 20:63099753-63099775 GAAGGCAGCCAAAGGGAGGAGGG + Intergenic
1176239173 20:64067995-64068017 AAGGGGAGGCAGAGGAGGGAGGG - Intronic
1176808943 21:13517377-13517399 GAGGGTGGCGAGAGGGAGGAGGG + Intergenic
1177264469 21:18765040-18765062 TGGGGGAGCCAGAAGGAAGATGG - Intergenic
1177294452 21:19156609-19156631 AAGGAGAGACAGAGAGAGAATGG + Intergenic
1177580193 21:23011951-23011973 AAAGAGAGACAGAGAGAGGAGGG + Intergenic
1177708593 21:24740916-24740938 GAGGGGAGAGAAAGGGAGGAGGG - Intergenic
1178043934 21:28673030-28673052 AAGGAGAGAGGGAGGGAGGAAGG + Intergenic
1178072443 21:28983655-28983677 ATGGAGAGCCACAGGAAGGATGG + Intronic
1178100347 21:29261476-29261498 AAGGAGAGAGAGAGGGAGGGAGG + Intronic
1178307590 21:31503416-31503438 AAGAGGAGAAAGAGAGAGGAAGG + Intronic
1178416662 21:32410742-32410764 GAGCTGAGCCCGAGGGAGGAAGG - Intergenic
1178422361 21:32452707-32452729 ATGGGGAGCCAGAAGGGGGATGG + Intronic
1178458837 21:32782244-32782266 AAGAGGGGCCAGAGACAGGAGGG + Intergenic
1178553959 21:33569727-33569749 ACTGGAAGCCTGAGGGAGGATGG + Intronic
1178824598 21:36004898-36004920 AGGGGGAGGCAGGGGGAGGCAGG + Intergenic
1178824631 21:36004965-36004987 AGGGGGAGACAGGGGGAGGCAGG + Intergenic
1179095916 21:38314340-38314362 ATGGGGAGTCAGAAGGGGGATGG - Intergenic
1179162772 21:38911532-38911554 AGGAAAAGCCAGAGGGAGGATGG - Intergenic
1179166765 21:38941402-38941424 AGGCGGAGCCAGAAGCAGGAAGG - Intergenic
1179262055 21:39766019-39766041 AGGGAGAGCATGAGGGAGGAAGG - Intronic
1179440235 21:41388336-41388358 AAAGTGAGCCAGAGGGACCAAGG - Intronic
1179462326 21:41545599-41545621 AAGGAGAGAGAGAGGGAGGGAGG + Intergenic
1179540860 21:42082606-42082628 AGGAGGACACAGAGGGAGGAGGG - Intronic
1179998601 21:44985117-44985139 AAGGGGTGCCTGTGGGAGGCGGG + Intergenic
1180186868 21:46144560-46144582 GGAGGGAGACAGAGGGAGGAGGG - Intronic
1180955163 22:19738221-19738243 AAGGGGAGACTGGAGGAGGAGGG - Intergenic
1181038939 22:20182894-20182916 AAGGGGAGGCAGGGGTGGGAGGG + Intergenic
1181044000 22:20206067-20206089 TGGGGGAGCCAGAGGGGAGATGG + Intergenic
1181408709 22:22703214-22703236 AAGGAAAGGCAGAGGCAGGAGGG - Intergenic
1181413982 22:22746343-22746365 AAGGAAAGGCAGAGGGAGGAGGG - Intronic
1181419628 22:22788866-22788888 AAGGAAAGGCAGAGGGAGAAGGG - Intronic
1181422333 22:22810645-22810667 AAGGAGAGGCAGAGGGAGGAGGG - Intronic
1181513888 22:23400852-23400874 CAGGGCAACCACAGGGAGGAGGG + Intergenic
1181527342 22:23497569-23497591 GAGGGCATCCAGAGGGAGGAGGG - Intergenic
1181819196 22:25462556-25462578 AGGGGGAGGAAGAGGGAGGAAGG - Intergenic
1181960313 22:26617904-26617926 AAAGGGAGACAGAGAGAGGGAGG - Intronic
1181998576 22:26902589-26902611 AAGGAGAGCGAGAGGAAGGAAGG - Intergenic
1182007042 22:26969715-26969737 AAGGAGAGAGAGAGGGAGGGAGG - Intergenic
1182045456 22:27270711-27270733 AAGGGTAACCAGAGAAAGGAGGG + Intergenic
1182079467 22:27518750-27518772 AGTGGTAGCCAGAGGCAGGAGGG - Intergenic
1182292255 22:29289475-29289497 AAGGGCAGGCAGAGGCAGCAGGG - Intronic
1182356565 22:29724854-29724876 GAGGGGAGCCAGGGGAAGGCAGG - Intronic
1182550878 22:31100179-31100201 AAAGGGAGAGAGAGGGAGAAGGG - Intronic
1182550927 22:31100398-31100420 AAGGGAAGACAGATGGAGAAGGG - Intronic
1182931468 22:34178288-34178310 AGGGGGAGGAGGAGGGAGGAGGG - Intergenic
1182935515 22:34218305-34218327 ATGAGGAGTCAGAGGCAGGAGGG - Intergenic
1182962429 22:34488257-34488279 AAGGGGGGAGAGAGGAAGGACGG - Intergenic
1183085378 22:35483693-35483715 GAGGGAAGAAAGAGGGAGGAAGG + Intergenic
1183089747 22:35513764-35513786 AGGGAGAGCCAGAGGGAGAAAGG + Intergenic
1183100101 22:35578645-35578667 AACTGAAGCCAGAGGGATGATGG + Intergenic
1183119562 22:35719905-35719927 ATGGGGAGCCAGAAAGGGGATGG + Intronic
1183158229 22:36092066-36092088 AAAGGGAGCGAGTGGGAGCAAGG + Intergenic
1183197487 22:36363446-36363468 AGGGAGAGACAGAGGGAGGCAGG + Intronic
1183271538 22:36865493-36865515 AAGGAGAGCCACAGGGACGCTGG - Intronic
1183310127 22:37105132-37105154 AAGGGGAGCTGGAGGGAGCCAGG - Intronic
1183321555 22:37167891-37167913 AAGGGGTGCGGGAGGGAGGGAGG + Intronic
1183358034 22:37369827-37369849 AGGGGGGGCCACAGGGAGGGAGG - Exonic
1183411252 22:37655930-37655952 TAGGGGAGCCACCGGAAGGAAGG + Exonic
1183442266 22:37830026-37830048 GAGGGGAGGCAGGGGCAGGAGGG - Intergenic
1183935232 22:41258112-41258134 AAGAGGAGGCAGAGAGTGGAGGG + Intronic
1183950221 22:41348595-41348617 AAGGGGAACAAGAGGGAGAAAGG - Intronic
1183987006 22:41575516-41575538 AAGAGGGGCCTGAGGGCGGAAGG + Exonic
1184018935 22:41807647-41807669 AAGGGGAGAAAGAGGAAGGGTGG + Intronic
1184226192 22:43130052-43130074 AAGGGGCACCAGGGGCAGGAGGG + Intergenic
1184239346 22:43203770-43203792 GAAGGGAGGCAGAGGGAGGGAGG + Exonic
1184298243 22:43539851-43539873 AAAGGGAGCGAGAGGCAGGGCGG - Intronic
1184537112 22:45094696-45094718 AGGGGGGGGAAGAGGGAGGAAGG - Intergenic
1184542050 22:45132610-45132632 AAAGGAGGCCAGAGGGAAGAAGG + Intergenic
1184730102 22:46367111-46367133 AAGGGGCCCTGGAGGGAGGAAGG + Exonic
1184934172 22:47706934-47706956 ATGGGGAGCCAGAAGGGAGATGG + Intergenic
1184992537 22:48180487-48180509 CATGGCAGCCCGAGGGAGGAGGG - Intergenic
1185001443 22:48248941-48248963 AGGGAGAGACGGAGGGAGGAAGG - Intergenic
1185014052 22:48333257-48333279 AAGGGGAAGCAGAGTGAGGCTGG - Intergenic
1185135796 22:49071415-49071437 AGGGAGGGACAGAGGGAGGAAGG - Intergenic
1185144441 22:49123351-49123373 ATGGGCAGCCAGATGGAGGCTGG - Intergenic
1185258742 22:49850043-49850065 AAGGGAAACCACAGGCAGGAGGG - Intergenic
1185320981 22:50200237-50200259 AAGGGAAACCACAGGCAGGAGGG + Intergenic
949571016 3:5293286-5293308 GATTGGAGCCTGAGGGAGGATGG + Intergenic
949617521 3:5770319-5770341 GATGGGAGCCAGAAGGGGGATGG + Intergenic
949808031 3:7976732-7976754 ATGTGGAGCCAGAAGGGGGATGG - Intergenic
949956102 3:9269878-9269900 AGGGAGGGACAGAGGGAGGAAGG + Intronic
950106795 3:10393634-10393656 AAGGGGGGCCAGAGCGTGGTGGG + Intronic
950108304 3:10402293-10402315 AAGGAGAGGCAGAGGCAGGTTGG - Exonic
950114379 3:10441155-10441177 CAGTGTAGCCAGGGGGAGGAAGG - Intronic
950235927 3:11320164-11320186 AAGGGGAGGTAGGGGGAGGGAGG - Intronic
950489656 3:13296066-13296088 AATGGTAGCCTGAGGTAGGAAGG + Intergenic
950674984 3:14549372-14549394 AGGGGGAGCCATAGGGAGGCAGG - Intergenic
951033002 3:17903756-17903778 AAGGAGAGAGGGAGGGAGGAAGG - Intronic
951149964 3:19277197-19277219 AAGGGGAGGCAGGGGGATGAAGG + Intronic
952623583 3:35376292-35376314 AAGGAGGGCCGGAGGGAGGGAGG + Intergenic
953357462 3:42266747-42266769 AAGGAGAGACGGAGGGAGGGAGG - Intergenic
953431493 3:42844250-42844272 GAGGTGAGGCAGAGGAAGGAAGG + Intronic
953434336 3:42866563-42866585 GAGGAGAGCAAGAGAGAGGAAGG - Exonic
953472297 3:43177627-43177649 CAGGGGAGTCAGAGGGGGGGGGG - Intergenic
954390739 3:50266893-50266915 AAGAGAAGCCAGAGGAAGGGAGG + Intergenic
954432945 3:50480907-50480929 AAGGGGAGGAAGGGGGAGGAAGG + Intronic
954432950 3:50480917-50480939 AGGGGGAGGAAGGGGGAGGAAGG + Intronic
954432956 3:50480927-50480949 AGGGGGAGGAAGGGGGAGGAGGG + Intronic
954453168 3:50582631-50582653 GAGGGCAGACACAGGGAGGAAGG + Exonic
954794225 3:53153345-53153367 GTGGGGAGGCAGAGGGAGGAAGG + Intergenic
955228784 3:57081153-57081175 AAGGGGAGAAAGAGGCTGGAGGG + Intergenic
955458235 3:59149339-59149361 CAGGAGACCCAGAAGGAGGATGG - Intergenic
955499567 3:59570512-59570534 ATGAGGAGCGTGAGGGAGGAGGG - Intergenic
955703123 3:61701913-61701935 AAGAGGAAGGAGAGGGAGGAAGG + Intronic
955770236 3:62378156-62378178 AAGGAGAGCTGGAGGGAAGAAGG - Intergenic
955778821 3:62462336-62462358 GAGAGGAGCTGGAGGGAGGAGGG - Intronic
955874539 3:63476050-63476072 AAGGAGAGAGAGAGGAAGGAAGG + Intronic
955901853 3:63764383-63764405 GAGGAGAGAGAGAGGGAGGAAGG + Intergenic
