ID: 1190646975

View in Genome Browser
Species Human (GRCh38)
Location X:52531662-52531684
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 332
Summary {0: 2, 1: 0, 2: 0, 3: 30, 4: 300}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1190646975_1190646980 -8 Left 1190646975 X:52531662-52531684 CCCTGCTCCATCATTTTCTGTAG 0: 2
1: 0
2: 0
3: 30
4: 300
Right 1190646980 X:52531677-52531699 TTCTGTAGAGCAGGGCCAAGAGG 0: 2
1: 0
2: 23
3: 24
4: 175
1190646975_1190646982 -6 Left 1190646975 X:52531662-52531684 CCCTGCTCCATCATTTTCTGTAG 0: 2
1: 0
2: 0
3: 30
4: 300
Right 1190646982 X:52531679-52531701 CTGTAGAGCAGGGCCAAGAGGGG 0: 2
1: 0
2: 4
3: 20
4: 204
1190646975_1190646983 -5 Left 1190646975 X:52531662-52531684 CCCTGCTCCATCATTTTCTGTAG 0: 2
1: 0
2: 0
3: 30
4: 300
Right 1190646983 X:52531680-52531702 TGTAGAGCAGGGCCAAGAGGGGG 0: 2
1: 20
2: 3
3: 30
4: 262
1190646975_1190646981 -7 Left 1190646975 X:52531662-52531684 CCCTGCTCCATCATTTTCTGTAG 0: 2
1: 0
2: 0
3: 30
4: 300
Right 1190646981 X:52531678-52531700 TCTGTAGAGCAGGGCCAAGAGGG 0: 2
1: 0
2: 4
3: 20
4: 227

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1190646975 Original CRISPR CTACAGAAAATGATGGAGCA GGG (reversed) Intergenic
902709530 1:18229196-18229218 CTGGAGGAAGTGATGGAGCATGG + Intronic
903363642 1:22792813-22792835 CTACAGACAGTGAAGGTGCAGGG + Intronic
903457680 1:23499206-23499228 CTCCATAAAATGAGGGGGCATGG + Intergenic
903991687 1:27275633-27275655 ATAAAGAAAAAGATGGAGCGGGG + Intronic
905746078 1:40419063-40419085 CAACTGAAAATGAAGGAGGAGGG + Intronic
905932686 1:41800728-41800750 CTATAGAAAATGCAAGAGCAAGG + Intronic
905961695 1:42048292-42048314 CTTCAGCAGAGGATGGAGCAAGG + Intergenic
908618466 1:65949331-65949353 CTGTAGCAAATGATGGAGGAAGG - Intronic
909398499 1:75197825-75197847 CTACACAAACTCATGGAACAGGG + Intergenic
909455355 1:75843386-75843408 CTACAGAAAACGAAGGGGTAAGG + Intronic
909896399 1:81075827-81075849 CTACAGAAAATGAAGGAAAATGG - Intergenic
911174985 1:94809812-94809834 TTACAAAAAATGATGGTGTATGG - Intergenic
911361815 1:96885982-96886004 CTAGAGAAAAACCTGGAGCAGGG - Intergenic
912333459 1:108841213-108841235 AGAAATAAAATGATGGAGCAAGG + Intronic
913111908 1:115664528-115664550 CTCCCAAAAATGATGGAGAAAGG + Intronic
914873962 1:151498657-151498679 CTCCAGACAACGATTGAGCATGG - Intergenic
914943427 1:152042745-152042767 CTCCACAAAATCAAGGAGCAAGG + Intronic
916190723 1:162175457-162175479 CAACAAACAATGATGGGGCAAGG - Intronic
916590757 1:166187890-166187912 CTACAGAAAATAAAAGAGAAAGG - Intergenic
916626651 1:166565335-166565357 CTATGGAGAAAGATGGAGCAGGG - Intergenic
917071586 1:171157336-171157358 CTAAAGCAAATGATAGAGGAAGG + Intronic
917442721 1:175081167-175081189 GTACAGAACAAGATGGAGGATGG + Intronic
918796949 1:188911758-188911780 CTATAGAAAATAAAGTAGCATGG + Intergenic
919041816 1:192398549-192398571 CTACACAGAAAGATGGAGGAAGG + Intergenic
919463380 1:197904268-197904290 CCACAGACAAAGATGAAGCAAGG - Intronic
920986561 1:210896140-210896162 TTACATAAAATGGGGGAGCATGG - Intronic
