ID: 1190649299

View in Genome Browser
Species Human (GRCh38)
Location X:52553610-52553632
Sequence AAGTGCCAAGATAATTCAGT GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 1018
Summary {0: 2, 1: 7, 2: 49, 3: 204, 4: 756}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1190649299 Original CRISPR AAGTGCCAAGATAATTCAGT GGG Intergenic
900859138 1:5213440-5213462 AAATGTCAAGGTAATTCAATGGG + Intergenic
901423114 1:9164049-9164071 AAGTCCCATGATAAGTCATTTGG + Intergenic
901531411 1:9855512-9855534 GGGTGCCAAGACAATTCAGTGGG + Intronic
901817375 1:11802499-11802521 AAGTGCTAATGTAATTCAGTTGG + Intronic
902064947 1:13677230-13677252 CATTGCCAAGAAAATTCAATGGG - Intergenic
902726986 1:18343708-18343730 GGATGCCAAGATAATTCAATGGG - Intronic
903150894 1:21407829-21407851 GAGTGCCAAAATCATTCAATGGG - Intergenic
903611231 1:24614877-24614899 GAGTACCAAGATAATTCAATGGG - Intergenic
904274809 1:29374208-29374230 AGGTGCCAAGAACATTCAGTGGG - Intergenic
904338582 1:29814605-29814627 AGGTGCAAAGACAATTCACTGGG - Intergenic
904507135 1:30966754-30966776 AAGTGACAAAATAATACATTTGG - Intronic
904554849 1:31353751-31353773 AGGGGCCAAGACCATTCAGTGGG - Intronic
905195613 1:36274951-36274973 GGGTGCCAGGACAATTCAGTGGG + Intronic
905546701 1:38805454-38805476 AGTTGCCAAAATAATTCAATGGG + Intergenic
905712200 1:40115502-40115524 AGGTGCCAAGACCATTCAATGGG + Intergenic
905973687 1:42159819-42159841 AAGTGCCAAGATCACACAATGGG - Intergenic
905982038 1:42237879-42237901 AGGTACCAATGTAATTCAGTAGG - Intronic
906138543 1:43518758-43518780 AAGTGCCAAGGAAATTCAATGGG - Intergenic
906173596 1:43749080-43749102 AAGTAATAACATAATTCAGTGGG + Intronic
906419875 1:45656614-45656636 AAGTACAAAGGTAATTCAATGGG - Intronic
906756252 1:48318994-48319016 AGATGCCAAGACAATTCAATGGG + Intronic
906889227 1:49689337-49689359 AAGTGCCAAGAATATACATTGGG - Intronic
907568107 1:55456255-55456277 ACGTGCCAAGGTAATCCAATGGG + Intergenic
907655647 1:56339746-56339768 AGGTGCTAAGGTAATTCAATGGG - Intergenic
908430985 1:64057269-64057291 GAGTGCCAAGACAATTCAATGGG - Intronic
908598730 1:65716163-65716185 AAGTGCCAAGAACATACACTGGG - Intergenic
908855668 1:68424359-68424381 AAGTGCTAAGAAAATTCAATGGG - Intergenic
909125517 1:71663558-71663580 AAATGCAAAAATAATTCAATGGG - Intronic
909226305 1:73027821-73027843 GTGTGCCAAGATAATTAAATGGG + Intergenic
909230062 1:73077035-73077057 AGGTGTCAAGGTAATTTAGTTGG + Intergenic
909256067 1:73424032-73424054 AGGTGCAAAGGTAATGCAGTGGG + Intergenic
909270212 1:73614364-73614386 AAGTGCCAAGAACATACACTGGG - Intergenic
909387177 1:75071425-75071447 AAGTGACATTATAAATCAGTGGG + Intergenic
909550260 1:76891844-76891866 AAATGCCAAGACAATTGAATAGG - Intronic
909607925 1:77525307-77525329 AAATGTCAAGATCATTCTGTAGG - Intronic
909903297 1:81165163-81165185 AAGTGCCAAGAACATACACTGGG + Intergenic
910090556 1:83458236-83458258 AAGTGGAAAGTTAAATCAGTTGG - Intergenic
910502756 1:87911889-87911911 GAGTGCCAAGATAGTTCAGTGGG - Intergenic
910782784 1:90958693-90958715 AAGTGCCAAGACCATTCAATGGG + Intronic
910932233 1:92454029-92454051 AACTACCAAGATAATTCAATGGG - Intergenic
911259310 1:95667378-95667400 AGGTGCCAAAGTGATTCAGTGGG + Intergenic
911308693 1:96264808-96264830 AGGTGCAAAAAAAATTCAGTGGG + Intergenic
912064120 1:105713998-105714020 GAGTGCCAAGACAATTCAATGGG - Intergenic
912342164 1:108927516-108927538 GGGTGCCAAGACCATTCAGTGGG + Intronic
913038008 1:114992520-114992542 GAGTGCCAAGACCATTCAATGGG + Intronic
913301948 1:117380633-117380655 GAGTGCCAATATTATTCAATAGG - Intronic
913373498 1:118126951-118126973 AAGTGCCAAGAACATACAATAGG - Intronic
913572677 1:120136696-120136718 AAGAGCCAAGACAATTCAATGGG + Intergenic
914293521 1:146297610-146297632 AAGAGCCAAGACAATTCAATGGG + Intergenic
914554565 1:148748393-148748415 AAGAGCCAAGACAATTCAATGGG + Intergenic
915990497 1:160511447-160511469 GAGTGCTAAGATCATTCAATAGG + Intronic
916259483 1:162826845-162826867 AGGTGCCAAGACCATTCAGTGGG - Intronic
916300869 1:163272674-163272696 CAGTGCCAAGACAATTCAAAGGG - Intronic
916710956 1:167407624-167407646 AGGTGCCAAGGCAATTCAATAGG + Intronic
917001787 1:170368478-170368500 AAGTGCCAAGGTATTTCAATGGG + Intergenic
917129531 1:171726542-171726564 AGATACCAAGGTAATTCAGTGGG + Intronic
917322227 1:173795441-173795463 AAGTGACAAGACACTTCAATAGG + Intergenic
918155259 1:181839045-181839067 TAGTGCCAAGACCATTCAATGGG + Intergenic
918194251 1:182206998-182207020 AACTTCCAAGAAAACTCAGTGGG + Intergenic
918587093 1:186200734-186200756 AAGTGCCAAGGCAATTCAATGGG - Intergenic
918687692 1:187439424-187439446 AATTGCCAACATAATTAAATGGG - Intergenic
918810589 1:189114157-189114179 ACGTGCCAATAAAATTCAATAGG - Intergenic
918904871 1:190478569-190478591 AAATGGCAAGATAATGCATTCGG - Intergenic
918923386 1:190745862-190745884 AAGTGCTTAAATAATTAAGTAGG + Intergenic
919099695 1:193079408-193079430 GGGTGCCAAGATGATTCACTGGG + Intronic
919114318 1:193261847-193261869 AACATGCAAGATAATTCAGTGGG - Intergenic
919117397 1:193297481-193297503 AAGGGGCAAGGTAATTCAATGGG + Intergenic
919285896 1:195559357-195559379 TACTGCCAAGACAATGCAGTGGG + Intergenic
919295382 1:195692524-195692546 GAGTGCCAAGATCATTGAGTGGG + Intergenic
919867983 1:201797246-201797268 GAGTGCCAAGACAATTCAGTGGG - Intronic