955901857 3:63764402-63764424 AAGGAGAGAGAGAGGGAGGAAGG + Intergenic
955901861 3:63764421-63764443 AAGGAGAGAGAGAGGGAGGAAGG + Intergenic
955901865 3:63764440-63764462 AAGGAGAGAGAGAGGGAGGAAGG + Intergenic
955901871 3:63764474-63764496 AAGGAGAGAGAGAGGGAGGAAGG + Intergenic
956121230 3:65967833-65967855 AAGGGAAGGAAGAGTGAGGAAGG + Intronic
956121293 3:65968621-65968643 AAGGCGAGCAAGAGAAAGGAGGG + Intronic
956147836 3:66210112-66210134 AAAGGGAGAAGGAGGGAGGAAGG - Intronic
956181141 3:66519145-66519167 ATGGGGAGCCAGAAGGGGGATGG + Intergenic
956390830 3:68771106-68771128 ATGGGGAGTCAGAAGGGGGATGG - Intronic
956563876 3:70614310-70614332 AGAGGGAGCCAGAGAGAGGAAGG + Intergenic
956659695 3:71584620-71584642 GAGGAGAGACCGAGGGAGGACGG - Intergenic
956689282 3:71861105-71861127 ATGGGGAGCCTGAAGGGGGATGG - Intergenic
956735276 3:72233254-72233276 ATGGGGAGCCAGAAAGGGGATGG + Intergenic
956750825 3:72342571-72342593 AAGGGAAGCAAGAGGTTGGAGGG - Intergenic
956932781 3:74064402-74064424 GAGGGGAGACAGAGAAAGGAGGG + Intergenic
956972051 3:74537640-74537662 TAGGGAAGGCAGAGGAAGGATGG + Intergenic
957029275 3:75221396-75221418 GACGGGAGCCAGAAGGGGGATGG + Intergenic
957058050 3:75459313-75459335 TGGGGGAGCCAGAAGGAAGATGG + Intergenic
957099114 3:75806513-75806535 AGGGGGAGACAGAGGGATTATGG - Intergenic
957133720 3:76256910-76256932 AAGGGGAGCAAGAGAGAGAGTGG + Intronic
957167991 3:76699803-76699825 AAGAGGAAACAGGGGGAGGAAGG - Intronic
957272618 3:78051345-78051367 GTGGGGAGGCAGAGGCAGGAGGG - Intergenic
957467073 3:80608069-80608091 AAGGGGAGTGGGAGGGAGGAGGG + Intergenic
957543206 3:81603020-81603042 TAGAGGAGCCATAGGGAGTAAGG - Intronic
958001956 3:87761837-87761859 ATGGGGAGCCAGAAGGGGGATGG + Intergenic
958074500 3:88658239-88658261 ATGGGGAGCCAGAAGGCGGATGG + Intergenic
958878082 3:99638357-99638379 AAAGGGAGAGAGAGGGAGAAGGG - Intergenic
958933728 3:100235230-100235252 AAGGGGAGACTGAGGCAGTAAGG + Intergenic
959269733 3:104192337-104192359 AGGGGGAGCCAGAAGGGAGATGG + Intergenic
959445630 3:106435578-106435600 AGGGGGAGAGAGAGGGAGGGAGG + Intergenic
960023949 3:112987816-112987838 TAGGGGAGCCAGAAGGGAGATGG + Intergenic
960188810 3:114677844-114677866 AAGAGTAGGCAGAGAGAGGAAGG - Intronic
960501609 3:118445051-118445073 ATGGGGAGCCAGAAGGGGGATGG + Intergenic
960557661 3:119046729-119046751 AAGGGCAGCCAGAGAGAGAAAGG + Intronic
960656095 3:120005512-120005534 AAGGGCAGCCAGAGAAAGGTTGG + Intronic
960959535 3:123060273-123060295 AAGGAGAGAGGGAGGGAGGAAGG - Intergenic
961013390 3:123449789-123449811 GCGGGGAGGCAGCGGGAGGAGGG - Intergenic
961214268 3:125147552-125147574 GAGGGGATCCGGAGGGAGGAGGG - Intronic
961295403 3:125880402-125880424 TGGGGGAGCCAGAAGGAAGATGG - Intergenic
961347723 3:126274882-126274904 GAGGGAAGAAAGAGGGAGGAAGG - Intergenic
961445362 3:126978122-126978144 ACGGGAAGTCAGAGGGAGGAGGG + Intergenic
961465171 3:127076997-127077019 AAGGGACTCCAGAGGAAGGATGG + Intergenic
961546649 3:127639013-127639035 AAGGGGAGACAGATGGAGACAGG - Intronic
961880221 3:130056495-130056517 ATGGGGAGCCAGAAGGGGGATGG - Intergenic
961917321 3:130390713-130390735 ACCTGGAGCCAGAGGGAGTAGGG + Intronic
961940938 3:130636896-130636918 GAGGGGAGGAAGGGGGAGGAAGG - Intronic
962072193 3:132044659-132044681 AAGGGGAGGGAGGGGGAGGGAGG + Intronic
962072339 3:132044940-132044962 AAGGGGAGGGGGAGGGGGGAGGG + Intronic
962222202 3:133573618-133573640 GAGGGGAGGGAGAGGGAGGAGGG - Intergenic
962311169 3:134327781-134327803 CAGGGGAGCCTGACAGAGGAAGG + Intergenic
962604648 3:137023458-137023480 AAGGGCTCCCAGAGGGAGCATGG + Intergenic
962957357 3:140278489-140278511 AAAGGAGGCCAGAAGGAGGAGGG - Intronic
963009863 3:140759111-140759133 AAGGGGCACCGGAGGGAGGGAGG - Intergenic
963561283 3:146869149-146869171 AAGGGGAGAGAGAGGGAGCAGGG - Intergenic
963641059 3:147862318-147862340 AAGGGGTCCCAGATGGAGGAGGG + Intergenic
963994590 3:151693203-151693225 AATGGTAACCAGAAGGAGGAAGG - Intergenic
964119196 3:153164036-153164058 AAGGGGAGTCTGGGGGAGAATGG + Exonic
964590533 3:158358789-158358811 AAACGGAGACAGAGGGAGAATGG - Intronic
964669466 3:159209345-159209367 AAGGGGAGCCGGAAGGGGGATGG - Intronic
964762465 3:160147193-160147215 AAGGGGAGACAGAGGGAGGGAGG - Intergenic
965185275 3:165454898-165454920 ACTGGGAGCCAGAAGGGGGATGG + Intergenic
965631873 3:170741242-170741264 AGGAGGAGAGAGAGGGAGGAGGG + Intronic
966060541 3:175749208-175749230 AAGGGGAGGGAGAGGGGGTAGGG + Intronic
966080761 3:175997211-175997233 AAGGGCAGCCAGAGAGAGAGGGG + Intergenic
966140728 3:176752746-176752768 AAGGAGAGAGAGAGGGAGGAAGG + Intergenic
966321604 3:178707078-178707100 AAGTGGAGACAGAAGGAGAAAGG + Intronic
966343189 3:178948254-178948276 AAGTGAAGCCTTAGGGAGGAAGG - Intergenic
966568641 3:181413423-181413445 AAGGGCAAGCAGAGGAAGGAAGG + Intergenic
966774660 3:183533379-183533401 CTGGGGAGCCTGAGGGAAGAGGG - Intronic
967210199 3:187161764-187161786 TAGGGGAAGCAGAGGTAGGAAGG - Intronic
967811627 3:193765759-193765781 AGGGGCAGCCACAGTGAGGAGGG + Intergenic
967853689 3:194100761-194100783 AAAAGGAGAGAGAGGGAGGAAGG + Intergenic
968471190 4:783162-783184 AATGGGAGGCTGGGGGAGGATGG + Intergenic
968628185 4:1637427-1637449 AGAGGGAGCCTGGGGGAGGATGG + Intronic
968695053 4:2020339-2020361 AAAGGGAGAGGGAGGGAGGAAGG - Intronic
968908299 4:3464385-3464407 AAGGGGAGGCGGAGGCAGGCAGG - Intronic
968992610 4:3924850-3924872 ATGGGGAGCCAGAAGGGGGATGG - Intergenic
969115515 4:4868521-4868543 GAGGGGACCCAGGGGGAGAAAGG - Intergenic
969185360 4:5470407-5470429 ATGGGGAGCCACAGAGAGCATGG + Intronic
969186587 4:5479021-5479043 AAGCGGATCCAGGGGGAGGCAGG + Intronic
969393438 4:6906138-6906160 AAGGGGATTGGGAGGGAGGATGG + Intergenic
969464624 4:7349000-7349022 TATGGAAGCCAGAGGGGGGAAGG - Intronic
969495318 4:7523048-7523070 AAGGGGAGAGAAGGGGAGGAAGG - Intronic
969495330 4:7523089-7523111 GGGAGGAGGCAGAGGGAGGAGGG - Intronic
969511786 4:7622206-7622228 ACAGGGAGCAAGAAGGAGGAGGG + Intronic
969607837 4:8211302-8211324 AGGGGGAGAAGGAGGGAGGAGGG - Intronic
969674856 4:8608830-8608852 AAGGGGAGCCCCAGGGAGCCGGG + Intronic
969719412 4:8885104-8885126 AAGAGGGGCCACAGGGAGAAGGG - Intergenic
969822741 4:9732772-9732794 ATGGGGAGCCAGAAGGGGGATGG + Intergenic
970234437 4:13944477-13944499 ATGGGGAGCCAGAAGGGAGATGG - Intergenic
970273164 4:14368493-14368515 ATGGAGAGCCAGAAGGGGGATGG + Intergenic
970640078 4:18054271-18054293 CAAGGCAGCCAGTGGGAGGAAGG - Intergenic
970985692 4:22154454-22154476 AAGGGTAGCTAGAGGGTGCAAGG + Intergenic
971005476 4:22370002-22370024 AAGGGGAGCCAAAAAGGGGATGG - Intronic
971393714 4:26209662-26209684 AGGGGGAGACGGAAGGAGGAAGG - Intronic
971483400 4:27134541-27134563 AAGGAGAGGCAGAGAGAGAAAGG + Intergenic
972281464 4:37605956-37605978 AAGGAGAGAGGGAGGGAGGAAGG + Intronic
972390251 4:38607010-38607032 ATGGGGAGTCAGAAGGGGGATGG + Intergenic
972425902 4:38932602-38932624 CAGGGGAGACTGAGGCAGGAGGG - Intronic
972446615 4:39150415-39150437 CAGGGGATGGAGAGGGAGGAAGG + Intergenic
972565522 4:40265676-40265698 GAGGGAAGGGAGAGGGAGGAGGG + Intergenic
973331046 4:48910394-48910416 GAGGGGAGAGAGAGGAAGGAAGG - Intergenic
973336245 4:48959389-48959411 GAGGAGAGCCAGAGGGAGAAGGG + Intergenic
973565848 4:52186646-52186668 AAGGGGTGCAAGAGTGAGGAAGG - Intergenic
973787005 4:54341739-54341761 ACGGGGATCCATAGGGAGGGCGG + Intergenic
974660251 4:64879174-64879196 AAGGAGAGATAGAGGGAGGAGGG - Intergenic
974774025 4:66457021-66457043 GAGGAGAGCAAGAGGAAGGAGGG + Intergenic
975462357 4:74669167-74669189 AAGGGGAGCAAAGGGGAGAAAGG + Intergenic
975536922 4:75460707-75460729 AAGTGGAGAGGGAGGGAGGAAGG + Intergenic
975660323 4:76682023-76682045 AAGGAGAGCCAGAGGGAAAGTGG - Intronic