921253201 1:213316663-213316685 CTACAGAGAAAAATAGAGCAAGG + Intergenic
921915589 1:220606902-220606924 CTACAGTAACTGAAAGAGCATGG - Intronic
922057740 1:222057479-222057501 CTCCAGAAAAAGATGTAGCATGG - Intergenic
922205416 1:223442218-223442240 CTAAGGAAAGGGATGGAGCATGG - Intergenic
923310500 1:232730106-232730128 ATACAAAAATTAATGGAGCATGG + Intergenic
923774634 1:236967413-236967435 CTACAAAAGATGAGGGAGCTTGG + Intergenic
1063815768 10:9769487-9769509 ATACAGATAATGGTGGAACAGGG + Intergenic
1064007841 10:11712603-11712625 CTGCAGAAAATGTGGGGGCAGGG - Intergenic
1064399028 10:15005381-15005403 CAACAGATAAGGATGCAGCATGG + Intergenic
1064979500 10:21151852-21151874 CTATAGAGAAAAATGGAGCAGGG - Intronic
1064985674 10:21207642-21207664 CTGCAGGAGATCATGGAGCAGGG + Intergenic
1065841897 10:29709091-29709113 CCACAGAAAAATATGGGGCAGGG + Intronic
1066345088 10:34577021-34577043 TCAGAGAAGATGATGGAGCAAGG - Intronic
1068059952 10:52054702-52054724 TTACAAAAAATGATGCAGGAGGG + Intronic
1068236868 10:54247456-54247478 CTACAGAAATTCAGAGAGCAAGG - Intronic
1071270716 10:84004530-84004552 CTGCAGCAAATGAAGGAGTAAGG - Intergenic
1073654049 10:105393205-105393227 ATAGAGAAAAGGAGGGAGCAAGG + Intergenic
1079513229 11:21235501-21235523 CTATAGAGACTGATGGAGCGGGG + Intronic
1081249253 11:40809515-40809537 CTATAGAAAAAAATGCAGCAGGG - Intronic
1081301327 11:41456149-41456171 CAACAGAAAATGAAGGATCTTGG - Intronic
1082894174 11:58172603-58172625 CTCCAGAAAGTGATGGAGCCAGG + Intronic
1084812620 11:71623475-71623497 CAACAGATAAGGATAGAGCATGG - Intergenic
1086946226 11:92846400-92846422 CTACAGTAAATGCTAGGGCATGG + Intronic
1088621521 11:111689276-111689298 CTACTGAAAATTATAGGGCATGG + Intronic
1090536061 11:127643188-127643210 TTACAGTAAATGATGGTGCCTGG - Intergenic
1091360404 11:134974781-134974803 ATCCAGAAAAGGATGGTGCAGGG + Intergenic
1092642875 12:10536650-10536672 CTACAAAAAATCAAGGAGGAGGG + Intergenic
1092695039 12:11162169-11162191 CCTCAGAAAATGATGGATAAGGG + Intronic
1093182258 12:15980285-15980307 CCACAGGAAATGATGGAGTTGGG + Intronic
1093933816 12:24980388-24980410 CTACAGAAAATCATAGAGGAAGG + Intergenic
1094035537 12:26066442-26066464 CTACAGATAATGACGGAGAAAGG - Intronic
1095271244 12:40221905-40221927 CTTCAGAAATTGATAGAGAAAGG + Intronic
1096564378 12:52465396-52465418 CCACAGAAAATGATAAAGCAGGG + Intergenic
1097860105 12:64510347-64510369 CTACACAGAAGGGTGGAGCAAGG - Intergenic
1098422032 12:70308216-70308238 CTACATAGAATGATGGAACAGGG - Intronic
1098517225 12:71391277-71391299 CTACAAAAATTAATGGGGCATGG + Intronic
1098567649 12:71953869-71953891 ATACAGAGAAAGATGGAGTATGG + Intronic
1099754780 12:86831254-86831276 CTTCAGAAAATGATCTACCAGGG - Intronic
1100034369 12:90233648-90233670 CTAAAGTAAATGAAGGAGTAAGG + Intergenic
1101419535 12:104538578-104538600 CTACAGAAAATGTTGAAAAAAGG - Intronic
1101752127 12:107590444-107590466 CCAGAGAAAATGAGGTAGCAGGG + Intronic
1101801786 12:108028834-108028856 CTATAGAAAATGAGAGAGCCAGG + Intergenic
1101868614 12:108543533-108543555 CTACAGTTAATGGTAGAGCAAGG + Intronic