919936849 1:202257584-202257606 CAGTGCTAAGACAATTCAATAGG - Intronic
920077344 1:203347091-203347113 CAGTGCTAAGACAATTCAGTGGG - Intronic
920267966 1:204739895-204739917 AAGTGTTAAGACAATTCAATGGG - Intergenic
920953156 1:210592298-210592320 AAGTGCCAAGAACATACACTGGG - Intronic
921038922 1:211410589-211410611 AAGCGTCAAGATAATTCAATGGG + Intergenic
921042278 1:211444874-211444896 GGGTGCCAAGATCACTCAGTGGG + Intergenic
921151523 1:212406851-212406873 AAGTGCCCAGGTAAATCAGGAGG - Intronic
921241700 1:213190912-213190934 AGGTGCCAAGAAAATACACTGGG - Intronic
921595533 1:217050176-217050198 ATGTGCCAAGATATTTGAGCTGG + Intronic
921970667 1:221145932-221145954 AAGTGCCAAGGCAATTCAATGGG - Intergenic
922112316 1:222572678-222572700 GGGTGCCAAGACAATTCAGTGGG + Intronic
922253596 1:223872261-223872283 AAGGGCCAAGATAATTAAACAGG - Intergenic
922394900 1:225187994-225188016 AAATGCCAAGATCATTTAGTGGG - Intronic
922540097 1:226412454-226412476 GGGTGCCAAGATCATTCAGTGGG - Intergenic
923053762 1:230408590-230408612 AGGTGTCAAAATAATTCAATGGG + Intronic
923073518 1:230588529-230588551 AGGTGTGTAGATAATTCAGTAGG + Intergenic
924220434 1:241869286-241869308 ATGTGCCAAGACAATTAAATGGG + Intronic
924489362 1:244520401-244520423 AAGTTCCAAAACAATTCAATGGG - Intronic
924505127 1:244675544-244675566 AGGTGCCAAGACAATTCAGTGGG - Intronic
924833597 1:247625932-247625954 AGGTGCCAAGATCATACATTAGG - Intergenic
1062917906 10:1255959-1255981 AAAAGTCAAGTTAATTCAGTAGG - Intronic
1063599920 10:7471495-7471517 ATGTGCTAAGACAATTCAATGGG + Intergenic
1063730276 10:8688652-8688674 AAATGCCAAGATATTTCACCAGG + Intergenic
1063742710 10:8841103-8841125 AATTCTCAAAATAATTCAGTAGG - Intergenic
1064465923 10:15581882-15581904 AGGTGCCAAAGTAATTCAGTGGG + Intronic
1065028462 10:21561699-21561721 AAGTGCCAGTATCATTCAGTGGG - Intronic
1065120639 10:22526790-22526812 GGGTGCCAAGACAATTCAGTAGG - Intergenic
1065245991 10:23758323-23758345 GAGTGCCAAGACTATTCACTGGG - Intronic
1065302614 10:24336786-24336808 CAGTGCCAAGATCATTCCATTGG + Intronic
1065467237 10:26037602-26037624 AGGTGCCAAGACCATACAGTGGG - Intronic
1066013056 10:31211620-31211642 AAATACCAAGAAAATACAGTAGG + Intergenic
1066142533 10:32520985-32521007 AGGTGCCAAGAACATACAGTGGG - Intronic
1066627529 10:37423124-37423146 AGGTGCCAAGACATTTCAATGGG - Intergenic
1066666440 10:37787553-37787575 AAGTGCCAAGATACTTCAAGAGG + Intronic
1066762967 10:38774077-38774099 AAGGGCAAGGATATTTCAGTTGG + Intergenic
1067022885 10:42817371-42817393 AAGTGCCAAGAAAAAGCATTTGG + Exonic
1067159328 10:43809828-43809850 AGGTGCCAAGATATTTTATTGGG + Intergenic
1067320374 10:45214309-45214331 AAGTGCAAAGGCAATTCAGTGGG + Intergenic
1067361712 10:45587799-45587821 AAATGCCAAGAGAACTCAATGGG + Intronic
1067381851 10:45781565-45781587 AGGTGCTAAGATATTTCAGTGGG + Intronic
1067466848 10:46506653-46506675 GAGTGCCAAGACCATTCAATGGG + Intergenic
1067513644 10:46916975-46916997 AGGTGCCAAGATAATATAATGGG - Intronic
1067620339 10:47877952-47877974 GAGTGCCAAGACCATTCAATGGG - Intergenic
1067648608 10:48134859-48134881 AGGTGCCAAGATAATATAATGGG + Intergenic
1067770863 10:49123686-49123708 GAGTGCCAAGATAATTTAATGGG - Intergenic
1067813464 10:49450268-49450290 AGGTGCCAAGTCCATTCAGTGGG - Intergenic
1067889550 10:50122205-50122227 AGGTGCCAAGATATTTCAGTGGG + Intronic
1067919930 10:50444479-50444501 AGATGTCAAAATAATTCAGTGGG + Intronic
1067928589 10:50537055-50537077 AAATGCTAAGATGACTCAGTGGG - Intronic
1068002569 10:51353021-51353043 AGGTGCCAAGAACATTCATTGGG + Intronic
1068139012 10:52980942-52980964 AAGTGCCAAGGTAATTAAATGGG - Intergenic
1068187397 10:53603465-53603487 AAGTGCCAAGAATATACATTGGG - Intergenic
1068200053 10:53772302-53772324 AAGTACCAAAATAACTCAATTGG - Intergenic
1068295567 10:55068366-55068388 AATTGCCAAGAAAATTCACTGGG - Intronic
1068473281 10:57492536-57492558 AAGTGCCAAGAAAATACAATGGG + Intergenic
1069205425 10:65676828-65676850 AAGTGCAAAGACAATTCAATAGG - Intergenic
1069234600 10:66054987-66055009 AAATGCCAAGAAAATACATTGGG - Intronic
1069284878 10:66701130-66701152 AAGTTCAAAGGCAATTCAGTGGG - Intronic
1069324609 10:67218062-67218084 CATTCCCAAGATAATTCATTAGG + Intronic
1069523633 10:69147672-69147694 AGGTGCCAAAACAATTCAATGGG - Intronic
1070084206 10:73219631-73219653 GGGTGCCAAGATCATTCAATGGG + Intronic
1070200710 10:74203215-74203237 GAGTATCAAGATCATTCAGTGGG - Intronic
1070443787 10:76474086-76474108 GAGTACAAAGATAATTCACTGGG + Intronic
1070579225 10:77706695-77706717 AAGTGCCAAGAATATACATTGGG + Intergenic
1070763436 10:79040959-79040981 AAGTGATAAGGTTATTCAGTGGG + Intergenic
1070822341 10:79367116-79367138 AGATGCCAAGAGCATTCAGTGGG + Intergenic
1071020676 10:81051241-81051263 TAGTGCCAAGGCAATTTAGTAGG + Intergenic
1071699011 10:87909120-87909142 GAGTGCCAAGACTATTCAATGGG - Intronic
1071905243 10:90166220-90166242 AAGTGCCAAGAACATACACTGGG - Intergenic
1071995595 10:91145735-91145757 GAGTGCCAAGACAATTCAATGGG + Intergenic
1072401193 10:95103070-95103092 ATGTGCCAAGATTCTTCATTAGG + Intergenic
1072825557 10:98602683-98602705 AAGTGCCAAGATGATTAAATGGG + Intronic
1072837553 10:98732509-98732531 AGGTGCCAAGATAAGTAAATGGG + Intronic
1072863180 10:99028860-99028882 AAGTGCCAAGAACATACACTGGG + Intronic
