ID: 1190643578

View in Genome Browser
Species Human (GRCh38)
Location X:52503970-52503992
Sequence AGGGAGAAGCGATTCTCTCG TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 78
Summary {0: 1, 1: 0, 2: 0, 3: 4, 4: 73}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1190643573_1190643578 27 Left 1190643573 X:52503920-52503942 CCTAGGAATTTGTGAGAGTATTG 0: 1
1: 1
2: 1
3: 11
4: 206
Right 1190643578 X:52503970-52503992 AGGGAGAAGCGATTCTCTCGTGG 0: 1
1: 0
2: 0
3: 4
4: 73

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1190643578 Original CRISPR AGGGAGAAGCGATTCTCTCG TGG Intergenic
902160539 1:14526850-14526872 ACCCAGAAGCGATTCTCTCCTGG + Intergenic
902896422 1:19483616-19483638 AGGAAGCAGCGATTCTCGCCAGG - Intronic
904336282 1:29800425-29800447 AAGGAGAAGGGAGTCTCTCAGGG - Intergenic
906124838 1:43421438-43421460 AGGGAGAAGAGAAGCTCTCAAGG - Intronic
909119435 1:71582585-71582607 AGTCAGAAGAGATTCTCTGGGGG + Intronic
912346470 1:108967752-108967774 AGGGAAAAGGGATTCTCTATAGG + Intergenic
917199200 1:172497574-172497596 AGGGAGAAACCCTTCTCTTGTGG + Intergenic
917345399 1:174023282-174023304 AGGCAGAAGTGCTTCTCTTGGGG - Intergenic
917373939 1:174327742-174327764 AGGGTGAAGTGAGTCTCTTGGGG - Intronic
917512134 1:175677444-175677466 AGGGAGAAGTCATCCTCACGAGG + Intronic
922018881 1:221683802-221683824 AGGGAGAAGTGACTCACTCAAGG - Intergenic
1065820657 10:29522371-29522393 AGCGAAAAGTAATTCTCTCGGGG - Intronic
1067833489 10:49623661-49623683 AGGGAGAGGCGAAGCTCTCCTGG - Intronic
1081268617 11:41057738-41057760 AGAGAGAAGCCATTCCCTCTAGG + Intronic
1092291527 12:7162277-7162299 GGGGAAAAGCGATGCTCTAGAGG + Intergenic
1096613395 12:52817672-52817694 GGGTAGAAGGGATTCTCTCTTGG + Intergenic
1104567403 12:129897622-129897644 AGGTAGAAGAGATTCTCTGATGG - Intronic
1117914046 14:60658450-60658472 ATTGAGAAGCGCTTCTCTTGTGG + Intergenic
1119590109 14:75878661-75878683 AGGGAGAAGCGATTTTATCTAGG + Intronic
1120255104 14:82108538-82108560 AGGGAGAAGAGCTTCTTTTGAGG + Intergenic
1120651680 14:87141191-87141213 AGGGAGAAGCTAGGCTCTGGAGG + Intergenic
1125421657 15:39510499-39510521 ATGGAGAAGGGCTTCTCTAGAGG + Intergenic
1135035312 16:19072200-19072222 AGGGAGATGCCATTGTCTCCAGG + Intronic
1137273163 16:46916376-46916398 AGGGAGAAGGGGTTCTCACCTGG - Intronic
1138118417 16:54378803-54378825 GGGGTGAAGCCATTCTCTGGTGG + Intergenic
1143731274 17:8884357-8884379 AGGGAGAAGCCAGGGTCTCGGGG - Intronic
1152786873 17:82252930-82252952 AGGGAGAGGCCAGCCTCTCGGGG - Intronic
1153069554 18:1089607-1089629 AGGGAGAAGGAATTCTCTAGCGG - Intergenic
1156229219 18:35137807-35137829 AGAGGGAAGCCATTATCTCGGGG + Intronic
1158862181 18:61603381-61603403 AGGGAAGAGCGATTCTGTTGAGG + Intergenic
1165481431 19:36066880-36066902 GGGGAGAAGCGCCTCCCTCGTGG + Intronic
1165520715 19:36311873-36311895 AGGGAGAAGCGATGCGCTCCTGG + Intergenic
1165623356 19:37266711-37266733 AGGGAGAAGCGATGCGCTCCTGG - Intergenic
931183781 2:59930093-59930115 AGGTGGAAGAGATTCTCTCCTGG - Intergenic