1102728339 12:115086097-115086119 CTAAAGTAAGTGACGGAGCAGGG + Intergenic
1103126815 12:118430558-118430580 CTACAGAAAAAAATACAGCATGG - Intergenic
1104531981 12:129580423-129580445 CCACATAAAATGTTGGAGGAAGG + Intronic
1105568524 13:21576623-21576645 TCACAGAAAATGGGGGAGCAGGG - Intronic
1106316386 13:28597779-28597801 CTTTAGGAAATGATGGAGCCAGG + Intergenic
1106902609 13:34369740-34369762 CCAGAGAAAATCATGGAGAAGGG + Intergenic
1107827428 13:44341206-44341228 TTACAGAAAATTATGGAGGCAGG + Intergenic
1109839716 13:67905663-67905685 CAACAGATAAGGATGCAGCATGG - Intergenic
1109977026 13:69851646-69851668 GTCCAGAAAAGGAAGGAGCAAGG - Intronic
1110764254 13:79264719-79264741 CCACAGAAAATGATGAGGCTTGG + Intergenic
1112853929 13:103742148-103742170 CAACAAAATATTATGGAGCAAGG + Intergenic
1113358681 13:109608101-109608123 CTCCAGTAAATAATGGAGGAAGG + Intergenic
1114261452 14:21039529-21039551 CAACAGAAAAAGATGGAGGAAGG - Intronic
1117200896 14:53388934-53388956 CTAAAAAAATTGATGGAGCATGG - Intergenic
1119394310 14:74314952-74314974 CTACACAGAAGGATGGAGGAAGG + Intronic
1120108499 14:80524361-80524383 CTTCTGAAACTGATGGAGTAAGG + Intronic
1120764747 14:88318474-88318496 CAAGAGAAAATGATGGTGCTGGG + Intronic
1122069189 14:99194708-99194730 CTACAGGAAGTGAAGGAGCTGGG + Intronic
1122169812 14:99863099-99863121 TTACATAAAAGGATGGAGGATGG - Intronic
1125243114 15:37599781-37599803 CTATAGAAGATGATGGTGAAAGG - Intergenic
1125695543 15:41634108-41634130 CTACAGAAAAAAATAAAGCAGGG - Intronic
1126031090 15:44498428-44498450 CTACAAAAAATGAATGAGCCTGG + Intronic
1127075409 15:55320492-55320514 CTACTGAAGACGAGGGAGCAAGG - Intronic
1127102955 15:55586730-55586752 CTAAAGGAAATGATAGAGCCAGG - Intronic
1128214965 15:65928134-65928156 CTAGAGAATATGATGGAGAAGGG - Intronic
1128398980 15:67257247-67257269 TTACAGTAAATGATGTAGCCTGG - Intronic
1128639320 15:69324512-69324534 ACACAGTAAATGATGGAGCCAGG + Intronic
1129014355 15:72452571-72452593 CTACAAAAAATAGCGGAGCATGG - Intergenic
1129921522 15:79323114-79323136 CAGAAGGAAATGATGGAGCAGGG - Intronic
1130639466 15:85657742-85657764 CAACAGAAAATGTAAGAGCATGG + Intronic
1133706043 16:8355611-8355633 CTGCAGAAGAGAATGGAGCAAGG + Intergenic
1134113336 16:11530016-11530038 CTAGAGAAAATGCTTGAGCTGGG - Intergenic
1134195899 16:12158731-12158753 CGGCAGGAAATGAGGGAGCAGGG - Intronic
1135475364 16:22769802-22769824 CTACAGATAATAAAGGAGGATGG - Intergenic
1135476312 16:22778984-22779006 TTTCAGAAATTGATGGATCAAGG + Intergenic
1136273735 16:29165522-29165544 CTTCAGAAAGTGAAGGAGGAGGG - Intergenic
1136639606 16:31552236-31552258 GTACAGAAAATGATTGAGAAGGG + Intergenic
1136990647 16:35149397-35149419 CTATAGACAATGAAGGAGCAGGG - Intergenic
1139118409 16:63985624-63985646 CTATAAAAAATAATTGAGCATGG + Intergenic
1140941909 16:79729718-79729740 CTGCAGAGAATGTTGGAGAAAGG - Intergenic
1141132723 16:81446224-81446246 CTACAGACAATGCCGGACCAGGG - Intronic
1141261681 16:82460067-82460089 CTACAGGAAACAATAGAGCAGGG - Intergenic
1141386918 16:83630132-83630154 CATCAGAAAATGGTGGTGCAGGG - Intronic
1141514829 16:84536941-84536963 ATACAAAAATTGATCGAGCATGG - Intronic