1073171629 10:101514755-101514777 AGATGCCAAGATAATTCAATGGG - Intronic
1073581488 10:104670453-104670475 AGGTGCAAAGACAATTCAATGGG - Intronic
1073874496 10:107906503-107906525 AAGTGCCAAGAGAATTAAAGAGG + Intergenic
1074135513 10:110622924-110622946 TGGTGCCAGGATAATTCAATGGG - Intergenic
1074444419 10:113507571-113507593 AGGTGCCAAGACTATTCAATGGG - Intergenic
1074744435 10:116517580-116517602 CAGTGCCATGGTAATACAGTCGG - Intergenic
1075268192 10:121024263-121024285 AAATGCCAAGGTAATTCAAAGGG + Intergenic
1075272684 10:121066595-121066617 AAGTGCCAAGACCATTCAATGGG - Intergenic
1075539910 10:123303608-123303630 AAGTCCCAAGAGAGTTCAGTTGG - Intergenic
1076377089 10:129997881-129997903 AAGTGCCAAGAACATACATTGGG + Intergenic
1076628542 10:131838331-131838353 AAGTGCAAAGACAATTCAATGGG + Intergenic
1076812621 10:132896988-132897010 CAGTGCCAAGACCATTCACTAGG + Intronic
1076913727 10:133407065-133407087 AAGTGCCAAGAACATACACTGGG - Intronic
1077372205 11:2188271-2188293 AGGTGCCAAGGCCATTCAGTGGG + Intergenic
1077437912 11:2552347-2552369 AGGTGCCAAAGTAATTCAATGGG - Intronic
1077449273 11:2626382-2626404 GAGTGCCAAGACCATTCAATAGG - Intronic
1077745744 11:4902662-4902684 AAGTCCCAAGATAATAAGGTGGG + Intronic
1077908505 11:6554206-6554228 ATGTGCCAAGATAATTCAATGGG + Intronic
1078189473 11:9080168-9080190 AAGTGCTAAGGTAATCCATTGGG + Intronic
1078345374 11:10543683-10543705 ATATGCCAAGGCAATTCAGTGGG + Intergenic
1079113775 11:17626066-17626088 AAGTGCCAAGAACATACATTGGG - Intronic
1079600816 11:22311671-22311693 AAGTGTCAAAAAAATTCAATAGG + Intergenic
1080089547 11:28329216-28329238 GAGTGCCAAGACCATTCAATTGG - Intronic
1080506709 11:32921975-32921997 AGGTGCCAAGACAATTCAATAGG + Intronic
1081001966 11:37685454-37685476 AAGTACCAAGAATATTCAGTGGG + Intergenic
1081201206 11:40218038-40218060 AAGTGTCAATATAATTGAGAAGG + Intronic
1081271237 11:41085313-41085335 AGGTCCCAGGACAATTCAGTTGG - Intronic
1081539440 11:44020017-44020039 GGGTGCCAAGATAATTCAGTGGG - Intergenic
1082644834 11:55709790-55709812 CAGTGCCAAGATTATTCAATAGG - Intergenic
1082688973 11:56277036-56277058 AGGTGCCAAGAAAATACATTGGG - Intergenic
1084159790 11:67340936-67340958 CAGTGCCAACGTAATTAAGTGGG + Intronic
1084896919 11:72278739-72278761 GGGTGCCAAGATTATTCAATGGG - Intergenic
1085149856 11:74242242-74242264 AGGTGCCAAGACAATTAAATGGG - Intronic
1085215926 11:74831874-74831896 GGGTGCCAAGACCATTCAGTGGG + Intronic
1085436022 11:76503487-76503509 AGATGCCAAGATCATTCAATGGG + Intronic
1085462892 11:76705827-76705849 AAATGATAAAATAATTCAGTGGG - Intergenic
1085926518 11:81030151-81030173 AGGTGCCATGATTATTCAATTGG - Intergenic
1086397083 11:86426843-86426865 AAGTGCCAAGAATATACAATGGG - Intergenic
1086570127 11:88273655-88273677 AAGTGCAATGGTAATTCAGTGGG + Intergenic
1086737513 11:90324285-90324307 AAGTGCCAAGAATATACACTGGG - Intergenic
1086923496 11:92614976-92614998 AGGTGCTAAGACAATTCAGCAGG - Intronic
1087230913 11:95662217-95662239 AAATGCCAAGATAGGTAAGTGGG - Intergenic
1087906012 11:103698511-103698533 TAGTGCCAAGACAATTCAATGGG - Intergenic
1088043043 11:105412257-105412279 AAGAGCCAAGGCATTTCAGTAGG - Intergenic
1088863620 11:113825246-113825268 CAGTGCCAAGATAATTCAATGGG + Intronic
1089194381 11:116685269-116685291 AGGTACCAAGGTAATTCAATGGG + Intergenic
1089266615 11:117267809-117267831 AAGTGCCAAGGTACCTCAATGGG - Intronic
1089686594 11:120152669-120152691 AGGTGCCAAGGTAATTCAACGGG - Intronic
1089871485 11:121676736-121676758 AACTGCCAAGGTAATTCAATGGG - Intergenic
1089946923 11:122485364-122485386 AGGTGCCAAGAACATACAGTGGG + Intergenic
1090760176 11:129829910-129829932 AGATGCCAAGACAATTCAATAGG + Intronic
1090966747 11:131604819-131604841 GTGTGCCAAGAAAATTCAATGGG - Intronic
1091190504 11:133691197-133691219 AGATGCCAAGACAATTCACTGGG + Intergenic
1091198857 11:133755164-133755186 AGGTGCCAAGGCAATTCACTGGG + Intergenic
1091210892 11:133859020-133859042 AGGTGCCAAGGCAATTCAGTGGG - Intergenic
1091313266 11:134590776-134590798 AAGTGCCAGGGCAATTCAATGGG - Intergenic
1092037856 12:5355496-5355518 AAGTGCCAAGACAATTCAATGGG + Intergenic
1092340560 12:7672415-7672437 AGGTGCCAAGATAATCCAATGGG - Intergenic
1092363631 12:7859063-7859085 GGGTGCCAAGATTATTCAATGGG - Intronic
1092632656 12:10399525-10399547 GAGTGCCAAGACCATTCAATGGG + Intronic
1092732704 12:11549152-11549174 ATGTGGTAAAATAATTCAGTGGG - Intergenic
1093322472 12:17730228-17730250 GAGTGCCAAGATTATTCAATGGG + Intergenic
1093422049 12:18985007-18985029 AGCTGCCAAGACAATTCAGTAGG + Intergenic
1093509669 12:19911591-19911613 AAGTGCCAAGAACATACAATGGG - Intergenic
1093975627 12:25418520-25418542 AGGTGCCAAGTCAATTCAATAGG - Intronic
1094457057 12:30647180-30647202 GAATGCCAAGACAATTCAATGGG + Intronic
1094784842 12:33835906-33835928 AGGTGCCAAGAAAATTCAACAGG + Intergenic
1095282029 12:40363583-40363605 AAGTGCAAAGATAATTCTTTTGG - Intronic
1095389983 12:41694575-41694597 AGGTGCCAAGAGCATTCAGCGGG + Intergenic
1096762892 12:53857943-53857965 AAGTGCCAAGACAATTCAGTGGG + Intergenic
1097135661 12:56852589-56852611 GAGTGCCAAGACAATTCAATAGG - Intergenic
1097298714 12:57995672-57995694 GAATGCCAAGACTATTCAGTGGG - Intergenic
1098030478 12:66248538-66248560 ATCTGCCAAGAACATTCAGTTGG + Exonic