975933365 4:79553856-79553878 AGGGAGGGACAGAGGGAGGAAGG - Intergenic
976126079 4:81835053-81835075 AAGGAGGAACAGAGGGAGGAAGG + Intronic
976158327 4:82172002-82172024 AACTGGAGACAGAGGAAGGAAGG + Intergenic
976547423 4:86353041-86353063 AAGGATAGCCAGAGGAAGGGAGG - Intronic
976695819 4:87918775-87918797 AAGGGGAGGGAAAGGGAGGGAGG + Intergenic
977292924 4:95182516-95182538 GAGGAGAGACAGATGGAGGATGG + Intronic
977306295 4:95327773-95327795 AAGGGGAGCTGGAAGGAGGATGG - Intronic
977307955 4:95348970-95348992 AAGGGTAGTGAGAGGGAGGGCGG + Intronic
977756949 4:100682782-100682804 CAGGGGAGCCAGAAGGGAGATGG - Intronic
977919221 4:102625194-102625216 AAAGGGAGAAAGAGGAAGGAGGG - Intergenic
978072429 4:104490681-104490703 AAGGGGAGAGGGAGTGAGGAGGG + Intronic
978414784 4:108463778-108463800 ATGGGGAGCCAGAAGGGGTATGG - Intergenic
978543068 4:109839603-109839625 AAGGGTAGAGGGAGGGAGGAGGG - Intronic
978667337 4:111200029-111200051 AAAGGGAGCCAGAGAGAGTGGGG - Intergenic
979681590 4:123466165-123466187 AAGGGGAGACAGTGGAAGAAAGG + Intergenic
979853234 4:125599605-125599627 GAGGGGAGAAAAAGGGAGGACGG - Intergenic
981423800 4:144581083-144581105 ATGGGGAGCCAAAAGGGGGATGG - Intergenic
981439195 4:144763258-144763280 AAGAGTAGAGAGAGGGAGGACGG + Intergenic
981582207 4:146261192-146261214 AAGGGGCCCCAGAGGAAGGCTGG + Intronic
981634023 4:146854560-146854582 AAAGGGAGTAAGAGTGAGGACGG - Intronic
981705442 4:147654635-147654657 ATGGGGGGCTAGATGGAGGATGG - Intronic
981808675 4:148747853-148747875 AAGGGGAACAACAGAGAGGATGG - Intergenic
982004235 4:151049249-151049271 TAGGAGAGCCAGAAGGAAGATGG + Intergenic
982277934 4:153656013-153656035 AAGGGGTGGCAGAGGGAGGATGG - Intergenic
982370442 4:154627424-154627446 CAGGGGAGGGAGACGGAGGAAGG - Intronic
982504175 4:156197018-156197040 ATGGGGAGCCAGAAGAAGCATGG - Intergenic
982869145 4:160553752-160553774 AAGGGGAGCTAGAAGGCAGATGG + Intergenic
983166418 4:164482345-164482367 ACAGGGAGTCAGAGGGAGGGTGG + Intergenic
983344952 4:166516394-166516416 ACGGGCAACTAGAGGGAGGAAGG + Intergenic
983527835 4:168778245-168778267 ACTGGGAGACAGTGGGAGGATGG + Intronic
983691044 4:170469578-170469600 AAGGAGAGAGGGAGGGAGGAAGG - Intergenic
983932293 4:173465768-173465790 AGGGGGAAGCGGAGGGAGGAAGG - Intergenic
984245934 4:177275333-177275355 AAGGGGAGCTGGAAGGGGGATGG - Intergenic
984703495 4:182833193-182833215 GAGGGGAGAGAGAAGGAGGAGGG - Intergenic
984864787 4:184272195-184272217 GAGGGAAGCCAGAGGGTTGAGGG - Intergenic
984885179 4:184443358-184443380 AAGGGGAGAGAGAGGAAGTAGGG - Intronic
984886485 4:184454572-184454594 AATGGTAGCCAGAGGTGGGAGGG + Intronic
985099711 4:186446743-186446765 AAAGGGAGAGAGAGGGAGGGAGG - Intronic
985219230 4:187685223-187685245 AAGGAGAGAGGGAGGGAGGAAGG - Intergenic
985445784 4:190020763-190020785 AAGGAGAGAAAGAGGGAGGGAGG - Intergenic
985487301 5:158679-158701 CAGGACAGGCAGAGGGAGGAAGG - Intronic
985755419 5:1711414-1711436 AAGGGCAGCCAGAGAAAGGTCGG + Intergenic
985781603 5:1874516-1874538 ATGGGGAGAGAGAGGGAGGCCGG + Intergenic
985944911 5:3173110-3173132 AAAGGGAGCAAGAGGGATGAGGG - Intergenic
986014812 5:3748564-3748586 CAGGGGAGAGAGAGGGAGGGCGG - Intergenic
986165274 5:5267444-5267466 ATGGGGAGCCAGAAAGGGGATGG + Intronic
987005705 5:13707253-13707275 ATGGGGAGCCAGAAGGGGGATGG - Intronic
987025910 5:13926188-13926210 AAGGAGCACCTGAGGGAGGATGG + Intronic
987149095 5:15020849-15020871 AAGGAGAAGCAGAGAGAGGAGGG + Intergenic
987212137 5:15693838-15693860 ATGGGGAGCCAGAAGGGGGATGG - Intronic
987602931 5:20095476-20095498 AAGGAGAGAGAGAGGGAGGGAGG + Intronic
987824582 5:23012581-23012603 AAGGAGAGAGAAAGGGAGGAAGG - Intergenic
987995419 5:25270879-25270901 AAAGGAAGCAAGAGAGAGGAGGG - Intergenic
988101101 5:26680005-26680027 AAGAGGAGAAAGAGGGAGGGAGG - Intergenic
988205339 5:28126516-28126538 ATGGAGAGCCAGAAGGGGGATGG - Intergenic
988267230 5:28967709-28967731 TTGGGGAGCCAGAGGGGAGATGG - Intergenic
988329372 5:29815178-29815200 AAGGAGAGAGGGAGGGAGGAAGG + Intergenic
988457621 5:31400641-31400663 ATGGGGAGCAGGAAGGAGGAGGG - Exonic
988773073 5:34450999-34451021 AAGGAGAGAGAGAGGGAGGGAGG - Intergenic
989043188 5:37249542-37249564 GAGGGGAGCGCGCGGGAGGAGGG - Intergenic
989261568 5:39424764-39424786 AAATGGAGCCAGAGGGAAGAAGG + Intronic
990205981 5:53430176-53430198 ATGAGGGGCCAGAGGCAGGAGGG - Intergenic
990317858 5:54601077-54601099 ATGGACAGACAGAGGGAGGACGG - Intergenic
990364619 5:55057721-55057743 AGTGGGAGACAGAGGGTGGACGG + Intergenic
990535309 5:56715877-56715899 AAGAGGAGAGAAAGGGAGGAAGG + Intergenic
990754574 5:59054875-59054897 AAAGGGAGGAAGAGGGAAGAGGG - Intronic
990868927 5:60409944-60409966 GAGGAGAGCCCGAGGGATGAAGG + Intronic
990976801 5:61568006-61568028 AAGGGGGGAGGGAGGGAGGAAGG - Intergenic
991180247 5:63742645-63742667 ATGTGCAGCAAGAGGGAGGATGG - Intergenic
991483001 5:67103509-67103531 GAGGGGAGGAGGAGGGAGGAAGG + Intronic
991715470 5:69447324-69447346 AAGGAGAGAAAGAGAGAGGAAGG + Intergenic
992002851 5:72452249-72452271 AAAGGGAGAGAGAGGGAGGGAGG + Intronic
992672752 5:79076138-79076160 ATGGGGAGCCAGAAGGGGGATGG + Intronic
992904619 5:81334108-81334130 ATGGGGAGCCAGAAGGAGGATGG - Intronic
993188104 5:84645940-84645962 ATGGGGAGCCAGAAGAGGGATGG - Intergenic
993375063 5:87141090-87141112 AGGGGGAGAGGGAGGGAGGAAGG + Intergenic
993564029 5:89450405-89450427 GTGGGGAGCTAGAGGGATGAGGG + Intergenic
993875821 5:93305505-93305527 AAGGAGAAAAAGAGGGAGGAAGG + Intergenic
994084579 5:95744033-95744055 AAGGAGAGAGGGAGGGAGGAAGG - Intronic
994088773 5:95789689-95789711 AAGGAGAGAGAGAGGGAGTAAGG + Intronic
994193314 5:96893611-96893633 AGGGAGGGCCAGAGGGAGCATGG - Intronic
994346042 5:98687467-98687489 AAAGGGAAGCAGAAGGAGGAAGG + Intergenic
994956878 5:106544353-106544375 TGGGAGATCCAGAGGGAGGACGG - Intergenic
995331270 5:110949658-110949680 AAGGGAGGGCAGAGGGAGAATGG - Intergenic
995441329 5:112195620-112195642 AAGGACAGTCAGAGGGAAGAAGG - Intronic
995533644 5:113114787-113114809 AAGGGGAGCTAGAAGGGGGATGG - Intronic
996215056 5:120856195-120856217 TAGGGAAGCCAGAAGGGGGATGG - Intergenic
996557138 5:124790067-124790089 GAAGGGAGCCAGAGGGTGGACGG - Intergenic
996646713 5:125826395-125826417 AAGTGGATCCAGAAGGAGAATGG - Intergenic
996797463 5:127364842-127364864 AATGGGAGTGAGAGGGAGTAGGG - Intronic
997195253 5:131974911-131974933 CATGTGAGCCAGAGGCAGGAAGG + Exonic
997338822 5:133126673-133126695 AGGGGGAGAGAGTGGGAGGAGGG + Intergenic
997437435 5:133885467-133885489 AAGAGGAGGCAGAGAAAGGAGGG + Intergenic
997457372 5:134027268-134027290 ATGGGGCGGGAGAGGGAGGAGGG - Intergenic
997521625 5:134527201-134527223 GAAGGGAGGGAGAGGGAGGAAGG - Intronic
997791442 5:136766002-136766024 AAGGGGAGGAAGCAGGAGGATGG - Intergenic
997952773 5:138255012-138255034 AAGGAGAGAGAGAGGAAGGAAGG + Intronic
998192741 5:140041761-140041783 AACTGGAGCCACATGGAGGACGG + Intronic
998394134 5:141807156-141807178 ATAGGGAGAGAGAGGGAGGAAGG + Intergenic
998449171 5:142220989-142221011 GTGGGGAGCCAGAGGGAGAGGGG + Intergenic
998734672 5:145122975-145122997 AAGGAGAGAGAGAGGGAAGAAGG - Intergenic
999296533 5:150462947-150462969 GAGGAGAACCAGAGGGAGAAGGG + Intergenic
999924549 5:156360765-156360787 AAGGGGAGCTGGAGAGGGGATGG - Intronic
1000251188 5:159497331-159497353 AAGGGGAAGCAGAGGGAGGAGGG + Intergenic
1000470202 5:161631079-161631101 ATGGGGGGCCAGAAGGGGGATGG + Intronic
1000508106 5:162147338-162147360 AAAGAGAGACAGAGGAAGGAAGG - Intronic
1000516443 5:162241228-162241250 ATGGGGAGCCAGAAGCCGGATGG + Intergenic
1000658892 5:163915412-163915434 ATGGGGAGCCAGAAGGGGGATGG + Intergenic
1000684355 5:164228721-164228743 GAGGGGAGCTAGAGAGGGGATGG - Intergenic
