ID: 1190645719

View in Genome Browser
Species Human (GRCh38)
Location X:52524422-52524444
Sequence CTGGCCATGGGAAGTGAGTC TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 273
Summary {0: 2, 1: 1, 2: 6, 3: 30, 4: 234}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1190645712_1190645719 2 Left 1190645712 X:52524397-52524419 CCGGCTACTGATCATGTGCCACC 0: 2
1: 0
2: 0
3: 8
4: 71
Right 1190645719 X:52524422-52524444 CTGGCCATGGGAAGTGAGTCTGG 0: 2
1: 1
2: 6
3: 30
4: 234

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1190645719 Original CRISPR CTGGCCATGGGAAGTGAGTC TGG Intergenic
900118720 1:1039664-1039686 CTGGTGATGGGACGTGTGTCAGG + Intronic
900477226 1:2881664-2881686 CTGGCCATGAGAAGGGAGGGTGG + Intergenic
901005876 1:6171284-6171306 CTGTCCATGGGCAGAGGGTCTGG - Intronic
901262178 1:7880783-7880805 CTGGCCTTGTGAAATGAGTTTGG - Intergenic
903827383 1:26155978-26156000 GTGGGCATGGGATGTGAGACTGG + Intergenic
904836190 1:33338714-33338736 CTGGTCAAGGGAATTGAGTAAGG - Intronic
905207735 1:36352514-36352536 GTGGCACTGGGAAGTGAGCCAGG + Intronic
906323814 1:44832142-44832164 CACTCTATGGGAAGTGAGTCTGG - Exonic
906922207 1:50076662-50076684 CTGGGCCTGGGAAGTGAGTCTGG + Intronic
907870818 1:58441168-58441190 CTGGCCATAGAAAGTGGGGCTGG + Intronic
908298196 1:62734441-62734463 CTGGCCATGAGCAGTGGCTCAGG + Intergenic
908747874 1:67393545-67393567 CTGGCCCTGGCACGTGGGTCTGG - Intronic
909601489 1:77466058-77466080 CGGGCCATGGTGAGGGAGTCGGG - Intronic
912156605 1:106928743-106928765 CTGGGGATGGGGAGTGAGTGGGG + Intergenic
914449994 1:147782827-147782849 GTGGACAAGGGAAGTGAGACTGG + Intergenic
917076183 1:171207467-171207489 CTGGAAAAGGGAAGTGTGTCTGG - Intronic
918235272 1:182574354-182574376 CTGGGTATGGGAAGTGAGGGAGG + Exonic
919534888 1:198775118-198775140 CTTGCAATGAGAAGTCAGTCAGG + Intergenic
920089854 1:203444737-203444759 CTGGCCATGCAAAATAAGTCCGG + Intergenic
920742209 1:208591739-208591761 CTGGCCATGGTTGGTAAGTCAGG - Intergenic
922901836 1:229143262-229143284 CAAGCCCTGGGAAGAGAGTCTGG + Intergenic
924575497 1:245277254-245277276 AGGGACATGGGAAGTGAGTTTGG + Intronic
1063657857 10:8009585-8009607 CTGGCCAGGGGCAGTGGCTCAGG - Intronic
1065747684 10:28857211-28857233 ATGGACATGGGAGGTGAGGCAGG - Intronic
1065901644 10:30213489-30213511 CTGGCCCTTGGATGTGAGTTAGG - Intergenic
1067552647 10:47246364-47246386 CTGGACTTGGGAAGGGAGTCAGG - Intergenic
1067741114 10:48896824-48896846 CTGGACAAGGTAACTGAGTCAGG - Intronic
1069657799 10:70103013-70103035 CTTGCTTTGGGCAGTGAGTCTGG - Intronic
1070543483 10:77434438-77434460 CTGGCCTTGAGATGTGTGTCGGG - Intronic
1071514006 10:86285082-86285104 CTGGCCATGGGGGGTGGGTTGGG - Intronic
1072569789 10:96648521-96648543 CTGGCCATGGGCAGTATGTGTGG - Intronic
1075002877 10:118810850-118810872 CTGGGCAGGGAAAGTGAGGCAGG - Intergenic