1098039786 12:66342269-66342291 GGGTACCAAGATAATTCAATGGG - Exonic
1098339863 12:69440827-69440849 AAGAGCCAAGATATTTATGTTGG + Intergenic
1098413739 12:70209188-70209210 AGGTGCCAAGAAAACACAGTGGG - Intergenic
1098491638 12:71087904-71087926 AAGTGCCAAGAAGATACACTGGG - Intronic
1098566005 12:71936713-71936735 ACGTGCCAAGACAATTCAATGGG - Intergenic
1100075347 12:90774343-90774365 ATGTGCCAAGATAATTTAACAGG - Intergenic
1100335860 12:93628920-93628942 GAGTGTCAAAACAATTCAGTTGG - Intergenic
1100905279 12:99291618-99291640 AAGTGCCAAGAAAACACATTGGG + Intronic
1100925224 12:99538022-99538044 AAGTGCCAAGAACATACACTGGG - Intronic
1101380662 12:104211462-104211484 AAGTGCCAGGAAAATTGAGGAGG + Intergenic
1101498928 12:105283034-105283056 GGGTGCTAAGATAATTCAATGGG + Intronic
1101927903 12:108988489-108988511 TGGTGCCAAGATCACTCAGTAGG - Intronic
1102069628 12:110006964-110006986 GGGTGCCAAAATAATTCATTGGG - Intronic
1102664553 12:114559759-114559781 AAGTACCTAGAAAATTCAATAGG - Intergenic
1104217925 12:126752780-126752802 AAGTGCCTAGATAAGTCATGTGG + Intergenic
1104403776 12:128500082-128500104 GAGTGTCAAGACAATTCAGTGGG + Intronic
1104613865 12:130252856-130252878 AAGTCCCAAGCTCATTCAGTTGG - Intergenic
1104619019 12:130296110-130296132 AGGTGCCAAGAAAACTCACTGGG + Intergenic
1105305024 13:19162150-19162172 TGGTGCCAAGACCATTCAGTGGG + Intergenic
1105494102 13:20915166-20915188 TAGTGCCAAGACCATTCAATGGG + Intergenic
1105903809 13:24783159-24783181 GGGTGCCAAGAACATTCAGTGGG - Intronic
1106200377 13:27531645-27531667 AGGGGCCAAGACCATTCAGTGGG - Intergenic
1106238863 13:27891265-27891287 GAGTGCCAAGATTATTCAGTGGG - Intergenic
1107257674 13:38448144-38448166 GAGTGCCAAAACAATTCAGTGGG - Intergenic
1107271841 13:38628341-38628363 GTGTGCCAAGATAATTAACTGGG - Intergenic
1107918029 13:45172716-45172738 AGGTGCCAAGAGAATTCAATGGG - Intronic
1108255490 13:48605917-48605939 AGGTGCCAAGAACATACAGTGGG - Intergenic
1108487282 13:50939653-50939675 AAGTGTGAAGATAATTCAGTGGG + Intronic
1108535498 13:51372341-51372363 AAAGGGCAAGATAATTGAGTGGG - Intronic
1109465306 13:62724084-62724106 AGTTGCCAAAATAATCCAGTGGG - Intergenic
1110732463 13:78895069-78895091 AGGTGCCAAGGCAATTCAATGGG - Intergenic
1110949746 13:81470897-81470919 AAGTGCCAAGAACATACATTGGG + Intergenic
1110965200 13:81685905-81685927 TAGTGTGAAGATAATTCAGTAGG - Intergenic
1111139034 13:84089771-84089793 AAAAGCAAAGAGAATTCAGTAGG - Intergenic
1111510893 13:89261453-89261475 AGGTGCCAAGAATATACAGTGGG - Intergenic
1112403517 13:99097209-99097231 CAGTGCTAAGACCATTCAGTGGG + Intergenic
1112605982 13:100906542-100906564 GAGTGCCAAGAACATTCAGTGGG + Intergenic
1112756381 13:102638951-102638973 AAGTGCCAAAATCAGTGAGTTGG - Intronic
1112759934 13:102683637-102683659 AGGTGCCAAAGTAATTCAATGGG - Intergenic
1113631401 13:111887688-111887710 AGGTGCCAAGACAATTCAATGGG - Intergenic
1113924609 13:113934550-113934572 AGGTGCCAAGACAACTCAATGGG + Intergenic
1114127071 14:19740993-19741015 AAGTGCCAAGAACATACATTGGG + Intronic
1114526057 14:23367412-23367434 AGGTGCCCAGGTAATACAGTGGG - Intergenic
1114864840 14:26577370-26577392 AATTTCAAAGATAATTCACTGGG - Intronic
1115833172 14:37364492-37364514 AAGTGCCAAGAACATACACTGGG - Intronic
1115921238 14:38376365-38376387 AATTGCCTTGATAATTCATTTGG + Intergenic
1115966408 14:38894408-38894430 AAGTGCCAAGAATATACAATGGG + Intergenic
1116506192 14:45684793-45684815 AAGTGCCAAGAACATACAATAGG - Intergenic
1116754806 14:48933964-48933986 AGGTGCCAAAGTAATTCAATGGG + Intergenic
1117010503 14:51466518-51466540 AAGTGCCAAAATGATTCAATGGG - Intergenic
1117120303 14:52560636-52560658 AAGTGCCAAGGTAATTTAGTGGG + Intronic
1117224845 14:53645356-53645378 AGGTGCCAAGAACATTCACTGGG - Intergenic
1117381102 14:55164373-55164395 AGGTGCCAATACAATTCAGCGGG + Intronic
1117606523 14:57434584-57434606 AAGTGCCAAGAACATACACTGGG - Intergenic
1117633552 14:57719101-57719123 AAGTGCCAAGAACATACACTGGG - Intronic
1117821568 14:59655698-59655720 GGGTGCCAAGACCATTCAGTGGG + Intronic
1117934213 14:60883342-60883364 AAGTGCCAAGACCATACATTTGG - Intronic
1118218948 14:63837171-63837193 GAGTGCCAAGAAAATTCAATGGG + Intergenic
1118298514 14:64592734-64592756 GGGTGCCAAGACAATTCAATGGG + Intergenic
1119523832 14:75306506-75306528 AAGTGCCAAGACCATTCAATGGG - Intergenic
1119570906 14:75671170-75671192 TAGTGCCAAGACCATCCAGTGGG - Intronic
1119698945 14:76737406-76737428 AAGTGCCAAGAACATACATTGGG - Intergenic
1120044924 14:79794951-79794973 AAGTGCAAAGATAAATGATTAGG + Intronic
1120368416 14:83600736-83600758 AGGTGCCAAGATGAATCAATGGG - Intergenic
1120635761 14:86949002-86949024 AAGTGCCAAGAAAGTTCAATGGG - Intergenic
1120806518 14:88757199-88757221 TGGTGCCAAGACAATTCAATGGG + Intronic
1120833519 14:89019651-89019673 GAGTGCCTAGAAAATTCAATGGG - Intergenic
1120915321 14:89705345-89705367 TAGTGGCAAGTTAATTAAGTAGG - Intergenic
1120963083 14:90142667-90142689 CAGTGCCAAGGCAATTCACTTGG - Intronic
1121130842 14:91445855-91445877 AAGTGCCAAGAACATACACTGGG + Intergenic
1121581171 14:95032423-95032445 TGGTGCCAAGATAATTCAATGGG - Intergenic
1121726337 14:96154164-96154186 AAGTGCCGATATAATCCAATGGG + Intergenic
1121912545 14:97804540-97804562 ATGTGCCAAAATAATTCAACTGG + Intergenic