1001029871 5:168254459-168254481 AAGGGGAGGAAGAGGAAGAAGGG + Intronic
1001029881 5:168254501-168254523 AAGGGGAGGAAGAGGAAGAAAGG + Intronic
1001159281 5:169300029-169300051 AAGGGCAGCCAGAGAGCGGCTGG + Intronic
1001181151 5:169521886-169521908 TAGGGGAGCCAGAAGGGAGATGG - Intergenic
1001246384 5:170108281-170108303 AAGGGGCGCCTGATGGGGGAGGG - Exonic
1001408708 5:171495295-171495317 AAGGAGGGACAGAGGGAGGGAGG + Intergenic
1001429051 5:171645262-171645284 ACGTGGAGCCACAGGGAGGGAGG - Intergenic
1001441877 5:171749783-171749805 AAGGGGAGTCACAGGGACTAAGG - Intergenic
1001442059 5:171750743-171750765 AAGGGGAACCAGAGGGGGTAGGG - Intergenic
1001445542 5:171779852-171779874 AAGGAGAGAGAGAGGGAGAAGGG + Intergenic
1001511071 5:172322374-172322396 AAGGAGAGAGATAGGGAGGAAGG - Intergenic
1001525658 5:172426806-172426828 AAGCAGAGCCAGAGGGAGAGAGG + Intronic
1001569920 5:172723874-172723896 AAGGAGAGAAAGAGGGAGGAAGG + Intergenic
1001960083 5:175874716-175874738 GAGGGGAGGCAGAGAGAGGGAGG + Intronic
1001968820 5:175937398-175937420 AGGAGGAGCCAGAGATAGGATGG + Intronic
1002132862 5:177092100-177092122 ATGGGGAGCCAGGTGGTGGAGGG + Intronic
1002140007 5:177132788-177132810 AAGGGGAGGGAGAGGGATGGGGG + Intergenic
1002248625 5:177906345-177906367 AGGAGGAGCCAGAGATAGGATGG - Intergenic
1002426697 5:179180943-179180965 CAGGGGAGCCAGGGAGAGGCAGG + Intronic
1002434990 5:179225740-179225762 GGGGGAAGCCAGAAGGAGGATGG - Intronic
1002475712 5:179464583-179464605 ATGGGGAGCCAGAAGGGGAATGG + Intergenic
1002705625 5:181159681-181159703 AAGGGCAGCAGGAGGGAGGCTGG - Intergenic
1002762648 6:214046-214068 ATGGGGAGCTGGAAGGAGGAGGG - Intergenic
1002851742 6:1003081-1003103 AAAGGGAGAGAGAGGGAGGTGGG - Intergenic
1002910081 6:1483414-1483436 AAGGAGAGAGAGAGGGAGGGAGG + Intergenic
1003004267 6:2366418-2366440 AAGGGAAGAAAGAGGAAGGAAGG + Intergenic
1003016031 6:2468213-2468235 GAGGGTAGACAGAGAGAGGAAGG + Intergenic
1003146896 6:3516903-3516925 ACGGGGAGCCAGGGAGATGACGG - Intergenic
1003153134 6:3569912-3569934 GAGGGGAGAGGGAGGGAGGATGG - Intergenic
1003837128 6:10083857-10083879 AGGGAGAGACGGAGGGAGGAAGG + Intronic
1003867984 6:10381056-10381078 GAAGGGAGGCAGAGGAAGGAAGG - Intergenic
1003890069 6:10556143-10556165 ACGGGGAGGCAGAGGGAGGAGGG + Intronic
1003934421 6:10960665-10960687 AAGGGGAGCAAGTGGAAGGTAGG + Intronic
1004139286 6:13000638-13000660 AAGGGGGGAGGGAGGGAGGAAGG + Intronic
1004428373 6:15522147-15522169 AAGGGGACCCAGTGGCAGGTGGG - Intergenic
1004725633 6:18308847-18308869 AAGGAGAGAGAGAGGAAGGAAGG - Intergenic
1004725648 6:18308917-18308939 AAGGGAAGAGAGAGAGAGGAAGG - Intergenic
1005224018 6:23620247-23620269 AGGGAGAGACAGAGGGAGGGAGG + Intergenic
1005363373 6:25053672-25053694 AAGGGGAGCCAAAGAGGGGATGG + Intergenic
1005665107 6:28044452-28044474 AAGGGGGGAGGGAGGGAGGAAGG + Intergenic
1005805573 6:29471424-29471446 ATGGGCAGGAAGAGGGAGGAGGG + Intergenic
1006096225 6:31658502-31658524 CATGGGAGCCAGAGGGAGTGGGG - Exonic
1006180633 6:32151643-32151665 AGGGGGAGACAGAAAGAGGAGGG + Intronic
1006341282 6:33448546-33448568 GAGGGAGGCCAGAGGGAGGCTGG - Intronic
1006384677 6:33723773-33723795 GAGGGGAGCCTGGTGGAGGAGGG + Intronic
1006385564 6:33728887-33728909 AAGGGCAGACAGACGGGGGAGGG - Intronic
1006928646 6:37673920-37673942 ACAGGGAGCGAGAGGGAGGATGG - Intronic
1006970851 6:38043503-38043525 AAGGAGAGAGGGAGGGAGGAAGG - Intronic
1006985060 6:38170453-38170475 GAGGCGAGGCGGAGGGAGGAGGG - Exonic
1007046753 6:38783529-38783551 AAGGAGAGACACAGGAAGGAAGG - Intronic
1007063981 6:38970481-38970503 AATGAGAGCCTGAAGGAGGATGG - Intronic
1007117543 6:39354192-39354214 AAGGGCAGCCTGAGACAGGAGGG - Intronic
1007253305 6:40511062-40511084 AAAGGGAGCCTGGGGCAGGAGGG + Intronic
1007292744 6:40799585-40799607 AAGGGAAGAGGGAGGGAGGAAGG - Intergenic
1007485706 6:42179207-42179229 AAAGGGAATCAGGGGGAGGAGGG - Intronic
1007615808 6:43179371-43179393 AAGGGGAGGCTGAGGGAGGACGG - Exonic
1007708538 6:43806411-43806433 GAGAGGAGTCAGAGGGAGGAAGG + Intergenic
1007745579 6:44041108-44041130 AAGGAGAGCAAGAAGGAGGGAGG + Intergenic
1007899831 6:45400239-45400261 GAGGGGAGACAGAGGGAGGAAGG + Intronic
1007989905 6:46244304-46244326 AAGGAAAGAAAGAGGGAGGAAGG - Intronic
1008265143 6:49415691-49415713 AAGGAGAGAGAGAGGGAGGGAGG + Intergenic
1008427750 6:51379381-51379403 AAGGGGAGAGGGAGGGAGGGAGG + Intergenic
1008475515 6:51931818-51931840 AGGGGGAGAGAGAGAGAGGAGGG + Intronic
1008475532 6:51931886-51931908 AAGGGGAGAGAGAGAGAGGAGGG + Intronic
1008627843 6:53335332-53335354 CAGGGAAGCCAGAGGGAGACAGG - Intronic
1008832980 6:55791741-55791763 ACGTGGAGCAAGAGGGAAGATGG + Intronic
1008863233 6:56176903-56176925 AAGGGGAGGAAGGGGGAGGAAGG + Intronic
1008921740 6:56850117-56850139 AAGGGGAGGTGGAGGGAGGATGG - Intronic
1009185445 6:60569027-60569049 ATTGGGAGGCAGAGGAAGGAGGG + Intergenic
1009804003 6:68578760-68578782 AAGGGGAGGGAAGGGGAGGAGGG + Intergenic
1009872696 6:69470205-69470227 AAGGGGAGATATAGGGAGGCTGG - Intergenic
1009943268 6:70314502-70314524 AAGTGGAGCCAAAGGGAGACAGG + Intergenic
1009948359 6:70366066-70366088 AAGGAGGGATAGAGGGAGGAAGG + Intergenic
1010028374 6:71245743-71245765 ATGGGGAGCCAGAAGGAGGATGG + Intergenic
1010042073 6:71396768-71396790 AGGGGTAGGAAGAGGGAGGAGGG - Intergenic
1010332112 6:74635350-74635372 AAGGTGAGAAAGAGTGAGGAAGG - Intergenic
1010467327 6:76183963-76183985 GAGGGAAGACAGTGGGAGGAGGG - Intergenic
1010628467 6:78168273-78168295 ATGGGGAACCAGAAGGGGGATGG + Intergenic
1011069933 6:83369638-83369660 AAAGAGAGACAGAGAGAGGAAGG + Intronic
1011227723 6:85126519-85126541 AGGGGGAGCCAGCAGGAGCAAGG - Intergenic
1011268197 6:85548082-85548104 AGGGGGGGCTGGAGGGAGGAAGG + Intronic
1011639594 6:89406587-89406609 TAGGGGAGCCAGAAGGGAGACGG - Intronic
1012072434 6:94639908-94639930 TGGGGGAGCCAGAAGGAAGATGG - Intergenic
1012085581 6:94822296-94822318 AAGGGGGGAAAGAGGGGGGAAGG - Intergenic
1012111611 6:95242116-95242138 AGGGGGAGGGAGAGGGAGGGAGG + Intergenic
1012201922 6:96417082-96417104 AAGGGGAGAGAAAGGGAGGGAGG + Intergenic
1012519986 6:100109876-100109898 AAGGAGAGAGAAAGGGAGGATGG - Intergenic
1012576384 6:100805358-100805380 AAGGGGAGCGAGAGGGAGTAGGG + Intronic
1012802375 6:103847238-103847260 AGGGAGAGACAGAGGAAGGAGGG + Intergenic
1012980998 6:105830870-105830892 AAAGGGAGGCAGCTGGAGGAGGG + Intergenic
1013374010 6:109496598-109496620 AAGGAGAGCCAGGATGAGGAGGG - Intronic
1013587614 6:111593660-111593682 AGGGAGAGACGGAGGGAGGAGGG - Intronic
1013591653 6:111623815-111623837 AATGGGAGCAACAGGGAGGTGGG - Intergenic
1013634828 6:112019366-112019388 AAAGGCAGCAAGAGGGAGAAGGG - Intergenic
1014107334 6:117582249-117582271 GGGGGGAGGCAGAGGGAGGGAGG - Intronic
1014856783 6:126411949-126411971 AAGGAGAGAGAGAGGGAGGGAGG - Intergenic
1015042867 6:128742809-128742831 ATGGGGAGCCAGAAAGGGGATGG - Intergenic
1015096843 6:129425575-129425597 GAGGGTAGCTAGTGGGAGGAGGG - Intronic
1015326756 6:131932218-131932240 TAGAGGAGCAAGAGGGAGGAGGG - Intergenic
1015395863 6:132733954-132733976 GAGGGGAGAGAGAGAGAGGAAGG + Intronic
1015600158 6:134903839-134903861 TGGGTGAGACAGAGGGAGGAGGG + Intergenic
1015692107 6:135936989-135937011 GAAGGGAGTCAGAGTGAGGAGGG + Intronic
1015723727 6:136276400-136276422 AAGGGAGGGCAGAGGGAGAATGG - Exonic
1015849004 6:137552410-137552432 AAGGGAAGGAAGGGGGAGGAAGG - Intergenic
1016040943 6:139431537-139431559 GAGGGGATCCAGAGGGATGGGGG - Intergenic
1016523727 6:144976128-144976150 AAGGGCAGCCAGAGAAAGGTAGG - Intergenic
1016532545 6:145074939-145074961 AAAGGAAGAGAGAGGGAGGAAGG + Intergenic
1016997266 6:149969529-149969551 AAGAGGAGTCAGGGGGAAGAAGG - Intronic