932586316 2:73031896-73031918 AGGTAGAAGCAAGTCTCTCCAGG + Intronic
939317305 2:140567435-140567457 AGGAAGAAAGGATTCTCTGGAGG - Intronic
943034966 2:182731961-182731983 AGGGAGAAGCAATTTACTTGAGG - Intronic
1170789174 20:19493787-19493809 AGGGCTAAGCCATTCTCTCAGGG - Intronic
1176515912 21:7783275-7783297 AAGGAGAAGCTGTTCTCTGGAGG - Intergenic
1178649940 21:34413287-34413309 AAGGAGAAGCTGTTCTCTGGAGG - Intergenic
1184197334 22:42938737-42938759 AGGGTGAAGCCCTTCCCTCGTGG - Intronic
950985051 3:17354432-17354454 GGGGAGAAGAGATTCTCCTGTGG - Intronic
952233213 3:31453421-31453443 AGGGAGCAGACATTCTCTGGAGG + Intergenic
952755415 3:36861567-36861589 AGGGATAAGCCATCCTCTCATGG - Intronic
953164249 3:40450464-40450486 AGGGAGAAGAGATGCTAACGTGG - Intergenic
954382255 3:50225902-50225924 GGGTTGAAGCGATTCTCTGGAGG - Intergenic
956602140 3:71033737-71033759 TGGGAGAAAGGATTCTCTCAGGG - Intronic
959333208 3:105033067-105033089 AGGGAGAAGTGATTCTTACTTGG - Intergenic
959434307 3:106295506-106295528 AGGGAGAAGCTATTCTCCTTGGG + Intergenic
962313274 3:134340893-134340915 AGGGAAAAGGGATTCTGTCAAGG + Intergenic
965030747 3:163363771-163363793 TGGGAGAAGAGATTGTATCGTGG - Intergenic
973857957 4:55032492-55032514 AAAGAGGAGGGATTCTCTCGTGG + Intergenic
976184611 4:82431088-82431110 AGGGAGAAGCTAGTGTCGCGAGG - Intronic
978964506 4:114725215-114725237 AGAGAGAAGCCACTCTCTCCAGG - Intergenic
985935195 5:3092256-3092278 AAAGAGAAGCGATTTTCACGAGG - Intergenic
987006743 5:13718215-13718237 AGGGACAAGAGAATCTCTCTAGG - Intronic
1003318449 6:5032239-5032261 AGGGATAAGCGGTTCCCTCAAGG + Intergenic
1004967807 6:20874608-20874630 AGGTTCAAGCGATTCTCTTGCGG + Intronic
1007779659 6:44245765-44245787 AGGGAGTGGCTATTCTCTCCTGG + Intergenic
1020440231 7:8209799-8209821 AGGGAGAAGGGAATTTCTGGTGG + Intronic
1020828433 7:13062296-13062318 AGGGAGAAGAGATTCTTACCAGG - Intergenic
1021289759 7:18828792-18828814 AGGGAGAAGAAATTCACTCTTGG - Intronic
1025969114 7:66305683-66305705 AGGGAGAAGTGCTTCTTTGGGGG - Intronic
1033982570 7:147184239-147184261 GGGGAGAAGTGTTTCTCTGGAGG + Intronic
1034191885 7:149219428-149219450 TGGGAGAAGAGAATCTCTTGGGG + Intronic
1036206927 8:6812211-6812233 AGAGAGAAGAGATTCTCCCCGGG - Exonic
1037294225 8:17383766-17383788 CGGGAGAACCGAGTCTTTCGGGG - Intronic
1049212778 8:141394418-141394440 GGGGAGAAACGGTGCTCTCGAGG - Intronic
1056170488 9:83980299-83980321 AGGGCGAAGCGATTGGCCCGAGG + Intronic
1062675746 9:137742679-137742701 AGGGAGAAGCAAATGTCTGGGGG - Intronic
1186497621 X:10024495-10024517 AGGGAGAACCGAATGGCTCGGGG - Intronic
1188038358 X:25343559-25343581 CTGGAGAAGCTATTCTCTCTAGG - Intergenic
1190630300 X:52379681-52379703 AGTGAGAAGTAATTCTCTCTTGG - Intergenic
1190643578 X:52503970-52503992 AGGGAGAAGCGATTCTCTCGTGG + Intergenic
1191221280 X:57990378-57990400 AGAGAGAAGCAATCCTCTCCAGG + Intergenic
1194735118 X:97503486-97503508 AGGGTGAAGGGATTTTCTCCAGG + Intronic
1199381451 X:147177347-147177369 AGGGAGAGGCCATTCCCTGGTGG + Intergenic
1201518210 Y:14841249-14841271 AGGGAAAAGCTATACTCTAGTGG - Exonic