1202901669 14_GL000194v1_random:46947-46969 GGGTGCCAAGATTATTCAGTGGG + Intergenic
1123424039 15:20154544-20154566 AAGTGCCAAGAAAAAGCATTTGG + Intergenic
1123533259 15:21161073-21161095 AAGTGCCAAGAAAAAGCATTTGG + Intergenic
1123570531 15:21602632-21602654 AAGTGCCAAGAACATACATTGGG + Intergenic
1123606645 15:22037986-22038008 AAGTGCCAAGAACATACATTGGG + Intergenic
1123792933 15:23740831-23740853 AAGTTCCAAAACAATTCAATGGG - Intergenic
1124475603 15:30031409-30031431 GAGTGCCAAGATCATTCAAAGGG - Intergenic
1124572815 15:30881722-30881744 AAGTGCCAAGATCACACACTGGG - Intergenic
1124843707 15:33269101-33269123 AAGTGCCAAGAACATACACTGGG - Intergenic
1125215374 15:37266974-37266996 GGGTGCCAAGACAATTCAATGGG + Intergenic
1125275638 15:37987630-37987652 GTGTGCCAAGACAATTCACTGGG - Intergenic
1125418977 15:39484636-39484658 AATAGGCAAGACAATTCAGTGGG + Intergenic
1125554834 15:40575678-40575700 AAGTGCTAAGACTGTTCAGTGGG + Intergenic
1125830445 15:42712582-42712604 GGGTGCCAAGACAATTCAATGGG - Intronic
1125890642 15:43263536-43263558 AGGTGCCAAGACAATTCAATGGG + Intronic
1126503662 15:49378124-49378146 AAGTGCCAAGAACATACATTAGG - Intronic
1126570770 15:50147888-50147910 GAGTGCCAAAATCATTCAGTGGG + Intronic
1126770860 15:52054463-52054485 AAGTGTCAAGATAATTCAGTGGG - Intronic
1126927560 15:53607400-53607422 AAGTGCCAAGAACATACATTGGG + Intronic
1127178298 15:56385116-56385138 AAGTGCTAAGAACATTCAATGGG - Intronic
1127209241 15:56755622-56755644 GTGTGCCAAGACAATTCAATGGG + Intronic
1127283747 15:57514866-57514888 GGGTGCCAAGACAATTCAATGGG - Intronic
1127441048 15:59008545-59008567 AAGTGCCAAGATAATGAGGAAGG - Intronic
1127822512 15:62671545-62671567 GGGTTCCAAGACAATTCAGTGGG - Intronic
1128006311 15:64245011-64245033 AGGTGCCAAGAACATTCAGTAGG + Intronic
1128316815 15:66665222-66665244 AGTTTCCAAGATAATTCAATGGG - Intronic
1128381033 15:67112906-67112928 GGGTGCCAAGACAATTCACTGGG - Intronic
1128899322 15:71405456-71405478 AGGTGCCAAGACAATTCATTAGG - Intronic
1128955915 15:71944615-71944637 AGGCACCAAGATAATTTAGTGGG - Intronic
1130121952 15:81057891-81057913 AAGTGCCAAAACAATTCAATGGG - Intronic
1130307659 15:82725281-82725303 CAATCCCAAGATAATTCAGTGGG - Intergenic
1130758591 15:86793363-86793385 GAGTTCCAAGATCATTCAGTAGG + Intronic
1131470229 15:92690170-92690192 AAGTGGCAAGATAAGTCACTAGG - Intronic
1131922816 15:97348835-97348857 AAGTGCTCAGATAGTTCAGTGGG - Intergenic
1131987311 15:98056715-98056737 AGGTGCCAAGAACATACAGTAGG - Intergenic
1132127885 15:99245610-99245632 GCATGCCAAGATAATTCAATGGG + Intronic
1132199178 15:99936943-99936965 GAGTGGCAAGATCATTAAGTAGG - Intergenic
1202978884 15_KI270727v1_random:329756-329778 AAGTGCCAAGAACATACATTGGG + Intergenic
1132791834 16:1694708-1694730 GGGTGCCAAGATCATCCAGTGGG + Intronic
1132811737 16:1802674-1802696 AGATGCCAAGACATTTCAGTTGG - Intronic
1134432726 16:14226407-14226429 AGGTGCCAAGACCATCCAGTGGG + Intronic
1134437228 16:14271604-14271626 AAAAGCCAAAATAATTCAGTGGG + Intergenic
1134873532 16:17675159-17675181 AGGTGCCAAAATAATTTAATGGG - Intergenic
1135542368 16:23341191-23341213 AGGTGCCAAGACAATTAAATGGG + Intronic
1135894777 16:26389319-26389341 AAGTGCCAGTGCAATTCAGTGGG - Intergenic
1136860830 16:33701342-33701364 AAGTGCCAAGAAAAAGCATTTGG - Intergenic
1137337108 16:47560638-47560660 ATGTGCAAAGACAATTCAGGGGG + Intronic
1137341282 16:47608731-47608753 GGGTGCCAAAACAATTCAGTAGG - Intronic
1137473703 16:48787603-48787625 ATGTGCTAAGATACTTCAGTGGG - Intergenic
1137989860 16:53143196-53143218 AAGTGTATAGATAATGCAGTTGG + Intronic
1138005803 16:53336352-53336374 GAGTGCCAAGACAATTCAATGGG + Intergenic
1138486340 16:57346845-57346867 GAGTGCCAAGATAATTCAATGGG + Intergenic
1139153778 16:64416022-64416044 TAGTGGCATGTTAATTCAGTTGG - Intergenic
1139807675 16:69582623-69582645 GAGTGCCAAGACCATTCAATGGG - Intronic
1140171195 16:72606793-72606815 AAGTGCCAAGATAATTCAATGGG + Intergenic
1140421156 16:74820167-74820189 AGGTGCCAAGATCACTCACTGGG - Intergenic
1141061025 16:80870483-80870505 AAGTTCCAATTTAATTCAATGGG + Intergenic
1141122840 16:81374847-81374869 AGGTGCCAAGGCAATTTAGTGGG + Intronic
1142384576 16:89755106-89755128 GGGTGCCAAGACCATTCAGTGGG + Intronic
1203122325 16_KI270728v1_random:1549525-1549547 AAGTGCCAAGAAAAAGCATTTGG - Intergenic
1143148727 17:4793759-4793781 GGGTGCCAAGATCATTCAATGGG + Intergenic
1144122012 17:12164535-12164557 AAGTGCCAAGACTGTTCAGTGGG - Intergenic
1144150827 17:12442114-12442136 AAGTGCCAAGAACATACATTAGG + Intergenic
1144387021 17:14757699-14757721 AATTACCAAGATAATTCACTGGG - Intergenic
1144636765 17:16915021-16915043 AAGTGCCAAGATCATTCAATGGG + Intergenic
1145092110 17:19994535-19994557 AAGTGCTAAGAAAATTCGGTTGG - Intergenic
1145853495 17:28127993-28128015 AGGTGCCACTATAATCCAGTCGG + Intronic
1146027910 17:29338709-29338731 ATGTGCCAAGATGATTCAATGGG + Intergenic
1146600243 17:34208260-34208282 GGGTGCCAAGATAATTCAATGGG - Intergenic
1146875031 17:36402708-36402730 AAGTGCCAGGATCATTCAGTGGG - Intronic
1146963267 17:37003173-37003195 GAGTACCAAGACGATTCAGTGGG + Intronic
1147064357 17:37910162-37910184 AAGTGCCAGGATCATTCAGTGGG + Intergenic
1147128434 17:38390187-38390209 AGATGCCAAGACAATTCAATGGG - Intronic