1017066846 6:150537017-150537039 AAGAGGAGCAAGTGGGAGGGAGG + Intergenic
1017127598 6:151080383-151080405 CAGGGCAGCCAGTGAGAGGATGG + Intronic
1017229154 6:152053401-152053423 AGGGAGAGACAGAAGGAGGAAGG - Intronic
1017390155 6:153929427-153929449 GAGGGGTGGTAGAGGGAGGAGGG - Intergenic
1017506684 6:155074929-155074951 CTGGGGAGTCAGAGGGTGGAGGG + Intronic
1017579163 6:155841907-155841929 AAAGCAAGTCAGAGGGAGGAAGG + Intergenic
1017625625 6:156345515-156345537 AAGGAGAGGGAGAGAGAGGAAGG + Intergenic
1017869082 6:158470929-158470951 AGGGGAAGGCAGAGAGAGGATGG + Intronic
1017980135 6:159394173-159394195 ATGGGGAGCCAGAAGGGGGATGG - Intergenic
1018245253 6:161816351-161816373 AAGGGGAGGCAGAGTGGGGTGGG + Intronic
1018381388 6:163261125-163261147 CCGGGAAGACAGAGGGAGGAGGG - Intronic
1018788852 6:167130974-167130996 GAGGGGGTCCAGAGGGAGGGTGG - Intronic
1018867734 6:167758941-167758963 GACGGGGGGCAGAGGGAGGAGGG - Intergenic
1018923753 6:168193116-168193138 AAGGATAGCCGGAGGGATGAGGG + Intergenic
1018998203 6:168726036-168726058 CAGAGGAGGCAGTGGGAGGAGGG + Intergenic
1019097943 6:169601049-169601071 AAGGGCAGCCAGAGAAAGGTCGG + Intronic
1019158193 6:170052779-170052801 AGGGGGAGGCGGAGGGGGGAGGG - Intergenic
1019283280 7:211200-211222 GAGGGGAGGCTGAGGGAGGTTGG - Intronic
1019334897 7:478438-478460 AAGGGAGGACAAAGGGAGGAAGG + Intergenic
1019473326 7:1232656-1232678 GGGGGGAGCCGGAGGGAGGGAGG - Intergenic
1019494965 7:1333456-1333478 AGGGGGAGGAGGAGGGAGGAGGG - Intergenic
1019587453 7:1813167-1813189 AAGGGGAGACCAAGGCAGGAGGG + Intergenic
1019788878 7:2997424-2997446 CAGGGGAGGCAGGGCGAGGATGG + Intronic
1019825276 7:3279387-3279409 AAGGGGAGAGAGAGGAAGGAGGG + Intergenic
1019954601 7:4403374-4403396 AAGGGGAGAGAGAGAGAGAAGGG + Intergenic
1020011352 7:4807534-4807556 GAGGGGAGACAGAGGGAGAGAGG - Intronic
1020025775 7:4898912-4898934 AAAGAGAGACAGAGGAAGGAAGG + Intergenic
1020080026 7:5282203-5282225 AAGGGGAAGGAGAGGGAGGGAGG + Intronic
1020080236 7:5282843-5282865 GAGAGGAGCGAGAGGGAAGAGGG + Intronic
1020315256 7:6901206-6901228 ATGGGGAGCCAGAAGGGGGATGG - Intergenic
1020334371 7:7051342-7051364 AAGTGTGGCAAGAGGGAGGAGGG + Intergenic
1020666317 7:11047932-11047954 AGGGGGAGGGAGAGGGAGGGAGG + Intronic
1021116003 7:16747387-16747409 AAGGGGAGAGAGAGGAGGGAAGG - Intergenic
1021447490 7:20749144-20749166 AAGGAGAGAGAGAGGGAGGGAGG - Intronic
1021469168 7:20981652-20981674 AAGGGGAGGGAGGGGAAGGAGGG - Intergenic
1022243602 7:28535612-28535634 TAGGAGAGAAAGAGGGAGGAAGG + Intronic
1022335426 7:29417257-29417279 AAAGGAAGAGAGAGGGAGGAAGG + Intronic
1022992760 7:35724910-35724932 ATGGGGAGCCAGAAGGGGGATGG - Intergenic
1023217720 7:37882524-37882546 AAGGAGGGAGAGAGGGAGGAAGG + Intronic
1023450439 7:40278747-40278769 AAAGGGAGGGAGAGGGAAGAAGG - Intronic
1023594550 7:41815246-41815268 AAGGGGTGCCCGAGTCAGGAAGG + Intergenic
1023737441 7:43247666-43247688 AAGGGGAGAGGGAGGGAGGGAGG + Intronic
1023842630 7:44105666-44105688 AAGGAGAGCCAGAGGCAGGAGGG - Intronic
1023856305 7:44186174-44186196 CAGGGCAGCTGGAGGGAGGAAGG + Intronic
1023911143 7:44557680-44557702 AAGGGGAAGGGGAGGGAGGAAGG + Intergenic
1023960077 7:44919064-44919086 AAGGGGTGTCAGTGGGAGGGGGG + Intergenic
1023981567 7:45073610-45073632 AGGGGGTGCCCCAGGGAGGATGG + Intronic
1024105248 7:46077673-46077695 AAAGGCAGCCAGAGGAAAGAAGG + Intergenic
1024198336 7:47081846-47081868 GAGGGGAGACACTGGGAGGAAGG + Intergenic
1024348599 7:48339097-48339119 ACCTGGAGTCAGAGGGAGGATGG + Intronic
1024522202 7:50315237-50315259 AAAGGGAGACGGAGGGAGGGAGG + Intronic
1024628923 7:51231578-51231600 AAGGAGCGCCAGAGGGTGGCTGG + Intronic
1024986069 7:55194165-55194187 AGGGGGAGCAAGTGGGAAGAGGG - Intronic
1025198890 7:56950013-56950035 AAGGGGAAGGAGAGGGAGGGAGG - Intergenic
1025626900 7:63230821-63230843 AGAGGGAGACAGAGGGAGGGAGG + Intergenic
1025626912 7:63230867-63230889 AGAGGGAGACAGAGGGAGGGAGG + Intergenic
1025673056 7:63626920-63626942 AAGGGGAAGGAGAGGGAGGGAGG + Intergenic
1025847830 7:65216726-65216748 AAGGAGGGAGAGAGGGAGGAAGG - Intergenic
1026011307 7:66638649-66638671 AAGGGAAGCCAATGGGACGAGGG - Intronic
1026070291 7:67112796-67112818 CAGGGGAGCCAGATGCAGAACGG + Intronic
1026111066 7:67459302-67459324 ATGGGGATCCAGAAGGGGGATGG + Intergenic
1026123247 7:67556120-67556142 AAGGAGAGAGAGAGGAAGGAAGG - Intergenic
1026149200 7:67773729-67773751 AAAGGGAGAAAGAGGGAGGGAGG - Intergenic
1026248407 7:68644917-68644939 ATGGGGAGCTAGAAGGGGGATGG - Intergenic
1026272018 7:68844936-68844958 ATGGGGAGCCAGAAGGGGGATGG + Intergenic
1026308841 7:69166277-69166299 AAGGGGAGGGGGAGGGGGGAAGG + Intergenic
1026313925 7:69211683-69211705 ATGGGGAGCCAGAAGGAGGGTGG - Intergenic
1026512932 7:71042162-71042184 AAAGGGAGAGAGAGAGAGGAAGG + Intergenic
1026589134 7:71680635-71680657 AAGGAGGGAGAGAGGGAGGAAGG - Intronic
1026706619 7:72699473-72699495 CAGGGGAGCCAGATGCAGAACGG - Intronic
1026806125 7:73430450-73430472 AAGGGGATGGAGGGGGAGGAGGG - Intergenic
1026806137 7:73430474-73430496 AAGGGGAGGGAGGGGGAGGAGGG - Intergenic
1026837259 7:73647375-73647397 AGGGAGAGCCAGAGGGAGGAAGG + Intergenic
1026875607 7:73877373-73877395 ATGGGGAGACTGAGGCAGGAAGG + Intergenic
1027345801 7:77258234-77258256 AATGGGAGCCAGGGGGTGGAGGG - Intronic
1027416868 7:77983341-77983363 AAAGAGAGACAGAGGGAGGGAGG - Intergenic
1027966546 7:85017244-85017266 AAAGGGAGCCAGAAGGAACAGGG - Intronic
1027977237 7:85174360-85174382 AAGGGGAGCTGGAGTTAGGAGGG + Intronic
1028210568 7:88069196-88069218 AAGGAGAAACATAGGGAGGAAGG - Intronic
1028478101 7:91273847-91273869 AAAGGGAGCAAGAGAGAGGGAGG + Intergenic
1028984237 7:96997381-96997403 ATGGGGAGCAGGAGGGAGGGGGG + Intergenic
1029165294 7:98584982-98585004 AAAGGGAGACAGAGGAAGAAAGG - Intergenic
1029459961 7:100688722-100688744 AAGGAGAGCAGGGGGGAGGAGGG + Exonic
1029478356 7:100798618-100798640 TAGGGGAGACAGAAGGAGCAGGG + Intergenic
1029514672 7:101017826-101017848 AAGGGGTCCCAGGGGGAGGAAGG - Intronic
1029514691 7:101017867-101017889 AAGGGGTCCCAGGGGGAGGGAGG - Intronic
1029514712 7:101017908-101017930 AAGGGGTCCCAGGGGGAGGGAGG - Intronic
1029514733 7:101017949-101017971 AAGGGGTCCCAGGGGGAGGGAGG - Intronic
1029514754 7:101017990-101018012 AAGGGGTCCCAGGGGGAGGGAGG - Intronic
1029514775 7:101018031-101018053 AAGGGGTCCCAGGGGGAGGGAGG - Intronic
1029514817 7:101018112-101018134 AAGGGGTCCCAGGGGGAGGGAGG - Intronic
1029514861 7:101018196-101018218 AAGGGGTCCCAGGGGGAGGGAGG - Intronic
1029611601 7:101629567-101629589 ATGGGGAGCCAGAAGGGGGATGG + Intergenic
1029642854 7:101832123-101832145 AAGGCGGGCTAGAGTGAGGAGGG + Intronic
1029654999 7:101918472-101918494 AAGGGGAGGCAGATGATGGAAGG + Intronic
1029748732 7:102531164-102531186 AAGGAGAGAGAGAGGAAGGAAGG - Intergenic
1029766679 7:102630248-102630270 AAGGAGAGAGAGAGGAAGGAAGG - Intronic
1029850924 7:103461150-103461172 AAGGGCAACCAGAGAGAGGTCGG - Intergenic
1029910215 7:104137765-104137787 TTGGGGAGCCCGAAGGAGGATGG - Intronic
1030002726 7:105082619-105082641 CAGGGGTGACAGAGGGAGAAGGG + Intronic
1030294178 7:107903895-107903917 ATGGGGAGATAGAGGAAGGAAGG + Intronic
1030297172 7:107940779-107940801 AGGGGGAGGCAAAGGCAGGACGG - Intronic
1030365499 7:108641358-108641380 AGGGAGGGACAGAGGGAGGAAGG - Intergenic
1030811946 7:113983379-113983401 AAGGAGAGAGAGAGGGAGGGAGG - Intronic
1030942489 7:115671296-115671318 AAGGAGGGAGAGAGGGAGGAAGG - Intergenic
1031168454 7:118260651-118260673 GAGGGGAGGAAAAGGGAGGAAGG - Intergenic
1031201521 7:118693858-118693880 AAGGAGAGAGGGAGGGAGGAAGG - Intergenic
1031232308 7:119123647-119123669 ATGGGGAGCCAGCAGGGGGATGG - Intergenic