1142077277 16:88127267-88127289 CTTCAGAAAGTGAAGGAGGAGGG - Intergenic
1144875805 17:18396560-18396582 CTACAGATCATGAAGGAGAAGGG + Intergenic
1145156423 17:20547861-20547883 CTACAGATCATGAAGGAGAAGGG - Intergenic
1146576185 17:33993822-33993844 CCTCAGAAAATGATGGAGTCTGG + Intronic
1146843919 17:36171948-36171970 CTACAGATCATGAAGGAGAAGGG - Exonic
1146856225 17:36259883-36259905 CTACAGATCATGAAGGAGAAGGG - Exonic
1146864394 17:36328492-36328514 CTACAGATCATGAAGGAGAAGGG + Exonic
1146872132 17:36383794-36383816 CTACAGATCATGAAGGAGAAGGG - Exonic
1146879494 17:36434879-36434901 CTACAGATCATGAAGGAGAAGGG - Exonic
1146883419 17:36456022-36456044 CTACAGATCATGAAGGAGAAGGG - Intergenic
1147067253 17:37929080-37929102 CTACAGATCATGAAGGAGAAGGG + Exonic
1147075018 17:37984418-37984440 CTACAGATCATGAAGGAGAAGGG - Intronic
1147078785 17:38008641-38008663 CTACAGATCATGAAGGAGAAGGG + Intronic
1147086543 17:38063964-38063986 CTACAGATCATGAAGGAGAAGGG - Exonic
1147094723 17:38132576-38132598 CTACAGATCATGAAGGAGAAGGG + Intergenic
1147102486 17:38187927-38187949 CTACAGATCATGAAGGAGAAGGG - Intergenic
1147355966 17:39896982-39897004 AAAAAGAAAATGATGGAGCCAGG - Intergenic
1147873098 17:43601612-43601634 CTACAGAAAGCGTTGGAGAAAGG + Intergenic
1149121769 17:53176913-53176935 CTAAAGCAAATGATGGAAGAAGG + Intergenic
1149427763 17:56571136-56571158 TTACATAAAATGATGGTGCAGGG - Intergenic
1149847059 17:60014393-60014415 CTACAGATCATGAAGGAGAAGGG - Intergenic
1150085418 17:62271010-62271032 CTACAGATCATGAAGGAGAAGGG - Intergenic
1151870353 17:76832661-76832683 GTGCAGAAGATGATGGAGGAAGG - Intergenic
1152504452 17:80738355-80738377 CCACAGAAAGGGATGGTGCATGG - Intronic
1153660278 18:7319917-7319939 CTACAGACAGCGATGGAGCTTGG - Intergenic
1153896933 18:9571856-9571878 CTACAGGAAATCATGTAGTAAGG + Intronic
1154061504 18:11065148-11065170 TTACAGAGAATGAGGGAGAATGG + Intronic
1155952316 18:31927017-31927039 CTACAGAAATTGGTGGGGCAAGG + Intronic
1156846332 18:41669759-41669781 CTACAGGAAATGAGGGTGCCAGG - Intergenic
1157214938 18:45774873-45774895 CTACCTAAAATGCTGGAGAATGG + Intergenic
1158251987 18:55499501-55499523 CTACATAAACAGATGGAGCTAGG - Intronic
1159461108 18:68723494-68723516 CTACATACAATGAGGGCGCAAGG + Intronic
1160463790 18:79058984-79059006 CTCTAGAAAAACATGGAGCAGGG + Intergenic
1161677613 19:5661266-5661288 CTCCAGGAAATGTTGGAGAAAGG + Intronic
1163225566 19:15958438-15958460 AGACAGAATATGATGCAGCAAGG + Intergenic
1163730979 19:18949018-18949040 CCACGGAAGATGCTGGAGCAAGG - Intergenic
1164188135 19:22890134-22890156 CTAAAGAAAATAATGGAGGGTGG - Intergenic
926326971 2:11793375-11793397 GTACAGAGAATGAAGAAGCAAGG - Intronic
926584768 2:14673938-14673960 ATCCAGGAAATGATGGAGCCAGG + Intergenic
926796276 2:16621691-16621713 CTGGAGAAAGTGAGGGAGCAAGG - Intronic
926846963 2:17152037-17152059 CCACAGACAGTGATGGAGGAGGG + Intergenic
927904239 2:26846180-26846202 CGGCAGAAACTGAAGGAGCAAGG + Intergenic
928374117 2:30761215-30761237 CTACATGGAATGGTGGAGCAGGG + Intronic