1147174242 17:38643013-38643035 AAGAGTCAAGGTACTTCAGTGGG + Intergenic
1147274777 17:39306521-39306543 AAATGCCAGGACCATTCAGTGGG - Intronic
1148246232 17:46032532-46032554 AAGTGCCTAGTGAATTCAGGAGG + Intronic
1150073984 17:62176791-62176813 AAGTGCCAAAATAATTCAATAGG + Intergenic
1150921092 17:69483821-69483843 GAGTGCCAAGACAATTCAGGGGG + Intronic
1151270710 17:72993596-72993618 AGTTGCCATTATAATTCAGTGGG - Intronic
1151503360 17:74507283-74507305 AAGTGCCAAGAACATTCACTGGG - Intergenic
1152147729 17:78578814-78578836 AGGTGCCAAGACAACTCAATGGG + Intergenic
1152692087 17:81723116-81723138 GGATGCCAAGACAATTCAGTGGG + Intergenic
1152972878 18:181983-182005 AGGTGCTAAGACAATTCAGTGGG - Intronic
1153036439 18:767520-767542 AGGTAACAAGGTAATTCAGTGGG - Intronic
1153613949 18:6917110-6917132 AACTGCCAAGGCAATTCAGTGGG + Intergenic
1153845392 18:9044825-9044847 AGGTGCCAAGATTATTCAGTGGG + Intergenic
1153870551 18:9315667-9315689 AAGTGCCAATGAAATTCAATGGG + Intergenic
1154233206 18:12577021-12577043 AAGTGCCAAGGTAGTTCAATGGG + Intronic
1154972666 18:21426465-21426487 CAGTGCCAAGAAAATTCAAGGGG - Intronic
1155406923 18:25499022-25499044 ACGTGCCAAGTCAATTCAATGGG + Intergenic
1155790030 18:29954577-29954599 AAATACCAAAATAATTGAGTTGG - Intergenic
1156210813 18:34940230-34940252 AGGTGCCAACATAATCCAATGGG + Intergenic
1156241174 18:35256003-35256025 AAGTGGCAATATAATTGTGTAGG + Intronic
1156293257 18:35768439-35768461 TGGTGCCAAGAAAATTCAATGGG - Intergenic
1157686778 18:49649172-49649194 AAGTGCCAAGACAAGTCAATAGG + Intergenic
1157769279 18:50331198-50331220 AGTTACCAAGATAATTCAATGGG - Intergenic
1157791854 18:50539489-50539511 AGGTCCCAAGGTAATTCAATAGG - Intergenic
1158138670 18:54233139-54233161 AAGTTCAAAGATAATTTACTGGG - Intergenic
1158746981 18:60212404-60212426 ATGTGCCAAGATAATCCACTGGG - Intergenic
1158986489 18:62822882-62822904 AGGTACCAAGGCAATTCAGTAGG + Intronic
1159074458 18:63664795-63664817 AAATGCCAAGATACATAAGTTGG - Intronic
1159701062 18:71628301-71628323 GAGTGCCAAGAAAATTCAATGGG + Intergenic
1160252548 18:77215877-77215899 AAATGCCAAGATAATTCAATGGG - Intergenic
1161366775 19:3884478-3884500 AAGTTCAAAGAGAATCCAGTAGG - Intronic
1162240552 19:9350080-9350102 GAGTGCCAAGACAATTCAATGGG - Intronic
1163147781 19:15393059-15393081 AGATGCCAAGATCATTCAATGGG + Intronic
1163825634 19:19522892-19522914 AGGTGCCAAGATAATTCAATGGG - Intronic
1164471605 19:28541081-28541103 AGCTGCCAAGGTAATTCAATAGG + Intergenic
1164786947 19:30940977-30940999 AGGTGCCAGGGTAATTCAATGGG - Intergenic
1165271967 19:34716798-34716820 AAGTGCCAAGAACATTTATTGGG + Intergenic
1165287755 19:34856779-34856801 AAGTGCCAAGAACATACATTGGG + Intergenic
1165638051 19:37360189-37360211 AGGTGCCAAGGTAATTCAATGGG - Intronic
1165764170 19:38340172-38340194 AGGTGCCAAGACAATTCAGCGGG - Intronic
1165876370 19:39010372-39010394 CGGTGCCAAGACCATTCAGTGGG - Intronic
1166050953 19:40259127-40259149 AGATGCCAAGATCATTCAATGGG + Intronic
1166201758 19:41242291-41242313 GAGTGCCAGGATAGTTCAGGTGG - Intronic
1166405280 19:42517057-42517079 GGGTGCCAAGATCATTCAGTGGG + Intronic
1166417161 19:42604160-42604182 GAGTGTCAAGATAATTTAATGGG - Intronic
1166463602 19:43013004-43013026 GTGTGCCAAGATCATTCAATGGG + Intronic
1166469753 19:43069581-43069603 GTGTGCCAAGATCATTCAATGGG + Intronic
1166969364 19:46553801-46553823 GAGTGCCAAGATCATTTAATGGG - Intronic
925678396 2:6390802-6390824 AAATGCCAAGGCAATTCATTAGG - Intergenic
926044940 2:9703490-9703512 CAGTGCCAAGAGACATCAGTGGG - Intergenic
926129655 2:10294447-10294469 AGATGCCAAGACAATTCAATGGG - Intergenic
926449071 2:12980480-12980502 AAGTGCCAAGCTAATTTAATTGG + Intergenic
926531979 2:14059271-14059293 ATGTGCCAAGAAAATTCGATAGG + Intergenic
926813640 2:16779056-16779078 AGGTGCCAAGATAATGTAGCTGG + Intergenic
926835705 2:17017508-17017530 ATATGCCAAGATAATTCAGTAGG - Intergenic
926903481 2:17783722-17783744 GAGTGCCAAGACAATTCAATGGG + Exonic
927309387 2:21612285-21612307 AAGTGCCAAGAACATACACTGGG - Intergenic
927421587 2:22938390-22938412 AGATGCCAAGGTAATTCAATTGG + Intergenic
927431373 2:23029096-23029118 AATTGCCAAGATAAATCAGGTGG + Intergenic
927984418 2:27398232-27398254 TGATGCCAAGATAATTCAATGGG + Intronic
928008886 2:27588530-27588552 AGATGCCAAGGCAATTCAGTAGG - Intronic
928151462 2:28833593-28833615 GGGTGCCAAGAAAATTCAATGGG + Intronic
928698590 2:33875908-33875930 GGGTGCCAAGATAATTCAGTGGG - Intergenic
928781607 2:34828935-34828957 AAGTGCCAAGAACATACATTGGG - Intergenic
929713725 2:44290195-44290217 AAGTTGCCAGACAATTCAGTAGG - Intronic
930429741 2:51259540-51259562 ACTTGCCAAATTAATTCAGTTGG + Intergenic
930496542 2:52152088-52152110 GGGTGCCAAGATCATACAGTGGG + Intergenic
930759670 2:55020430-55020452 AAATGCCAAGAACATTCATTGGG + Intronic
931112787 2:59130827-59130849 AGTTGCCAAATTAATTCAGTGGG + Intergenic
931457316 2:62421970-62421992 AGGTGCCAAGAATATACAGTGGG + Intergenic
931896676 2:66739397-66739419 GGGTGCCAAGACAATTCAATGGG - Intergenic
932170110 2:69547026-69547048 GGGTGCCAAGACAATTCAATGGG + Intronic
932557501 2:72838002-72838024 GAGTGACAAGATAATTCAATAGG - Intergenic
932652670 2:73576083-73576105 GAGTGCCAAGAACATTCAATGGG - Intronic
933392746 2:81692782-81692804 AAGTGCCAGGAGAATTGACTTGG + Intergenic