1031484592 7:122311705-122311727 AAGAGGAGACAGTGGGAAGAGGG - Intergenic
1031630166 7:124034298-124034320 AAGGAGATAAAGAGGGAGGAAGG - Intergenic
1031651652 7:124298848-124298870 ATGGGGGGTGAGAGGGAGGAGGG - Intergenic
1031657199 7:124372505-124372527 AACGGAAGCCAGAGAGAGGCAGG + Intergenic
1031766245 7:125781303-125781325 AAGGGGAGCTGGAGAGGGGATGG + Intergenic
1032248689 7:130234332-130234354 AAGGGGCCCCAGGTGGAGGAGGG + Intergenic
1032322299 7:130896556-130896578 AGGGGGAGAGAGAGGGAGGGAGG - Intergenic
1032327820 7:130948405-130948427 CAGGGGAGCTGGGGGGAGGAGGG + Intergenic
1032526526 7:132581956-132581978 AAGGGGAGATGGAGGGAGGGAGG + Intronic
1033062127 7:138119252-138119274 AAGGAGTGACGGAGGGAGGAAGG + Intergenic
1033349714 7:140552356-140552378 AAGGAGAGGGAGAGGGAGGGAGG - Intronic
1033586910 7:142780807-142780829 AAGCGGAGACAGGAGGAGGATGG - Intergenic
1033652271 7:143352264-143352286 AGGGGGAGGCAGAGAGAGGCAGG - Intergenic
1033759341 7:144422855-144422877 AAGGGGAGCTATTGGGAGGCTGG + Intergenic
1033832609 7:145271598-145271620 GAGGGGAGGAAGAGGAAGGAAGG + Intergenic
1033954878 7:146834490-146834512 AAGGAAAGACAGATGGAGGATGG + Intronic
1034399485 7:150852653-150852675 AACAGGACACAGAGGGAGGAGGG + Intronic
1034423721 7:151002126-151002148 CAGGGAGGCCAGAGTGAGGAGGG + Intronic
1034511208 7:151536248-151536270 AAAGAGAGACAGAGAGAGGAAGG + Intergenic
1034511212 7:151536315-151536337 AAAGAGAGACAGAGAGAGGAAGG + Intergenic
1034625164 7:152487154-152487176 AAGGGAAGAGAGAGGAAGGAAGG - Intergenic
1034629643 7:152521212-152521234 AAGGGGAGGATGAGGGAGGATGG - Intergenic
1034931301 7:155166005-155166027 CTGGGGAGCCAGAAGGGGGATGG - Intergenic
1034953232 7:155315577-155315599 AGGGGGAGAGAGAGGGAGGTTGG + Intergenic
1035140261 7:156752572-156752594 GAGGGGAGCTGCAGGGAGGAGGG + Intronic
1035319731 7:158020889-158020911 CGGGGGAGCCTGAGTGAGGACGG - Intronic
1035459141 7:159028725-159028747 ATGTGGAGCGAGAGGGAGGCAGG - Exonic
1035468657 7:159096122-159096144 AAGGGGAGCAGCAGGGAGGCTGG + Intronic
1035568750 8:658878-658900 AAGGAAAGGCAGAGGAAGGACGG - Intronic
1036154173 8:6326261-6326283 AAGGGAAGAGGGAGGGAGGAAGG + Intergenic
1036207787 8:6818013-6818035 AAAGGGAGAAAAAGGGAGGAAGG - Intronic
1036635539 8:10547701-10547723 AAGGGGAGAGGGAGGAAGGAAGG - Intronic
1036744064 8:11391512-11391534 AAGGAGTTCCAGAAGGAGGACGG - Intronic
1037175889 8:15945438-15945460 ATGGGGAGCTAGAAGGGGGATGG - Intergenic
1037656166 8:20886024-20886046 AAAGAGAGACAGAGGGAGGGAGG + Intergenic
1037671143 8:21016327-21016349 AAAGGGAGAGAGAGGGAGAAGGG - Intergenic
1037754691 8:21703275-21703297 CAGGGGAGCCTAGGGGAGGAGGG + Intronic
1037773153 8:21814922-21814944 GAGAGGAGCCAGGGGCAGGAAGG - Intergenic
1037859302 8:22393262-22393284 AAGAGGAGGCAGGGGGAGAATGG + Intronic
1037974289 8:23199165-23199187 AAGTGGAGCCTGAGGGAGATGGG - Intronic
1038210715 8:25516988-25517010 AAGGGGAGCCAGCTGCAAGATGG - Intergenic
1038425357 8:27461002-27461024 AAGGGGAGGAAGCGGGAGGCAGG - Exonic
1038448423 8:27620789-27620811 AGGGAGAGCCAGAGGGAGGGAGG - Intergenic
1039086315 8:33783604-33783626 TGGGGGAGCCAGAAGGGGGATGG + Intergenic
1039260520 8:35766326-35766348 AGGGAGAGAAAGAGGGAGGAAGG - Intronic
1039349941 8:36753165-36753187 AAGGTGAGGCGGAGGGAGAAGGG - Intergenic
1039390844 8:37179823-37179845 AAGAGAAGCCAGAGGGGGAAAGG - Intergenic
1039407544 8:37326286-37326308 GAGGGAAGCCAGTGGGAGGAAGG - Intergenic
1039454683 8:37698706-37698728 AGGAGGAGGGAGAGGGAGGAGGG - Exonic
1039455942 8:37706682-37706704 AAGGAGAGAGAGAGGAAGGAGGG + Intergenic
1039498288 8:37997624-37997646 AAAGAGAGACAGAGGGAGAATGG - Intergenic
1039542264 8:38382061-38382083 AAGGGGAGGCCGAGGGACGGGGG + Exonic
1039589343 8:38733739-38733761 AAGGGGAGCCTGGGAGAGGCTGG - Intronic
1039849099 8:41346873-41346895 AGGGGGACCCAGAGGAAGAAAGG + Intergenic
1039893358 8:41699173-41699195 GAGGGGAGCCTGGGAGAGGATGG + Intronic
1039893399 8:41699369-41699391 CAGGGATTCCAGAGGGAGGAAGG - Intronic
1039950189 8:42164948-42164970 AAGGGGAGGGAGAGAGAGGAAGG + Intronic
1040099733 8:43488184-43488206 AAGAGGAGAAAGAGGGAGGTTGG + Intergenic
1040386706 8:46919105-46919127 AAGAGGAGGCAAGGGGAGGAGGG + Intergenic
1040602361 8:48897362-48897384 ATGGGGAGCAAGAAGGGGGATGG + Intergenic
1040681918 8:49820776-49820798 GAAGGGAGACGGAGGGAGGAAGG + Intergenic
1040725028 8:50371852-50371874 AATGGTAGCCAAAGGGAGCAGGG - Intronic
1041225429 8:55692726-55692748 ATCAGGAGGCAGAGGGAGGATGG - Intergenic
1041586781 8:59529852-59529874 AAGGGAAGCGAGAGGAGGGAGGG - Intergenic
1041648489 8:60277885-60277907 AAGGGGAATCTGAAGGAGGAAGG + Intronic
1041731708 8:61069420-61069442 AAGGGAAAACAGAGGAAGGAAGG - Intronic
1042025064 8:64414589-64414611 ATTGGGAGACAGAGGGAGAAGGG - Intergenic
1042159217 8:65875106-65875128 ATGGGGATCCAGAAGCAGGATGG + Intergenic
1042420662 8:68584881-68584903 CTGTGGAGCCAGAGGGAGAAGGG - Intronic
1043778195 8:84297198-84297220 GAGGGTAGACAGTGGGAGGAGGG - Intronic
1043913535 8:85893095-85893117 GAGGGGGGTGAGAGGGAGGAAGG + Intergenic
1044186398 8:89256884-89256906 GAGGTGAGAGAGAGGGAGGAGGG + Intergenic
1044206203 8:89494331-89494353 ACGGGGAGCCAGAAGGGAGATGG - Intergenic
1044429819 8:92095655-92095677 AAGGAGAGACACAGGCAGGAGGG + Intronic
1044627190 8:94245578-94245600 GAGGGGACACAGAGGGAAGAAGG - Intergenic
1044631619 8:94285486-94285508 TAAGGAAGCCAGAGGTAGGAAGG + Intergenic
1044654595 8:94534574-94534596 AAGGGGAGGGAGAGAAAGGAGGG - Intronic
1045358727 8:101412660-101412682 ATGGGCAGCCACAGGTAGGAAGG + Intergenic
1045542646 8:103101320-103101342 ATGGGCAGCCAGACTGAGGAGGG + Intergenic
1045622377 8:103995461-103995483 CAGTGGAGACAGAGGGAGAATGG + Intronic
1045674098 8:104589082-104589104 CAGGCGAGCCGGAGGGAGGAGGG - Intergenic
1045947895 8:107817502-107817524 AGAGGGAGACAGAGAGAGGAAGG + Intergenic
1046072969 8:109281458-109281480 AAGGAGTGAAAGAGGGAGGAAGG - Intronic
1046174683 8:110560050-110560072 ATGGGGAGCCAGAAGGTGGAGGG + Intergenic
1046277442 8:111982237-111982259 ATGGGGAGCCAGAAGGGAGATGG + Intergenic
1046661573 8:116953015-116953037 AAGGGGAGAGAAAGGGAGGGAGG - Intronic
1046699709 8:117386370-117386392 AAGGGCTGTCAAAGGGAGGAAGG - Intergenic
1046791449 8:118326601-118326623 TTGGGGGGCTAGAGGGAGGATGG - Intronic
1047254806 8:123207061-123207083 GAGGGGAGGAAGAGGGAGGGAGG - Intronic
1047518668 8:125577712-125577734 AAGAAGAGACAGAGGGAGGGAGG - Intergenic
1047550237 8:125863654-125863676 AAGGGGAGACGGAGTAAGGAGGG - Intergenic
1047586521 8:126279690-126279712 ATGGGGAGCCAGAAGGGAGATGG - Intergenic
1047898652 8:129396142-129396164 AAAGAGAGCGAGAGGGAGGGAGG + Intergenic
1048048562 8:130796050-130796072 ACAGGGAGGCAGAGGGAGGGAGG - Intronic
1048194820 8:132323622-132323644 ATGGGAAGTCAGAGAGAGGATGG - Intronic
1048234311 8:132675218-132675240 AAGGGGAGGAAGAGGCAGAAAGG - Intronic
1048507140 8:135031806-135031828 AAGGGGAGTGGGTGGGAGGAAGG - Intergenic
1048643163 8:136387345-136387367 AAGGAGAAGCAGAGGGAGTATGG - Intergenic
1048696260 8:137031631-137031653 AAGGGGAGGAAGGGAGAGGAGGG - Intergenic
1048881673 8:138877091-138877113 GAGGGGAGGCAGAGGGCTGATGG - Intronic
1048928039 8:139288099-139288121 AAAGGGAGCCAGAGTGCAGATGG - Intergenic
1048976332 8:139674916-139674938 GAGGGGATCCAGAGTGGGGAAGG - Intronic
1049310429 8:141931238-141931260 GAGGGGAGGCCTAGGGAGGAAGG + Intergenic
1049370313 8:142261199-142261221 AAGGGAGGGGAGAGGGAGGAGGG + Intronic
1049409563 8:142466432-142466454 GAGAGGGGCCAGAGGAAGGAGGG + Intronic
1049426426 8:142539901-142539923 ACGGGGAGCAAGAGGAAGGCGGG + Intronic
1049429017 8:142550673-142550695 AAGGGGAGGTGGGGGGAGGAAGG + Intergenic
1049446547 8:142634089-142634111 GCGAGGAGCCAGAGGGAGAAGGG + Intergenic