928727513 2:34191825-34191847 CTAAAGTAACTGGTGGAGCAAGG - Intergenic
928952626 2:36826510-36826532 CTAGAGGAAAAGAAGGAGCAGGG - Intergenic
931686649 2:64799821-64799843 GTACAGAAGATGATGGAGGAGGG - Intergenic
932254849 2:70275701-70275723 CTGCAGAAAATGATTGCTCAGGG + Intronic
932348202 2:71009503-71009525 CAACAGAGAAGGATGCAGCATGG - Intergenic
932351079 2:71032383-71032405 CAACAGAGAAGGATGCAGCATGG - Intergenic
932716602 2:74104804-74104826 CTGCAGAAACTGATGAACCAAGG - Exonic
933264731 2:80169578-80169600 CCACAGAAACAGATAGAGCAGGG - Intronic
933794927 2:85911929-85911951 CTACAGAAAAAAAAAGAGCATGG - Intergenic
935081525 2:99801853-99801875 TTACAGAAAATAATGGAACTTGG - Intronic
936090742 2:109499930-109499952 CAAGAGAGAATGAGGGAGCAGGG + Intronic
936745787 2:115574826-115574848 CTGCAGAGAATCATGGATCAAGG - Intronic
937440956 2:121915637-121915659 CTTCAGAAAATGAGGGGGGATGG + Intergenic
937971325 2:127551625-127551647 CTACAGTAATTGATAAAGCAAGG + Intronic
939532328 2:143380012-143380034 CCAAAGAAAATGATGAAGGAAGG + Intronic
940163472 2:150740539-150740561 CTACAGAAAGTGATTGTGTATGG + Intergenic
940913065 2:159225741-159225763 TTACAGAAATTAATGGAGGAAGG + Exonic
942128578 2:172853173-172853195 CTTCAGAAAATGAAGGAGGATGG - Intronic
942307633 2:174624644-174624666 CAACATAAGATGCTGGAGCAGGG + Intronic
945024695 2:205608882-205608904 GTACAGAAAATGAAGGAGAAAGG - Intronic
945105710 2:206311792-206311814 CTACAGAAAATGTTGGACAAAGG - Exonic
945274308 2:207972785-207972807 CTGCAGAAAAAAATGGACCATGG - Intronic
946081196 2:217119993-217120015 CCAGAGAAAATTATGGAGTAAGG + Intergenic
946319929 2:218947017-218947039 CCAGAGAAAAAAATGGAGCAGGG + Intergenic
946791786 2:223308390-223308412 AGACACAAAGTGATGGAGCATGG - Intergenic
947226833 2:227848792-227848814 CTCCAGCAAATGAAGCAGCAAGG + Intergenic
947960635 2:234233799-234233821 CTTCTGAAAATGATGAAGAAAGG - Intergenic
1169554607 20:6736044-6736066 ATAGAGAAAGTGTTGGAGCATGG - Intergenic
1169704981 20:8493166-8493188 AAACAGAAAATCATGGTGCAGGG - Intronic
1171940781 20:31327376-31327398 CTACAGTAAATGAAACAGCATGG + Intergenic
1173353489 20:42265791-42265813 CAAGAGAAGATGATGAAGCAAGG - Intronic
1173377709 20:42503981-42504003 GGACAGAAAATTAAGGAGCAAGG - Intronic
1173819854 20:46012928-46012950 CTACAAAAAATAAATGAGCAAGG + Intronic
1173887975 20:46478747-46478769 TAACAAAAAATGAAGGAGCAAGG + Intergenic
1174571173 20:51502634-51502656 CATCAGAAAATGATACAGCAGGG - Intronic
1175050933 20:56154926-56154948 CTACTGTAAATGAACGAGCATGG + Intergenic
1175541041 20:59747814-59747836 CTGCTGGAGATGATGGAGCAGGG + Exonic
1175602503 20:60286508-60286530 CTGCAGATAATGATGCAGCAAGG + Intergenic
1177084301 21:16682719-16682741 TAACAGAAAATGCTGGAGCATGG + Intergenic
1177501959 21:21968297-21968319 CTACAGATCATTGTGGAGCATGG + Intergenic
1178678775 21:34653975-34653997 CTAGAGACAAGCATGGAGCAGGG + Intergenic
1179066447 21:38029000-38029022 AAACAGAAAATAATGGAACAGGG + Intronic
1181106992 22:20581486-20581508 CTACAGAAATGGATGGTCCAGGG + Intronic
1181386384 22:22548807-22548829 ACACAGCAAATGATGGAGAAAGG - Intronic