1075822803 10:125329155-125329177 CTGACCAAGGGAAGAGAGGCTGG - Intergenic
1076338260 10:129725135-129725157 GTGGCCTTGGGAGGTGAGTGTGG + Intronic
1076384337 10:130045987-130046009 CTGGGCATGGGAGGTGGGGCTGG + Intergenic
1076815219 10:132911244-132911266 CTGGCCCTGGGCAGTCAGTGTGG - Intronic
1077192086 11:1259811-1259833 CTGGCCATCGGGCGTGAGGCAGG - Exonic
1078098380 11:8313978-8314000 CTGCCTATGGGATGTGATTCTGG - Intergenic
1079314062 11:19392655-19392677 CTGTTCATTGGGAGTGAGTCTGG + Intronic
1079515007 11:21257087-21257109 CTGGCAGTGGGAAGTCAGGCAGG + Intronic
1083529064 11:63400650-63400672 CTGGCCTTGTGAAATGAGTTTGG - Intronic
1083654758 11:64224275-64224297 CTGGCTCTGGCAGGTGAGTCTGG - Exonic
1085452017 11:76639860-76639882 CTGGCCATGTGAGGTGAGCCTGG + Intergenic
1088417461 11:109605485-109605507 CAGTCCTAGGGAAGTGAGTCTGG + Intergenic
1089289663 11:117430018-117430040 CTGGCCATGCTAATTGAGGCAGG - Intronic
1090071615 11:123549176-123549198 GTGGCCATAGGAAGTGAAGCAGG - Intronic
1090587168 11:128225855-128225877 CTCCCCATGGGAAGTGCATCTGG - Intergenic
1090920670 11:131203612-131203634 GTTGCCATGGGAGGTGGGTCAGG - Intergenic
1091696862 12:2633490-2633512 CTGGCCATGGTGAGGGCGTCCGG + Intronic
1091771409 12:3154249-3154271 CTGCCCTTGGGAAGGCAGTCAGG + Intronic
1091886108 12:4018248-4018270 CTGGCCATGGGAATCAAGACTGG - Intergenic
1094487561 12:30937147-30937169 CTGGCAATTGGAAGTGACTTTGG + Intronic
1097084653 12:56458343-56458365 CTGGCCAGGTGCAGTGACTCAGG - Intronic
1100253955 12:92862312-92862334 CTGGCCAGGCGCAGTGACTCAGG + Intronic
1102433632 12:112903079-112903101 CTGGCCAGGAGCAGTGATTCAGG - Intergenic
1103152380 12:118651971-118651993 CTGTCAATGGGAAGTGAGGAGGG + Intergenic
1103885363 12:124196404-124196426 CTGGCCTTGGGAAATAACTCGGG - Intronic
1104842144 12:131830353-131830375 CTGGCCGGGGGCAGTGAGTGGGG + Intronic
1105897226 13:24726579-24726601 CTGGCCAAGGGAAGCAAGTTTGG - Intergenic
1108756560 13:53510154-53510176 CTGGCAATTGGAAGTCTGTCAGG + Intergenic
1110479653 13:75959529-75959551 CTGGCCCTCGGAGCTGAGTCAGG + Intergenic
1110682492 13:78332902-78332924 CTTACCATGGGAAGTGTTTCTGG + Intergenic
1112280164 13:98055988-98056010 AGGGACATGGGAAGTGAGGCGGG + Intergenic
1114418543 14:22560160-22560182 CCAGCCATGGGGAGTGTGTCTGG - Intergenic
1114866581 14:26601801-26601823 TAGGACATGGGAAGTGAGGCAGG + Intergenic
1117231881 14:53728071-53728093 CTTGCAATGGGAAGAGAGGCTGG - Intergenic
1118505130 14:66402906-66402928 CTGGAATTGGAAAGTGAGTCTGG - Intergenic
1119266872 14:73267941-73267963 CAGGCCCTGAGAAGTGAGTAGGG - Intronic
1119336359 14:73836889-73836911 CTGGCCCTGGGTACTGAGACTGG - Intergenic
1119749141 14:77065148-77065170 CTGGCCTTGTGATCTGAGTCTGG - Intergenic
1119917076 14:78412166-78412188 CTTCCAATGGCAAGTGAGTCAGG - Intronic
1120739553 14:88092540-88092562 CTGGACAAGGGAAGTGTGTGAGG + Intergenic