1049475258 8:142794313-142794335 AGGGAGAGGCAGAGGGAGGGTGG - Intergenic
1049501892 8:142971501-142971523 AAGGGGAGGGAGAGGAAGGGAGG - Intergenic
1049698804 8:143997264-143997286 AAGTGGGTCCAGAGGGTGGAGGG - Intronic
1049702275 8:144020687-144020709 AAGAGGATCCTGAGGGAAGAGGG - Intronic
1049879760 8:145053558-145053580 CAGGGAAGCCTGAGGGAGCAGGG + Intronic
1049949169 9:627699-627721 CAGGGGGACCAGAGGGTGGATGG + Intronic
1050002816 9:1096708-1096730 AGGGGGAGACAGAGGAAAGAAGG + Intergenic
1050041342 9:1496951-1496973 AAGGGGAGAGAGAGGGGGAAGGG - Intergenic
1050213092 9:3287048-3287070 AAGGGGAGGCACATGGAGAATGG - Intronic
1050579724 9:7040302-7040324 AAAGAGAGACAGAGGGAGGGAGG - Intronic
1050798912 9:9584221-9584243 AAGGGGAGACAGAGGTTGCAGGG - Intronic
1050829109 9:9989531-9989553 AAGGGGAGCTAGAAGGGGGATGG - Intronic
1050939707 9:11443332-11443354 GAGGGGAGCTGGAGAGAGGATGG - Intergenic
1051693354 9:19741285-19741307 AAGGGGAGCTAGAGGGAAGTGGG + Intronic
1052210877 9:25901823-25901845 AAGGGGCTACAGAGGAAGGAAGG + Intergenic
1052280149 9:26723692-26723714 AAGGGAAGCCGGAGGGTGGAAGG + Intergenic
1052738468 9:32369976-32369998 AATGGGAGCAAGAGAGAGAAGGG - Intergenic
1053014482 9:34654202-34654224 AAGGGGGAGCAGAAGGAGGAAGG - Intronic
1053049321 9:34945669-34945691 TACAGGAGACAGAGGGAGGAAGG - Intergenic
1053225435 9:36351636-36351658 ACGGGGAGAGAGAGGAAGGAAGG + Intronic
1053295917 9:36912831-36912853 AAAATGAGCCAGTGGGAGGAGGG - Intronic
1053480761 9:38414754-38414776 ATGGGGAGGCAGAGGGAGTGGGG - Intronic
1053525511 9:38826230-38826252 GAGGGGAGCCAGAGGGGGGATGG - Intergenic
1053580537 9:39399438-39399460 AAGGAGAGAGAGAGGGAGGGAGG - Intergenic
1053680903 9:40484526-40484548 AATGGAAGCCAGATTGAGGAGGG - Intergenic
1053697947 9:40655393-40655415 AGGAGGAGGAAGAGGGAGGAAGG + Intergenic
1053817456 9:41927528-41927550 AAGGAGAGAAAGAGGGAGGGAGG + Intronic
1054102124 9:60958243-60958265 AAGGAGAGAGAGAGGGAGGGAGG - Intergenic
1054197740 9:62050657-62050679 GAGGGGAGCCAGAGGGGGGATGG - Intergenic
1054282810 9:63140409-63140431 AATGGAAGCCAGATTGAGGAGGG + Intergenic
1054293985 9:63320041-63320063 AATGGAAGCCAGATTGAGGAGGG - Intergenic
1054309238 9:63454801-63454823 AGGAGGAGGAAGAGGGAGGAAGG + Intergenic
1054392010 9:64624530-64624552 AATGGAAGCCAGATTGAGGAGGG - Intergenic
1054441179 9:65262749-65262771 AGGAGGAGGAAGAGGGAGGAAGG + Intergenic
1054489097 9:65758740-65758762 AGGAGGAGGAAGAGGGAGGAAGG - Intergenic
1054503719 9:65891798-65891820 AATGGAAGCCAGATTGAGGAGGG + Intronic
1054584235 9:66948620-66948642 AAGGAGAGAGAGAGGGAGGGAGG + Intergenic
1054640614 9:67537715-67537737 GAGGGGAGCCAGAGGGGGGATGG + Intergenic
1055053379 9:72001290-72001312 AAGGGGATGCAGAAGGAGGATGG + Intergenic
1055166297 9:73199512-73199534 AAGGGCACTGAGAGGGAGGATGG + Intergenic
1055297821 9:74852446-74852468 AGGGAGAGGGAGAGGGAGGAGGG - Intronic
1055575935 9:77660330-77660352 AAGGGAAGGAAGAGGGTGGAGGG - Intergenic
1055677775 9:78682798-78682820 AAGGGGAGGAAGAGAGAGGAAGG - Intergenic
1055730271 9:79273801-79273823 AAGGAGAGAAAGAGGAAGGAAGG + Intergenic
1055820190 9:80252990-80253012 AAGGTGAGGCAGAGAGGGGAAGG + Intergenic
1056321091 9:85435143-85435165 AAGGGAAGCCAGAGAGAGAAAGG + Intergenic
1056327355 9:85490915-85490937 ATGGGGAGCCAGAAGGAGGATGG - Intergenic
1056408387 9:86299062-86299084 CAGGTCAGCCAGAGGAAGGAGGG + Intronic
1056463081 9:86826854-86826876 TGGGGCAGCCAGAGGAAGGAAGG - Intergenic
1056488497 9:87082839-87082861 AAGGTGAGCAAGAGGGAAGATGG - Intergenic
1056545054 9:87606478-87606500 AGGGAGAGACAGAGGGAGGAAGG - Intronic
1056545111 9:87606659-87606681 ACAGGGAGAGAGAGGGAGGAAGG - Intronic
1056545124 9:87606706-87606728 AGGGAGAGAGAGAGGGAGGAAGG - Intronic
1056545156 9:87606817-87606839 AAGGGGGGAGAAAGGGAGGAAGG - Intronic
1056617457 9:88180597-88180619 AAGGAGGGCCAGCGGGAGGGCGG - Intergenic
1056755155 9:89377013-89377035 AAGAGGAGCCAGGAGGAGGGAGG + Exonic
1056871905 9:90289626-90289648 ATGGGGAGCCAGAAGGGGGATGG - Intergenic
1057013851 9:91633010-91633032 AAGGGAAGGAAGAGGGAGGGAGG + Intronic
1057272272 9:93657904-93657926 AGGGTGAGACAGTGGGAGGATGG + Intronic
1057353911 9:94320316-94320338 CAGGGGAGCCTGAGGGACAACGG - Exonic
1057373072 9:94491483-94491505 ATGGGGAGGCTGAGGCAGGAGGG + Intergenic
1057387116 9:94614129-94614151 AAGAGGAGGGAGAAGGAGGAGGG + Intronic
1057438679 9:95065485-95065507 AAGGGCAGCCAGCAGGAGAAGGG - Intronic
1057470686 9:95353598-95353620 AAGGAGAGAAAGAGGAAGGAAGG - Intergenic
1057489957 9:95512788-95512810 AAGGGGTGCCAGAGGCAGAAGGG - Intronic
1057565052 9:96160100-96160122 AAGGAGAGAGAGAGGGAGGGAGG + Intergenic
1057653839 9:96937274-96937296 CAGGGGAGCCTGAGGGACAACGG + Exonic
1057797936 9:98171676-98171698 AAGGGGAGGCATGGGGTGGAAGG + Intronic
1058236598 9:102498123-102498145 ATGGGGAGCCAGAAGGGGGATGG + Intergenic
1058314524 9:103548312-103548334 AGAGGGAGAGAGAGGGAGGAAGG + Intergenic
1058711524 9:107683468-107683490 AAGGGGATGCAGAGGGAGAAGGG - Intergenic
1058873353 9:109221229-109221251 GAGGGGAGGGAGGGGGAGGAAGG + Intronic
1058907492 9:109493785-109493807 AAAGGCAGCCAGGGGGAGGCCGG + Intronic
1059048073 9:110892733-110892755 AAGGGAAGGAAGAGGGAGGGAGG + Intronic
1059410085 9:114126436-114126458 AAGAGGAGAGGGAGGGAGGAAGG - Intergenic
1059467089 9:114475820-114475842 AAGAGGAGGAACAGGGAGGAGGG + Intronic
1059701923 9:116783341-116783363 AAGGAGAGAGAGAGGGAGGGAGG - Intronic
1059750734 9:117244793-117244815 AAGGAGAGAGGGAGGGAGGAAGG + Intronic
1059770238 9:117416955-117416977 AAGGAGAGACTGAGGGAGGCAGG - Intergenic
1059814074 9:117892072-117892094 AAGAGGAGAAAGAGGCAGGATGG - Intergenic
1059929861 9:119249951-119249973 AAGGAGAGAGAGAGGGAGGGAGG + Intronic
1059929886 9:119250039-119250061 AAGGAGAGAGAGAGGGAGGGAGG + Intronic
1059930469 9:119255403-119255425 TGGGGGAGCCAGAGGTGGGAGGG + Intronic
1059952226 9:119477705-119477727 ATGCGGAGCCAGAAGGGGGATGG + Intergenic
1060124034 9:121024294-121024316 GAGGGGAGCGGGAGGGGGGAGGG + Intronic
1060124067 9:121024349-121024371 GAGGGGAGCGGGAGGGGGGAGGG + Intronic
1060300567 9:122372327-122372349 TAGGGGACCCAAAGAGAGGACGG + Intronic
1060488942 9:124067849-124067871 AATGGGAGCCAGAGGTAGGGGGG + Intergenic
1060494164 9:124105718-124105740 AAGGGGACACAGAGGGAAGGAGG - Intergenic
1060583238 9:124770667-124770689 GAGGGGACCCGGGGGGAGGAGGG + Intronic
1060592701 9:124828960-124828982 AAGGAGAGAGAGAGGAAGGAAGG - Intergenic
1060592713 9:124829028-124829050 AAGGAGAGAGAGAGGAAGGAAGG - Intergenic
1060661565 9:125408063-125408085 ACCGGGAGCCAGAGGGAGCCGGG + Intergenic
1060831770 9:126722136-126722158 AAGAGGGGCCTGAGGGAAGAGGG - Intergenic
1061045694 9:128163753-128163775 AAGGGGAGGCCCAGGCAGGAAGG - Exonic
1061061849 9:128254455-128254477 AAGGGGAGGAAGATGGAGGGAGG - Intronic
1061177221 9:129004973-129004995 AAGGGGAGCATGAGGGAAGGAGG + Intronic
1061177229 9:129005001-129005023 AAGGGGAGCATGAGGGAAGGAGG + Intronic
1061239571 9:129361821-129361843 AAGGGGAGCCAGTGGTGGGGAGG - Intergenic
1061334620 9:129923963-129923985 AGGGTGAGGCAGAGGCAGGAGGG + Exonic
1061492108 9:130951074-130951096 AGGGGGAGACAGGGAGAGGAAGG - Intergenic
1061765297 9:132877943-132877965 AGGCGGACCCAGGGGGAGGAAGG - Intronic
1061783228 9:133007975-133007997 AAGAGGAGGGAGAGAGAGGAGGG - Intergenic
1061899676 9:133666496-133666518 AGGAGGAGGGAGAGGGAGGAGGG - Intronic
1061921844 9:133786914-133786936 AAGGGGAGAAAGAGGGAGGGAGG + Intronic
1062070767 9:134553960-134553982 AAGGGGAGGAAGAGGAAGGCTGG + Intergenic
1062133141 9:134911026-134911048 AATGGGATTCAGAGAGAGGAGGG + Intronic
1062143959 9:134978790-134978812 AAGGAGAGAAGGAGGGAGGAAGG + Intergenic