1182256355 22:29041626-29041648 CCACAGAGACTGATTGAGCAGGG - Intronic
1182483653 22:30626437-30626459 CTGCAGAAACAGATTGAGCAAGG - Intronic
1182855727 22:33516169-33516191 CTGCAGGAAATGAAGGAGCGAGG + Intronic
1185286494 22:50002324-50002346 CAACAAAAAATAATGGAGTAAGG - Intronic
949732677 3:7131881-7131903 CTGGAGAAAATGATGTGGCAAGG - Intronic
949801467 3:7909014-7909036 TTACAGAAAATGGTGGGGCGGGG - Intergenic
949885679 3:8691612-8691634 CAACAGATAAGGATGCAGCATGG - Intronic
950346070 3:12294531-12294553 CTTCAGAAAATGATGTGCCAAGG + Intronic
951303488 3:21027967-21027989 ATAAAGAAAATCATGGAGAAGGG - Intergenic
951430649 3:22603078-22603100 TGACAGAAAATGGTAGAGCAGGG + Intergenic
951956493 3:28261259-28261281 CTACAGAAAAGCATGAAGAATGG - Intronic
952636899 3:35543962-35543984 CTTTAGAATATGAAGGAGCAGGG - Intergenic
953614837 3:44480584-44480606 CTGCAGAAAAAGATGGAGGGTGG - Intergenic
953890643 3:46749760-46749782 CCACAGAAAATGAAAGAGGAGGG + Intronic
954010564 3:47633343-47633365 CTATGGAAAATGATGGAACCAGG + Intronic
955076602 3:55619658-55619680 CTTCAGAAACTGTTGGAACATGG + Intronic
955279375 3:57579588-57579610 AAACAGAAAATGATGTAGGATGG - Intronic
955763025 3:62309762-62309784 AGACAGAAAATGATGGTGAAAGG + Intergenic
956055692 3:65296341-65296363 ACACAGAAAATTATGGAGCCAGG + Intergenic
956114849 3:65907927-65907949 CCACAGAGAGTGATGGAGCCGGG - Intronic
956285897 3:67609597-67609619 CTACAGAAATTGAAGGAGAGAGG + Intronic
958642350 3:96821984-96822006 TTACAGTAAATGATGTTGCATGG + Intronic
959017164 3:101147897-101147919 CTAGAGAAAATAATGGAGTTGGG + Intergenic
959676898 3:109045897-109045919 CTAGAGAAAATGATGCTACATGG - Intronic
960493753 3:118350692-118350714 CTACAGAGAATGATGAAGGGAGG - Intergenic
960683847 3:120277218-120277240 TTACAGAAAATAGAGGAGCAGGG - Intronic
962389748 3:134961254-134961276 CTGGAGAACCTGATGGAGCATGG + Intronic
962799366 3:138876935-138876957 CTACAGAAAAAAATGTAGGATGG + Intergenic
963298417 3:143573033-143573055 CAACAGTAAGTGATGGAGCTGGG - Intronic
965184249 3:165443146-165443168 CTAGGGAAAATGATGGATCTGGG + Intergenic
965948861 3:174279106-174279128 CCCCAGATATTGATGGAGCAAGG + Exonic
966053588 3:175653288-175653310 CTAAAGAAAATGGTGGAAGAAGG - Intronic
968346996 3:198016964-198016986 CTACAGAAAGTAAATGAGCATGG + Intronic
968897608 4:3413883-3413905 CTACACACAGGGATGGAGCAGGG - Intronic
968960836 4:3742733-3742755 CTGCTGAACATGATGGTGCAGGG - Intergenic
969649695 4:8458159-8458181 CTAAAGGAAATGATGGAAGAAGG + Intronic
969735295 4:8984862-8984884 CAACAGATAAGGATGCAGCATGG - Intergenic
970399737 4:15705684-15705706 CTACAGAAATGGATGGTGCATGG + Intronic
972078950 4:35125062-35125084 CTACAGAAAACAATACAGCATGG - Intergenic
972163511 4:36254428-36254450 CTACAGAAAAATAAGGAGAAGGG + Intergenic
973141477 4:46773954-46773976 CTAAAGAGAATGATGGAACAAGG - Intronic
978792570 4:112678046-112678068 CTAAATGAAGTGATGGAGCAAGG - Intergenic
979542766 4:121904945-121904967 CTACTGCAAATGATGCTGCAAGG - Intronic
985504491 5:271385-271407 GGACAGGAAGTGATGGAGCACGG - Intergenic
990454814 5:55974871-55974893 GTACAGAAAATGACTGACCAAGG + Intronic