1122409596 14:101519097-101519119 CTGCCCACAGGAAGTGAGGCTGG + Intergenic
1126108635 15:45162928-45162950 CTGGGCCTGGCAGGTGAGTCAGG + Intronic
1126217240 15:46170216-46170238 CTGGCCATTGGAAATCAGGCTGG - Intergenic
1128326552 15:66727568-66727590 CTGGGAATGGGGAGTGATTCTGG + Intronic
1128332195 15:66763204-66763226 CTGACCTTGGGCAGGGAGTCAGG - Intronic
1128705713 15:69836326-69836348 CTGGCCACGGGCAGTGAGGCAGG - Intergenic
1128840832 15:70850345-70850367 CTGGCCTTGTGAAATGAGTTTGG - Intronic
1128866282 15:71117073-71117095 CTGGGCCTGGGAAATGAGTTTGG + Intronic
1129742688 15:77997458-77997480 CTGGCCATGAGAAGTGAGGGTGG + Exonic
1129842784 15:78753988-78754010 CTGGCCATGAGAAGTGAGGGTGG - Intergenic
1131423170 15:92324499-92324521 CTGGCCATTGGATGTGAGCCTGG + Intergenic
1131678531 15:94697347-94697369 CTGGGCCTGGGAAGAGTGTCTGG + Intergenic
1131789030 15:95944354-95944376 CTGGCCATGGCAACTGAAGCTGG - Intergenic
1133308958 16:4830436-4830458 CTGGCCATGGTCAGGGAGTCTGG - Intronic
1133644029 16:7745971-7745993 CTGGCCATGGCATTTGAGTGAGG - Intergenic
1133997466 16:10759276-10759298 GCGGCCATGGGAAGGGTGTCCGG + Intronic
1134363284 16:13552765-13552787 CTGACCTTGTGAAGTGGGTCTGG - Intergenic
1135821226 16:25688313-25688335 CTGGCCATGCGATGTGACTGTGG + Intergenic
1136990082 16:35146679-35146701 CTGGCTAAGGGGAGTAAGTCCGG + Intergenic
1137871010 16:51950300-51950322 CTGGGCCTGGGCAGAGAGTCTGG - Intergenic
1138474339 16:57261887-57261909 CTGGCCACTGGTGGTGAGTCTGG - Exonic
1140479725 16:75256166-75256188 CTGGCCATGGGAGCTGCGTGGGG - Intronic
1142431560 16:90031276-90031298 CTGGCCAGGTGCAGTGGGTCAGG - Intronic
1142502647 17:341038-341060 CTGGGCAGGGGCAGTGAGTGTGG - Intronic
1142502669 17:341108-341130 CTGGGCAGGGGCAGTGAGTGTGG - Intronic
1143024977 17:3936257-3936279 CTGGCTATCGGAGGTGAGTGGGG - Exonic
1143502410 17:7347082-7347104 ATGGCCAGGGGAAGGGAGCCTGG + Exonic
1144486539 17:15670272-15670294 CTGGGCCTGGGAATAGAGTCTGG - Intronic
1144914480 17:18712018-18712040 CTGGGCCTGGGAATGGAGTCTGG + Intronic
1145973353 17:28969873-28969895 TTGGCCAGGGGCAGTGGGTCAGG + Exonic
1145976340 17:28986339-28986361 TGGGCCCTGGGAAGTGAGGCGGG - Intronic
1146287954 17:31586994-31587016 CTGGGCATGGGACTTAAGTCTGG + Intergenic
1147286647 17:39407818-39407840 CTGGACAGTGAAAGTGAGTCAGG - Exonic
1147936551 17:44014638-44014660 CTGCCCATGGGAGGGGAGTCTGG - Intronic
1148511874 17:48177939-48177961 CTGCCCATTGGAAGTGAGGAAGG - Intronic
1151821109 17:76497393-76497415 CTGGCCAAGGGAAGTGAGGGTGG - Intronic
1151830175 17:76544864-76544886 CTGCCCTGGGGAAGTGCGTCTGG - Intronic
1152183346 17:78839315-78839337 CTGGGGATGGGAAGTGACTCAGG - Intronic
1152284871 17:79406527-79406549 CCGGCAATTAGAAGTGAGTCAGG - Intronic
1153191624 18:2547124-2547146 CTGGCTTTGGGAAGTCAGTCTGG - Intronic