933413414 2:81953087-81953109 AGGTGCCAAGACAATTCAATGGG + Intergenic
933643562 2:84790139-84790161 AGGTGCCAAGGCAATTCAATGGG + Intronic
933673377 2:85030599-85030621 GAGTGCCAAGACAATGCATTGGG - Intronic
933855451 2:86409547-86409569 GAGTGCCAAGATCATTTAATGGG + Intergenic
933863417 2:86493489-86493511 GAGTGCCAAGACCATTCAATGGG - Intergenic
933934255 2:87188181-87188203 AAGTTCCAATATAACTAAGTAGG + Intergenic
934318293 2:91946938-91946960 AGATGCTAAGACAATTCAGTAGG + Intergenic
934459209 2:94202498-94202520 AAGTGCCAAGAAAAAGCATTTGG - Intergenic
934505095 2:94884163-94884185 GGGTGCCAAGATTATTCAGTGGG - Intergenic
935030349 2:99315755-99315777 AAGTTCCAAGACAATTCAAATGG - Intronic
935052774 2:99537529-99537551 GGGTGCCAAGAAAATTCAATGGG + Intergenic
935195442 2:100812021-100812043 AAGTACCAAGACAATTCAATGGG - Intergenic
935519613 2:104088186-104088208 AAGTGCCAAGATGATTTAATGGG - Intergenic
935609752 2:105009619-105009641 TAGTGCTAAGTTAATTCAGCAGG + Intergenic
935613490 2:105051309-105051331 AAGTGATAAAATAATTCAATGGG - Intronic
935728855 2:106048026-106048048 AGGTGCCAAGATAATTTAGTGGG - Intergenic
936242896 2:110803395-110803417 CAGAGCCAAGACAATTCAATGGG + Intronic
936358887 2:111777714-111777736 AAGTTCCAATATAACTAAGTAGG - Intronic
937327351 2:120998722-120998744 AAGTGCCAAGGCAATTCAATAGG + Intergenic
937749949 2:125463581-125463603 ATGTGCCAAGATAAATAAATGGG + Intergenic
937992036 2:127669143-127669165 GAGTGCCAAGACCATTCAATGGG + Intronic
938136237 2:128759332-128759354 GAGTACCAAGATCATTCAGTGGG - Intergenic
938770044 2:134493882-134493904 AGGTGCCAAGGTAATTCAATGGG - Intronic
938818700 2:134931341-134931363 CAATCCCAAGAAAATTCAGTGGG - Intronic
938844285 2:135192757-135192779 GGGTGCCAAGATCATTCAATGGG + Intronic
938877083 2:135543235-135543257 CAGTGCCAAGACAATTCAATGGG - Intronic
939080088 2:137649543-137649565 AGGTGCCAAGAACATGCAGTGGG - Intronic
939385052 2:141485447-141485469 CAGTGCTAGGATATTTCAGTTGG + Intronic
939890940 2:147735492-147735514 AGGTGTCAAGAACATTCAGTGGG + Intergenic
940570309 2:155423995-155424017 AAGTGCCAACAGCATTCACTGGG - Intergenic
940952821 2:159695645-159695667 GAATGCCAAGGTAATTCAATGGG - Intergenic
941117184 2:161485777-161485799 AAGTGCCAAGAACATACACTGGG + Intronic
941737914 2:169000540-169000562 AAGTGGAAAAACAATTCAGTGGG - Intronic
941846191 2:170136046-170136068 AGGTGCCAAGAACATTTAGTGGG + Intergenic
942365747 2:175224889-175224911 AGGTGCCTAGACAATTCAATGGG - Intergenic
942609278 2:177725921-177725943 AATTGCCAAAATAAGTAAGTAGG - Intronic
942894542 2:181036291-181036313 AAATGCCAAGGTAATTCAGTAGG + Intronic
943055417 2:182971788-182971810 AAGTGCCAAGAATATACATTGGG + Intronic
943138210 2:183942808-183942830 AGGAGCCAAGAACATTCAGTGGG + Intergenic
943220151 2:185093518-185093540 AGGTGCCAAGAGCATTCATTGGG + Intergenic
943475518 2:188349974-188349996 AGGTGCCAAGACAAATCATTGGG - Intronic
943550619 2:189334950-189334972 AGGTGTCAAGATAATTTAATAGG + Intergenic
943931959 2:193866307-193866329 AGGTGCCAAGAGCATTCAATAGG - Intergenic
943974362 2:194452438-194452460 AGATGCCAAGATACTTCAATGGG - Intergenic
944009138 2:194951895-194951917 GAGTGCCAAGATAATGAAATGGG + Intergenic
944457028 2:199905885-199905907 AAGTGCCAAGATAATTCAATGGG - Intergenic
944508040 2:200435027-200435049 AGGTACCAAGACAATTCAATGGG + Intronic
944638222 2:201695388-201695410 CAGTGACATGATAGTTCAGTGGG - Intronic
944722540 2:202438727-202438749 GGGTGCCAAGACAATTCAATGGG - Intronic
945113330 2:206386330-206386352 ATTTGCCAAGGCAATTCAGTGGG + Intergenic
945237805 2:207648485-207648507 AGGTGCCAAGAGAATTCAATGGG + Intergenic
945371843 2:209028397-209028419 AAGTGCCACGAGTATTCATTTGG + Intergenic
945905842 2:215592436-215592458 GAGTGGCAAGATAATTCATGGGG - Intergenic
946184233 2:217969200-217969222 TGATGCCAAGATCATTCAGTGGG + Intronic
946390509 2:219413294-219413316 AGGTGCCCAGACCATTCAGTGGG + Intergenic
946761186 2:222994830-222994852 AAGAGCCAAGATAATGCAAAGGG - Intergenic
947014469 2:225602724-225602746 AACTGCCAAGATCATTCACTGGG - Intronic
947130565 2:226919588-226919610 AGGTGCCAAGAGAATACACTGGG - Intronic
947911799 2:233805793-233805815 GGGTGCCAAGACAATTCAGTGGG + Intronic
948442675 2:238005669-238005691 AGGTGCCAAGGTAAGTCAATGGG - Intronic
948579334 2:238973334-238973356 AAATGCCAAGATAATTCATGAGG + Intergenic
948579658 2:238976745-238976767 AAGTGCCAAGATAATTCAATGGG + Intergenic
948914149 2:241022491-241022513 GGGTGCCAAGGTTATTCAGTGGG - Intronic
948960519 2:241331950-241331972 AAAAGCCAAGTTGATTCAGTGGG + Intronic
948985023 2:241516222-241516244 GTATGCCAAGACAATTCAGTTGG + Intergenic
949067396 2:242001524-242001546 AGGTCCCAAGGAAATTCAGTGGG - Intergenic
1169038646 20:2474659-2474681 GGGTGCCAAGATTATTCAGTGGG - Intronic
1169237147 20:3939461-3939483 GGGTGCCAAGACAATTCAGTGGG - Intronic
1169238713 20:3955396-3955418 GGGTGCCAAGATCATTCAATGGG - Intronic
1169396235 20:5232472-5232494 GGGTGCCAAGACCATTCAGTGGG + Intergenic
1169949272 20:11025195-11025217 GGGTGCCAAGACAATTCAATAGG - Intergenic
1170143664 20:13149870-13149892 AAGCGCAAAGATAATGCCGTTGG + Intronic
1170273655 20:14557099-14557121 GAGTGCCAAGACAATTCAATGGG + Intronic
1170539870 20:17376655-17376677 AAGTGCCAAAATGAATGAGTAGG - Intronic