991984367 5:72268613-72268635 CTTCAAAAAATTATGGATCAAGG + Intronic
992361861 5:76046844-76046866 TGACAGAAAATGAATGAGCAAGG - Intergenic
994011198 5:94905096-94905118 CTAAAGAAGATGAAGAAGCAAGG + Intronic
994109811 5:95988632-95988654 CTATAGCAAATACTGGAGCATGG - Intergenic
994129131 5:96204521-96204543 CCACAGAACTTCATGGAGCATGG + Intergenic
995929558 5:117422360-117422382 AAACAGAAAATGTTGGAGAAGGG - Intergenic
997363159 5:133308137-133308159 CTTGAGAAAATGAGGGACCAAGG + Intronic
1000964477 5:167639583-167639605 CTACATAAAATGATGGGAAAAGG - Intronic
1001116725 5:168946588-168946610 CTGCAGAAGATGCTGGAGCCAGG - Intronic
1004312989 6:14562367-14562389 CTCCAGACAATGCCGGAGCAAGG + Intergenic
1004506009 6:16247295-16247317 ATACAGTAAATGCTGCAGCACGG - Intronic
1004512589 6:16294913-16294935 CTACAGAAAGTGCTGGAGCTGGG + Intronic
1005143165 6:22657536-22657558 CCACAGTACATGATAGAGCAGGG + Intergenic
1005811679 6:29520743-29520765 CTAAAGAAAATAAAGGAGCAGGG + Intergenic
1007947541 6:45839717-45839739 CTGCAGGAGGTGATGGAGCAGGG - Intergenic
1008754471 6:54777741-54777763 CTACACAAAAAGATGGACCATGG - Intergenic
1009849752 6:69180560-69180582 CCTGAGATAATGATGGAGCAGGG - Intronic
1010596592 6:77770610-77770632 CTACAGTAAATGAAACAGCAAGG + Intronic
1013787408 6:113797034-113797056 CTACAAAAAATTAACGAGCATGG - Intergenic
1013975564 6:116074416-116074438 TTACATAAAATGAAGAAGCATGG - Intergenic
1014105696 6:117558284-117558306 CTACAGAAATGGATGGAGGGGGG - Intronic
1014444164 6:121506908-121506930 CTCTAGAAAGTGATGCAGCAAGG + Intergenic
1015042420 6:128738290-128738312 CTACAGAAAAAGGTGGGGGAAGG + Intergenic
1016029475 6:139322767-139322789 CTACAGAAAAAGAAGGAACAAGG - Intergenic
1016275113 6:142340877-142340899 CCACAGAAAATGATGTAACAGGG - Intronic
1017422580 6:154288118-154288140 CTACAGAAAAAGAAAGAGAAGGG + Intronic
1019986454 7:4659824-4659846 CCAAAGGAAATGATGGTGCAAGG - Intergenic
1022177718 7:27887823-27887845 CTACTGAAAATGTTGGAGTGAGG - Intronic
1022199433 7:28102215-28102237 TTGCAGCAAATGTTGGAGCAGGG - Intronic
1023211736 7:37813175-37813197 CTACAGTAACTGAAGCAGCATGG + Intronic
1023361331 7:39418739-39418761 ATACAGTAAATGATAGAGCCTGG + Intronic
1023537317 7:41227169-41227191 CTACAGAAACTGATGTCCCAAGG - Intergenic
1023881217 7:44322758-44322780 CAGCAGAAAAGGATGGGGCAAGG + Intronic
1024100313 7:46025801-46025823 TTCCAGAAAATGAGAGAGCAAGG - Intergenic
1024119691 7:46224183-46224205 CTGCAGAAAATGTTGGAGTTGGG - Intergenic
1024333499 7:48179947-48179969 CTACAGAAAATGAGCCAGGAAGG + Intronic
1025714003 7:63937682-63937704 AGAAACAAAATGATGGAGCAGGG + Intergenic
1025800433 7:64781785-64781807 CTGAAGAAAATAATGGAGGATGG + Intergenic
1027422614 7:78032128-78032150 GTACAGAAAAAAATGTAGCAAGG - Intronic
1027795651 7:82690691-82690713 CTAGAGAAAAAGGTGGAGGAAGG - Intergenic
1028031771 7:85924191-85924213 GTACACAAAATGATGAAGCATGG - Intergenic
1028364491 7:90011678-90011700 ATACAGTAAATGATGGAGCTGGG + Intergenic
1029961828 7:104695872-104695894 ATTTAGAAAATGAGGGAGCAAGG - Intronic