1155928219 18:31680236-31680258 CTGGCCCTGGCAAGTGGGCCTGG - Intronic
1157481708 18:48059531-48059553 CTGGCAATGGGTTGTGAGTCAGG - Intronic
1157905378 18:51564812-51564834 CTGAACTTGGGAAGGGAGTCAGG - Intergenic
1158397734 18:57092779-57092801 CTGGCCATGGTGATTGACTCAGG - Intergenic
1159821822 18:73155107-73155129 CTGGCCATGGGAATGGACACAGG - Intronic
1161307337 19:3575344-3575366 CGGGGCATGGGAAGTGAGGTGGG + Intronic
1162065621 19:8123698-8123720 CTGGAGATGGGAAGTGTGTTTGG - Intronic
1162370661 19:10277119-10277141 CTGGCTATGAGAAGAGAGGCTGG + Intronic
1162729105 19:12706920-12706942 CTGGCTCTGTGAAATGAGTCTGG - Intronic
1162948340 19:14056805-14056827 CTGGGCAGGGGAAGGGAGTTGGG + Intronic
1163652500 19:18526476-18526498 CTGGCCTTGAGCAGTGACTCAGG - Intergenic
1163726200 19:18924491-18924513 GTGGCCATGAGAAGTCAGACCGG - Intronic
1164562115 19:29299596-29299618 CTGGCCGTGGGAAGGGAGTAGGG - Intergenic
1164939709 19:32243241-32243263 CTGGCCATGGGAGGCCATTCAGG + Intergenic
1165830959 19:38729930-38729952 CTGGCAATGGCAAGTGAGTCTGG - Exonic
1165834896 19:38748314-38748336 CTGGCCAGGTGCAGTGGGTCAGG - Intronic
1166109073 19:40611800-40611822 ATGGCCATGGGAATGGATTCAGG + Intronic
1166975141 19:46601429-46601451 CTCGCCATGGTGAGTGAGGCTGG + Exonic
1166978844 19:46621104-46621126 CTGGCTCTGGGAAGAGAGTGAGG - Exonic
1167420688 19:49401262-49401284 CTGGCCTGGGGAAATGAGGCAGG - Intronic
926472897 2:13283515-13283537 CTTGCCATAGGTAGTGTGTCTGG - Intergenic
927359338 2:22214415-22214437 CTGGCCATGTAAAATGAGTTTGG - Intergenic
927750618 2:25666840-25666862 CTGGCCTTGAGCAGTGGGTCTGG - Intronic
928219825 2:29394517-29394539 CTGGGCAGGGGAAGTGAGAGGGG + Intronic
932276377 2:70454986-70455008 CTGGCCATGAGAAGCAAGGCTGG + Intronic
933780863 2:85799912-85799934 CTGGCGCTGTGCAGTGAGTCCGG - Intergenic
937079222 2:119128379-119128401 GTGGCCAGGGCAAGTCAGTCCGG + Intergenic
937274516 2:120675343-120675365 CTGGGCTTGGGAAGTGAGTCAGG - Intergenic
938797970 2:134734699-134734721 CTGGGCATGGGGAGAGTGTCAGG - Intergenic
940375230 2:152950284-152950306 CTGGCCACAGGAATTGAGTCAGG - Intergenic
941712302 2:168727022-168727044 CTGGCCATGGGAAGAGGTTCTGG - Intronic
942556903 2:177181166-177181188 CTGGCCATGTGCAGTGACTCAGG + Intergenic
943281661 2:185942586-185942608 CTGACCATGAGAGGAGAGTCAGG + Intergenic
944913507 2:204333679-204333701 GAGGCCATGGGAGGTGGGTCAGG - Intergenic
945058002 2:205884874-205884896 GTGGACCTGGGCAGTGAGTCCGG - Intergenic
946710856 2:222503910-222503932 CTGGCCATAGGAATTGACTGGGG - Intronic
947933917 2:233987004-233987026 CTAAGAATGGGAAGTGAGTCAGG - Intronic
948311989 2:236994144-236994166 AGAGCCATGGCAAGTGAGTCGGG - Intergenic
948420964 2:237859751-237859773 CTGGCCAGGGGAAGGGAGCTCGG - Intronic
1168758707 20:333877-333899 CTGGCGATGGACAGTGAGTCTGG + Intergenic