1062143966 9:134978817-134978839 AAGGAGAGAAGGAGGGAGGAAGG + Intergenic
1062144003 9:134978929-134978951 AAGGAGAGAAGGAGGGAGGAAGG + Intergenic
1062144060 9:134979105-134979127 AAGGAGAGAGGGAGGGAGGAGGG + Intergenic
1062194172 9:135263979-135264001 AAGGGGAGGGGGAGGGAGGGTGG - Intergenic
1062212184 9:135371149-135371171 AGGGGGAGCTGGAGGCAGGAGGG - Intergenic
1062235891 9:135507411-135507433 GGGGTGAGCCAAAGGGAGGACGG - Intergenic
1062725942 9:138073640-138073662 AGGGGAAGCAAGACGGAGGAAGG - Intronic
1202780310 9_KI270717v1_random:28583-28605 AGGAGGAGGAAGAGGGAGGAAGG + Intergenic
1203654449 Un_KI270752v1:9595-9617 AAAGAGAGAGAGAGGGAGGAAGG - Intergenic
1185495498 X:551264-551286 AAGGAGAGAGAGAGAGAGGAAGG - Intergenic
1185550083 X:976007-976029 AAGAGGAGGCAGAGAGAGAAGGG + Intergenic
1185627578 X:1493356-1493378 GAGGGGAGGGGGAGGGAGGAAGG + Intronic
1185688279 X:1948314-1948336 GAGGGGAGACAGGAGGAGGAGGG + Intergenic
1185688580 X:2133890-2133912 GAGGGGAGACAGGAGGAGGAGGG + Intergenic
1186001954 X:5022427-5022449 AGGGGGAGACACAGAGAGGAGGG - Intergenic
1186053695 X:5626847-5626869 AAGAGCAGACAGAGGGAGGAAGG + Intergenic
1186079280 X:5912858-5912880 AGGGAGAGCAGGAGGGAGGAAGG + Intronic
1186111945 X:6266901-6266923 AAGGGAGGAAAGAGGGAGGAGGG + Intergenic
1186286230 X:8046718-8046740 ATGGGGAGCCAGAAAGGGGATGG + Intergenic
1186309016 X:8297139-8297161 AGGGGGAGCGGGAGGGAGGGAGG - Intergenic
1186309036 X:8297192-8297214 AAAGGGGGAGAGAGGGAGGAAGG - Intergenic
1186327862 X:8499074-8499096 AAGGAAAGCGAGAGGGGGGAGGG + Intergenic
1186479020 X:9881716-9881738 TCGGGGAGGCAGAGGGAGGAAGG - Intronic
1186776047 X:12865642-12865664 GGAGGGAGCCAGAGGGAGGCAGG + Intergenic
1187097280 X:16161906-16161928 ATGGGGAGCCAGAAGGGGGATGG - Intergenic
1187138524 X:16571154-16571176 ATGGGGAGCCAGAAGGGGGATGG - Intergenic
1187248206 X:17573083-17573105 AAGGGCAGCCAGAGAAAGGTCGG - Intronic
1187427120 X:19188039-19188061 AAGGGGCCCCAGGTGGAGGAGGG - Intergenic
1187441852 X:19327955-19327977 GAAGGGAGCCGGAGGAAGGAGGG - Intergenic
1187480210 X:19648372-19648394 AAGGAGGGCAAGAGGGAGGAGGG + Intronic
1188368295 X:29336988-29337010 AAGGGGAGCCGGAGACTGGAGGG + Intronic
1188734585 X:33696728-33696750 AAGGGGAGAGAGAGGGAAGAGGG + Intergenic
1188744084 X:33820425-33820447 GAGGGGAGCAAGAGTGAGGGGGG - Intergenic
1189230795 X:39451036-39451058 AAGGGGAAGCAGAGGGAGGAAGG - Intergenic
1189376105 X:40467297-40467319 AACGGGAGCCAAAGGGTGGGGGG + Intergenic
1189511466 X:41666428-41666450 AGAGAGAGACAGAGGGAGGAAGG - Intronic
1189571415 X:42301924-42301946 GAGAGGAGAAAGAGGGAGGAGGG - Intergenic
1189675518 X:43456933-43456955 AAGGAGAGAGAGAGGAAGGAAGG + Intergenic
1189695819 X:43660650-43660672 AATGGGAGCCAGAGTGATCAAGG - Intronic
1189837332 X:45039210-45039232 ATGGGGAGGCAGAGGGGGGATGG - Intronic
1189846237 X:45141454-45141476 AGGGAGAGCGAGATGGAGGAGGG + Intergenic
1190057415 X:47189793-47189815 AAGGAGAGGGAGAGGGAGGGTGG - Intergenic
1190160919 X:48030782-48030804 AAGGGGAGCCAAAGGGAGGAAGG + Intronic
1190420208 X:50222671-50222693 AAGGGCAGCCAGAGAAAGGTCGG - Intronic
1190430758 X:50375935-50375957 AAGTGGAGCCGGAGGCTGGACGG - Intronic
1190619076 X:52266989-52267011 AAGGGGAGCCAGAGGGAGGAAGG + Intergenic
1190629320 X:52369326-52369348 AAGGGGAGCCAGATGAAGATAGG + Intronic
1190631293 X:52389432-52389454 ATGGGGAGCTAGAAGGTGGAGGG + Intergenic
1190637099 X:52446146-52446168 AAGGGGAGCCAGAGGGAGGAAGG - Intergenic
1190727458 X:53198931-53198953 AAGTGGGGCAAGAAGGAGGATGG - Intronic
1190734709 X:53248653-53248675 AAGGACAGCAAGAGGGAGGAAGG - Intronic
1191052963 X:56213969-56213991 AAGGGGAGCTAGAAAGGGGATGG + Intergenic
1191146047 X:57166185-57166207 ATGGAAAGCCAGAGGGGGGATGG - Intergenic
1191767117 X:64710013-64710035 AAGGGGAGCTGGAAGGGGGATGG + Intergenic
1191915568 X:66198155-66198177 AAAGGGAGAGAGAGGGAGGGAGG - Intronic
1191971307 X:66819751-66819773 GGGGGGTTCCAGAGGGAGGAGGG + Intergenic
1191974902 X:66861309-66861331 ATGGGGAGCCAGAAGGGGGATGG + Intergenic
1192098515 X:68239071-68239093 ATGGGGAGCCAGAAGGAGGATGG + Intronic
1192180754 X:68914345-68914367 GAGGGGAGCGGGAGGGGGGATGG - Intergenic
1193428368 X:81368949-81368971 AAGGTGAGTAAGAGTGAGGAAGG - Intergenic
1193508363 X:82370635-82370657 AAGGGGAGAGAGAGGGAGAGGGG + Intergenic
1193716226 X:84937409-84937431 AAGGGGAGATGGAGGGATGAAGG + Intergenic
1194579190 X:95650707-95650729 TATGGGAGCCAGAGGTCGGAGGG + Intergenic
1194988117 X:100513257-100513279 AAAGGGAGGGAGAGGGAGCAAGG - Intergenic
1195385884 X:104313290-104313312 AGGGGGACAAAGAGGGAGGAAGG - Intergenic
1195549461 X:106150616-106150638 AAGGGGGGAGGGAGGGAGGAAGG + Intergenic
1195640925 X:107174106-107174128 AGGGGGAGAGAGAGGGAGGGAGG - Intronic
1195751860 X:108167896-108167918 AAGGGAAGGAAGAGGGTGGAGGG - Intronic
1196058017 X:111377096-111377118 AAGTGGAGGCAGGAGGAGGAGGG - Intronic
1196242066 X:113353424-113353446 TGGGGGAGCCAGAAGGGGGATGG - Intergenic
1196706436 X:118721364-118721386 AAGGGGAGCAAGAGAGCGTAGGG + Intergenic
1196797709 X:119515555-119515577 AGGGGGAGAGAGAGGGAGGGAGG + Intergenic
1196913226 X:120505531-120505553 AAGGGAAGGGGGAGGGAGGAAGG - Intergenic
1197027585 X:121773507-121773529 AAGTGGGGAGAGAGGGAGGATGG - Intergenic
1197462094 X:126755318-126755340 AAGGGGAGCTAGAAAGGGGATGG + Intergenic
1197749068 X:129952673-129952695 AAGGAGAGCGGGAGGGAGGAGGG - Intergenic
1197862043 X:130981135-130981157 AAGGGTAGTGAGAGGGTGGAGGG + Intergenic
1198116491 X:133549740-133549762 AAAGAGAGAGAGAGGGAGGATGG - Intronic
1198258973 X:134949620-134949642 ATGTGAAGCCAGAGAGAGGAAGG - Intergenic
1198320296 X:135513334-135513356 CAGAGGGGCCAGAGAGAGGATGG - Intergenic
1198376464 X:136045096-136045118 TAGGGGAGGGAGAGTGAGGAGGG + Exonic
1198690523 X:139279117-139279139 AAGGGTAGTGAGAGGGAGGTGGG + Intergenic
1198843415 X:140882922-140882944 AAGGGTAGAGAGTGGGAGGAGGG + Intergenic
1199264780 X:145817805-145817827 GAGGGAGGCGAGAGGGAGGAGGG - Intergenic
1199296480 X:146164641-146164663 AGGGAGAGACAGAGGGAGGGAGG + Intergenic
1199303547 X:146240744-146240766 AAGGGGATAGGGAGGGAGGAGGG - Intergenic
1199432437 X:147776559-147776581 AAGGGAAGCTAGAAGGGGGATGG + Intergenic
1199794238 X:151179468-151179490 AGGGGGAGGGAGAAGGAGGAGGG - Intronic
1199936108 X:152575156-152575178 AAGGTGAGCCAGTGGGAGATAGG - Intergenic
1199966286 X:152823686-152823708 AAGGGGAGGAAGAGGGAGCAGGG - Intergenic
1200019178 X:153187854-153187876 AAGGGGAGTCTGAGGCAGGGTGG - Intergenic
1200052687 X:153443317-153443339 AGGGGGAGCAAGAGAGAGGCGGG - Intergenic
1200100509 X:153687575-153687597 AAGGGGAGGCGGAGGGCTGAGGG + Intronic
1200165577 X:154032939-154032961 AAAGGGAGCCAAATGGGGGAGGG + Intronic
1200179849 X:154143655-154143677 ATGGGGGGCAAGGGGGAGGAGGG + Intergenic
1200883074 Y:8240962-8240984 ATGGGGAGCCAGAAGGGAGATGG + Intergenic
1200910060 Y:8523971-8523993 ATGGGGAGCCAGAAGGAAGATGG - Intergenic
1200940573 Y:8775978-8776000 ATGGGGAGCCAGAAGGGAGATGG + Intergenic
1201539347 Y:15089510-15089532 AATGGGAGCAAGAAGAAGGATGG + Intergenic
1201550337 Y:15211591-15211613 AAGGTGAGAGAGAGGGAGGGAGG + Intergenic
1201741219 Y:17326096-17326118 AAGGAGAGAGGGAGGGAGGAGGG + Intergenic
1201890906 Y:18942829-18942851 GAGGGGAGACAGAGAGAGGAAGG + Intergenic
1202200009 Y:22336240-22336262 ATGGGGAGCCAGAAGGGAGATGG - Intronic
1202233324 Y:22678768-22678790 ATGGGGAGCCAGAAGGGAGACGG - Intergenic
1202309832 Y:23517390-23517412 ATGGGGAGCCAGAAGGGAGACGG + Intergenic
1202333472 Y:23779960-23779982 AAGGGCAGCCAGAGAGAAGGTGG - Intergenic
1202537297 Y:25890103-25890125 AAGGGCAGCCAGAGAGAAGGTGG + Intergenic
1202560969 Y:26153203-26153225 ATGGGGAGCCAGAAGGGAGACGG - Intergenic