1032688062 7:134256102-134256124 CTACTGAAAAGGCAGGAGCAGGG - Intronic
1033951704 7:146792559-146792581 CTACAGAAAATGAGGTATCCAGG + Intronic
1034464539 7:151218782-151218804 CTACAGAAAATGATGGCATCAGG - Exonic
1034465083 7:151223185-151223207 TCACAGAGAATGATGGGGCAAGG + Intronic
1035992889 8:4511621-4511643 CTACAGAAAGTGATGGTACCAGG + Intronic
1036396321 8:8374414-8374436 CTACAGGACATCAAGGAGCATGG - Intronic
1037094002 8:14961191-14961213 AAAAAGAAAATGATGGAGCTGGG - Intronic
1037590617 8:20309088-20309110 CTATTGAAAAAGATGGAGCGAGG - Intergenic
1037748885 8:21667207-21667229 TTACAGAAAATAATGGAGGGAGG + Intergenic
1038786319 8:30619987-30620009 CAACAGAAGAGGATGGAGGAAGG + Intronic
1039621214 8:38998076-38998098 CGACAGAGGATGATGGAGAATGG + Intronic
1041591417 8:59589356-59589378 CAACAACAAATGTTGGAGCAGGG - Intergenic
1041867530 8:62594220-62594242 CTACAGAAAATAGAGGAGGAGGG + Intronic
1045708352 8:104954537-104954559 CTACAGAAATGGATGGAGGGAGG + Intronic
1047376578 8:124303650-124303672 ATACAAAAAATGTTGGCGCAAGG + Intergenic
1047640495 8:126814950-126814972 CTGAACAAAATGATGAAGCAAGG - Intergenic
1050693225 9:8251820-8251842 CCACAGAAAATGCTGGGGGATGG - Intergenic
1052100219 9:24436908-24436930 CCAGAGAAAACCATGGAGCAAGG - Intergenic
1055668071 9:78572010-78572032 ACACAGAAAGTGATGGAGCTGGG + Intergenic
1056863684 9:90210693-90210715 CAACAGATAAGGATGCAGCATGG - Intergenic
1057862940 9:98656319-98656341 CTAAAGAAAATGCAGGACCATGG + Intronic
1059340788 9:113596583-113596605 CTACAGGAAATGACTGAGCCAGG + Intronic
1059752217 9:117258543-117258565 GAATAGAAAGTGATGGAGCAGGG - Intronic
1185963622 X:4574999-4575021 CTATAGAAAAAGAGGGAACAAGG + Intergenic
1187253232 X:17618355-17618377 CTGAACAAAATAATGGAGCAAGG - Intronic
1187293471 X:17977131-17977153 CTACAGAAGGTTATTGAGCAGGG - Intergenic
1188408914 X:29846937-29846959 ATACACAAAATGAAGGAGCATGG - Intronic
1189537134 X:41947068-41947090 CTAAAGGAAATGCTGGAGGAGGG + Intergenic
1189834169 X:45004193-45004215 CTAAAGAGTATGGTGGAGCAGGG - Intronic
1190471641 X:50786436-50786458 CCACAAAAAAGGTTGGAGCACGG - Intronic
1190640697 X:52481203-52481225 CTACAGAAAATGATGGAGCAGGG + Intergenic
1190646975 X:52531662-52531684 CTACAGAAAATGATGGAGCAGGG - Intergenic
1190976443 X:55406749-55406771 TTACATAAGATGATGGAGAATGG - Intergenic
1192005466 X:67207336-67207358 CTAAAGAAAGTGATGGAGAGGGG - Intergenic
1195043266 X:101033296-101033318 TTACAGAAAATGAAGGAGGCTGG + Intronic
1195260125 X:103123646-103123668 CCACACAAACTGATGGAGCCCGG + Intergenic
1196657211 X:118230985-118231007 ATAGTGAAAATGAAGGAGCATGG + Intergenic
1196993768 X:121358165-121358187 CTACAAGAAAACATGGAGCAGGG - Intergenic
1197720604 X:129742273-129742295 ATAGAGAAGATGATAGAGCAGGG - Intronic
1197826685 X:130597643-130597665 CTACAGCAAAGAAAGGAGCATGG + Intergenic
1200038934 X:153351985-153352007 TGACAGAACATGATGGACCACGG + Exonic
1200887409 Y:8282635-8282657 TTACAGAAAATGATGGGCCTGGG - Intergenic
1200930851 Y:8695793-8695815 CTACAGAAAAAGAGAGAACACGG + Intergenic
1201326487 Y:12765773-12765795 CTACAGCAAATGGTGCAGGATGG - Intronic