1169710214 20:8552774-8552796 CTAAACATGGGTAGTGAGTCTGG - Intronic
1170742835 20:19073084-19073106 CTGGCCATGAGATGTGGGACAGG + Intergenic
1171867371 20:30497279-30497301 CGGGACATGGGATGTGAGTGGGG + Intergenic
1173252615 20:41372566-41372588 CTGACCAGGGAAAGGGAGTCTGG - Intergenic
1173875748 20:46370250-46370272 CTGGCCATGGTTGCTGAGTCTGG + Intronic
1175969174 20:62675306-62675328 CTGGACCTGGGAAGGGAATCTGG - Intronic
1176271010 20:64235516-64235538 CTGGCCATGGTATGTGACCCGGG + Intronic
1176514660 21:7775069-7775091 CTGGCCTTGGGAAGTGGGGTGGG - Intergenic
1178648773 21:34405593-34405615 CTGGCCTTGGGAAGTGGGGTGGG - Intronic
1180932039 22:19598720-19598742 CACGCCCTGGGAAGTGAATCAGG + Intergenic
1183686726 22:39365284-39365306 CTGGCCTTAGCAAGTGACTCAGG + Intronic
1184119331 22:42440140-42440162 CTGGGCATGGCCAGTGAGTGAGG + Intergenic
1184816918 22:46879350-46879372 CTTGCCGTTGGAAGTGAGTTTGG + Intronic
949408485 3:3739343-3739365 CAGGCCATGGAAACTCAGTCAGG - Intronic
949599209 3:5580295-5580317 CTGGCCACAGCAAGAGAGTCAGG - Intergenic
950323095 3:12076533-12076555 ATGACCATGGGAAGTGAGAATGG + Intronic
950339010 3:12224965-12224987 CCTGCCATGGGATGTGAGTGTGG + Intergenic
950556839 3:13701152-13701174 CTGGCCTTGGGAAGTCTCTCTGG - Intergenic
950673169 3:14539358-14539380 CTTGCCATGGGAAGGGAGGTGGG + Intronic
951891512 3:27572192-27572214 CTGGCCAAGGGAAGAGTGTATGG - Intergenic
951905274 3:27700192-27700214 CTGGCCAGGCGCAGTGACTCAGG - Intergenic
952230083 3:31420527-31420549 CTGGCCAAGGGAGGTGAGTGAGG - Intergenic
953715796 3:45316047-45316069 CTGGCCATTGGATCTGACTCTGG - Intergenic
953908578 3:46881150-46881172 GAGGCCCTGGGAAATGAGTCTGG - Intronic
954026158 3:47784978-47785000 CTGGCCATGGTGGCTGAGTCAGG + Intergenic
955406120 3:58626918-58626940 CTGGTCATGGGAAGGGAGACTGG - Intronic
956236878 3:67082396-67082418 GAGGACATGGGGAGTGAGTCAGG + Intergenic
961745641 3:129062086-129062108 CGGGCCATGGGCAGCGAGGCTGG - Exonic
962018542 3:131471000-131471022 CTGGCTCTGGGAAATGAGTGAGG + Intronic
962450678 3:135513974-135513996 CTGGGGAGGGGCAGTGAGTCTGG - Intergenic
964616606 3:158672917-158672939 CTGTCCATGGGAAAAAAGTCTGG + Intronic
966916680 3:184588086-184588108 AAGGCCATGGGAGGTGAGGCTGG - Intronic
967618216 3:191599864-191599886 CTGGCCATGAGATTTGAGTGGGG - Intergenic
969254362 4:5992352-5992374 CGAGCCATGGGAGGTGAGTTGGG + Intergenic
969619727 4:8273018-8273040 CTTGCCGTGGGAAATGAGACAGG - Intronic
970144219 4:13016597-13016619 CTGGCCTTGTCAAATGAGTCTGG - Intergenic
971446751 4:26758513-26758535 CTGGCCATGGGGATTGCTTCAGG + Intergenic
972647122 4:40979681-40979703 CTGGGGATGGAAAGTGAGCCTGG + Intronic
973576725 4:52297160-52297182 CTGGCCATGGGTAGAGGGACAGG - Intergenic
973835396 4:54804342-54804364 CTGGCCTAGGGAAGTGGGTTTGG - Intergenic
978050990 4:104200019-104200041 CTGGCCATGTAAAATGAGTTAGG + Intergenic
979058473 4:116024992-116025014 CTGGCAGTTGGAAGTTAGTCTGG - Intergenic
979099904 4:116600121-116600143 CTGGCAATGGCAAGTGAGTCTGG - Intergenic
982869021 4:160552369-160552391 TTTGCCATGGGAAGTGTTTCTGG + Intergenic
983859829 4:172691665-172691687 GTGGCCTTGGGGAGTGAGGCAGG - Intronic
983976395 4:173939517-173939539 CTGGGCTTGGGAAGGGAGTCGGG + Intergenic
984093041 4:175398647-175398669 TTGGCCTTGAGAAGTGAGTTTGG - Intergenic
984908134 4:184648984-184649006 CTGGCCAGGGGAACCGAGCCCGG - Intronic
985517366 5:353984-354006 GTGGCCAGGTGAAGTGTGTCTGG + Intronic
990603540 5:57384913-57384935 CTGGCCAAGAGAAGTGAGTATGG + Intergenic
991946854 5:71906478-71906500 CTGGAGATGGGCAGTGAGGCTGG + Intergenic
992679204 5:79136375-79136397 ATGGCCATGGGAAGTGGCTTGGG - Intronic
993190175 5:84670810-84670832 GTAGCCATGGGAGCTGAGTCCGG + Intergenic
995305010 5:110635321-110635343 CTGGCCTTGGGAAATGTGTTAGG - Intronic
997914951 5:137915250-137915272 CTGGCCATGTAAAATGAGTTTGG + Intronic
1000021205 5:157320873-157320895 CTGGCCATGGGCAGTGGGACTGG + Intronic
1000310508 5:160039147-160039169 GTGGCCAGGGGCACTGAGTCAGG - Intronic
1002399122 5:178981421-178981443 CCCACCATGGGAAGCGAGTCTGG + Exonic
1010989005 6:82458502-82458524 CTGCACAGGAGAAGTGAGTCAGG + Intergenic
1012332816 6:98014931-98014953 CTGGCCATGGCTATTGTGTCTGG - Intergenic
1013735458 6:113221970-113221992 CCGGCCAGAGGAAGTGAGGCTGG + Intergenic
1015374372 6:132492917-132492939 CTGGGCATGGGAGGAGAGTGGGG - Intronic
1016702333 6:147067614-147067636 CTGGTGATGGGGAGTGGGTCAGG + Intergenic
1018748384 6:166780352-166780374 CTGGCCATGGGGAGAGAGATGGG + Intronic
1018948642 6:168364460-168364482 GTGGCCCTGGGAGGTGACTCTGG + Intergenic
1020490664 7:8779965-8779987 CTTGCAGTGGGAAGTGATTCAGG + Intergenic
1020916287 7:14197952-14197974 CTGCCCAAGGGAAATGAGTCTGG + Intronic
1023004884 7:35853428-35853450 CTGGGCGGGGGAAGTGGGTCAGG + Intronic
1025143414 7:56484154-56484176 CTTGCCATGGGAAGTGAGTCGGG + Intergenic
1025259048 7:57404983-57405005 CTTGCCATGGGATGTGAGTCCGG + Intergenic
1025609802 7:63068171-63068193 CTTGCCATGGGATGTGAGTCCGG - Intergenic
1025710171 7:63901026-63901048 CTTGCCAAAGAAAGTGAGTCCGG + Intergenic
1025712650 7:63926794-63926816 CTGGCTAAGGGGATTGAGTCCGG + Intergenic
1025723460 7:64037098-64037120 CTCTCCATGGGGAGTGAGTTTGG - Intronic
1027170166 7:75866334-75866356 CAGGGCATGGGAAGCGAGACAGG - Intronic
1030098174 7:105920021-105920043 TAGGCCATGGGAAGTAAGACTGG + Intronic
1030812765 7:113995063-113995085 CTGGCCTTGTGAAATGAGTTTGG - Intronic
1035170606 7:157015347-157015369 CTGGCCATGCGAGAGGAGTCGGG - Intergenic
1035678085 8:1468873-1468895 ATGGACACGGGAAGAGAGTCTGG - Intergenic
1036120427 8:6011820-6011842 TTGGACATGGGAAGTGAAACGGG - Intergenic
1036753338 8:11456786-11456808 CTGGCTAAGGGAAGTGAGTGGGG + Intronic
1037938527 8:22931492-22931514 GTGGTCATGGGAAGGGAGGCTGG - Intronic
1038442840 8:27583887-27583909 CTGTCCCTGGGGAGTGAGCCAGG + Intergenic
1043780671 8:84330715-84330737 CTGGACAAAGGAAGTGAGTCGGG - Intronic
1044129560 8:88505116-88505138 CAGGCCAGGGGCAGTGACTCAGG + Intergenic
1044682834 8:94799382-94799404 CTGGCCATCTGAAGTGGGTCTGG + Intergenic
1044731017 8:95228845-95228867 CTGGCCAGGGGACGTGGGCCAGG - Intergenic
1046756470 8:117977778-117977800 CTGGTCATGGGTAGTGGGTATGG - Intronic
1047042124 8:121007716-121007738 GTGGGCATGGGAAGTGGGTTGGG + Intergenic
1047577738 8:126176436-126176458 CTTGAGATGGGAAGTGAGGCAGG + Intergenic
1047596427 8:126382176-126382198 ATGGCCATGGCATGTGAGCCTGG - Intergenic
1048423931 8:134305180-134305202 CTGGCCACTGGAAGTTAGGCTGG + Intergenic
1048799709 8:138184566-138184588 CGGGCCATAGGAAGGCAGTCTGG + Intronic
1048921944 8:139239431-139239453 CTTGACATGGGAAGGGAGTGAGG - Intergenic
1049439444 8:142602519-142602541 ATGGACATGGGAAGGGACTCAGG + Intergenic
1049769995 8:144375324-144375346 CTGGGCAGGGTAAGTGGGTCTGG - Intronic
1049921859 9:372346-372368 ATGGGAATGGAAAGTGAGTCTGG - Intronic
1051524044 9:18022444-18022466 CTGGCTATGGGAAGTGGGTGAGG + Intergenic
1051814912 9:21094197-21094219 CTGACCATGGGTAGTGACTGTGG + Intergenic
1056828233 9:89891425-89891447 CTGGCCATGAGAAGGGAGGCTGG + Intergenic
1057779153 9:98035660-98035682 TTGGCCATGGGACCTGAGGCAGG + Intergenic
1058522463 9:105824809-105824831 CTGGCCTTGAGAAATGAGTTTGG + Intergenic
1058707346 9:107648311-107648333 CAGGCCATGGGCCGTGGGTCTGG - Intergenic
1060074531 9:120579800-120579822 CTGGCCAGGGGCAGTGTGTGGGG - Intronic
1060590045 9:124810851-124810873 GTGGCCCTGGGAAGGGAGACTGG - Exonic
1060873481 9:127061824-127061846 CTGGCGGTGGGCAGAGAGTCAGG - Intronic
1061105738 9:128528981-128529003 CAGGCAATGAGAAGTGAGTCGGG - Intronic
1061974227 9:134060313-134060335 CAGGCCATGCGCAGTGACTCAGG + Intronic
1062218620 9:135402612-135402634 CTCGCCATGGGGAGTGCCTCTGG + Intergenic
1062464788 9:136676199-136676221 CAGGGCATGGGCAGTGGGTCTGG - Intronic
1187749824 X:22450006-22450028 CTGGCCATGAGCAATGAGTTGGG - Intergenic
1189074562 X:37902753-37902775 CTGGCCATGGTAATTGTTTCAGG + Intronic
1189555914 X:42145212-42145234 CTGGCATTGGCAAGTGAGTCAGG - Intergenic
1190474447 X:50813366-50813388 CCGGCCGTGGGAAGTGTGGCTGG + Intronic
1190641953 X:52488444-52488466 CTGGCCATGGGAAGTGAGTCTGG - Intergenic
1190645719 X:52524422-52524444 CTGGCCATGGGAAGTGAGTCTGG + Intergenic
1193266420 X:79476291-79476313 CTGGCCTTGTGAAATGAGTTTGG + Intergenic
1196934228 X:120713683-120713705 CTGGCCAGTGAAAGTGAGGCAGG + Intergenic
1197369358 X:125607281-125607303 CTGACCTTGGGAAATGAGTGTGG + Intergenic
1200086849 X:153611319-153611341 AGGCCCATGGGATGTGAGTCTGG - Intergenic
1200162984 X:154018784-154018806 CTGGCTGTGGGAAGAGAGCCTGG + Exonic