1170563873 20:17582577-17582599 GAGTGCCAGGATAATTCAGTTGG + Intronic
1170909833 20:20555187-20555209 GGGTGCAAAGACAATTCAGTCGG - Intronic
1171397990 20:24851277-24851299 ATGTGCCAAGGTAATCCAATAGG + Intergenic
1171892762 20:30730928-30730950 GGGTGCCAAGATTATTCAGTGGG - Intergenic
1172173035 20:32954393-32954415 AAGTGCCAAGACCACTCAATTGG - Intronic
1172961518 20:38803912-38803934 GAGTGCCAAGACAATTTAATGGG - Intergenic
1173238721 20:41273619-41273641 CAGTGCCAAGATGATTCACTGGG - Intronic
1174727856 20:52882249-52882271 AAGTGCCAAGATAATTCAGTGGG - Intergenic
1174873854 20:54207636-54207658 ATGTGCCATGATAATTCAGGTGG - Intergenic
1175679046 20:60971608-60971630 AGATGTCAAGATAATTCATTGGG + Intergenic
1176621041 21:9061721-9061743 GGGTGCCAAGATTATTCAGTGGG + Intergenic
1177165371 21:17596547-17596569 AAGTGCCAAAGCAATTCAATGGG - Intronic
1177256627 21:18671459-18671481 AGGTGCCAAGAATATTCATTGGG + Intergenic
1177456668 21:21348811-21348833 AAGTGCCAAGAATATACAATAGG + Intronic
1177795511 21:25774692-25774714 AGGTGCCAAGGTAATTCAATAGG + Intergenic
1177813059 21:25945664-25945686 TAGTGCCAAGACCATTCAATGGG + Intronic
1178101781 21:29277636-29277658 AAGTGCCAAAGTAAATCAATGGG + Intronic
1179009381 21:37544226-37544248 AGGTACCAAGGTAATTCAATGGG + Intergenic
1179193975 21:39147814-39147836 AGGTGCCAAGGTAATTCAACAGG - Intergenic
1179411420 21:41166811-41166833 AACAGCCAACATAATTCAGCTGG + Intergenic
1179434832 21:41353535-41353557 CAGTGCCAAGATTATTTAATGGG + Intronic
1179634730 21:42700739-42700761 AGGTGTCATGGTAATTCAGTGGG - Intronic
1180191172 21:46163611-46163633 GAGTGCCAAGACAATTCAGGAGG - Intronic
1181004411 22:20004771-20004793 AGGTGCCAAGACCATTCATTAGG + Intronic
1181113179 22:20613773-20613795 AACTGCCAAGACCATTCAGTGGG + Intergenic
1181357000 22:22303991-22304013 AAGTGCCAAGAAAAAGCATTTGG + Intergenic
1181835079 22:25598926-25598948 AAATGCCAAGACAATTTAGTGGG + Intronic
1182507926 22:30798688-30798710 GTGTGCCAAGACCATTCAGTAGG - Intronic
1183859228 22:40657310-40657332 AGATGCCAAGACAATTCATTGGG - Intergenic
1184013677 22:41769289-41769311 GGATGCCAAGATAATTCAATGGG + Intronic
1184148298 22:42624234-42624256 ATGTGCCAAGATACTCCAGGGGG + Intronic
1184700322 22:46167107-46167129 AAGTGCCAAGTCATTTAAGTGGG + Intronic
1184905132 22:47477858-47477880 GGGTGCCAAGACAATTCAGTGGG - Intronic
949345643 3:3074018-3074040 AAATGCCAAGGCAATTCACTGGG + Intronic
949349799 3:3113843-3113865 GAGTGTCAAGACAATTCAGCGGG + Intronic
949686844 3:6583858-6583880 AAGTGTCATGGTAATTCAATGGG - Intergenic
950595771 3:13980040-13980062 AAGTGAGATGATAATTTAGTGGG - Intronic
950598119 3:14003825-14003847 AAGTGTCAAGACAATTCCATGGG - Intronic
950735002 3:14999769-14999791 AGGTGCCACGATAATTCAATAGG - Intronic
950828411 3:15850111-15850133 AGATGCCAAGACAATTCAATGGG + Intronic
951090552 3:18568424-18568446 GAGTGGTAAAATAATTCAGTAGG - Intergenic
951176069 3:19601759-19601781 AGGTGCCAAGAACATACAGTGGG + Intergenic
951616613 3:24553696-24553718 GGGTGCCATGATAATTCAATGGG - Intergenic
951719546 3:25683392-25683414 GGGTGCCAAGATCATTCAATAGG + Intergenic
951793755 3:26515824-26515846 AAGTGCCAAGAACATTCACTGGG - Intergenic
952318157 3:32250137-32250159 GAGTGCCAAGATAATTCAATGGG - Intronic
952566680 3:34667734-34667756 GATCGCCATGATAATTCAGTGGG - Intergenic
952786327 3:37159251-37159273 GGGTGGCAAGGTAATTCAGTGGG - Intronic
952811200 3:37404903-37404925 AAGTGCCAAGAACATACATTGGG - Intronic
952969054 3:38639286-38639308 AAGTGCCAAATGAATTTAGTTGG + Intronic
953273306 3:41468383-41468405 AGGTGCTAATATAATACAGTAGG + Intronic
953585051 3:44192160-44192182 GAGTGCCAAGATAAAGCACTTGG + Intergenic
954287929 3:49632051-49632073 GAGTGCCAAGACCATTCAGTAGG + Intronic
954477138 3:50757851-50757873 AGGTGCCAAGACAATTCAACAGG - Intronic
954522782 3:51243962-51243984 GAATGCCAAGACCATTCAGTGGG - Intronic
954584676 3:51722796-51722818 GGGTGCCAATATAATGCAGTGGG - Intergenic
954966338 3:54614443-54614465 AAGTGACAAGTAAATACAGTGGG - Intronic
955336573 3:58091411-58091433 AGGTGCAAAGATAAGTCATTGGG + Intronic
955460368 3:59175458-59175480 AAGTGCCAAGAACATACACTGGG - Intergenic
955621558 3:60869743-60869765 AAGTGCCAAGATAAATAATAGGG + Intronic
955646620 3:61145303-61145325 AAGAACCAAGACAATTCAATAGG - Intronic
955847985 3:63187671-63187693 AGGTGCCAAGATTATACACTGGG - Intergenic
956462810 3:69488460-69488482 AGGTGCCAAGTCAATTCAATAGG + Intronic
956597497 3:70983887-70983909 ATTTGCCAAGATACTTCATTTGG - Intronic
956988655 3:74735665-74735687 AAGTGTCAAGGTAACTCAATTGG - Intergenic
957016686 3:75072257-75072279 AATTTCCAAGATAAGTCAATTGG + Intergenic
957597485 3:82287108-82287130 AAGTGCAAAGACAATCCAGGGGG - Intergenic
957727147 3:84082248-84082270 AACTGCCAAGATAGTTAAATAGG - Intergenic
957755826 3:84485937-84485959 AAGTGCCAAGAACATACAATGGG - Intergenic
957964146 3:87300595-87300617 AAGTGTTAAGATAATTCAAGAGG + Intergenic
957966721 3:87331290-87331312 AAGTGCAATGATAATGTAGTTGG + Intergenic
958252586 3:91287772-91287794 AGGTGCCAAAATAATTCAGTGGG + Intergenic
959414272 3:106064733-106064755 AAGTGCCAAGAACATACATTGGG + Intergenic
959471382 3:106755629-106755651 AGGTGCCAAGAATATTCATTGGG + Intergenic
959977500 3:112477886-112477908 GGGTACCAAGATTATTCAGTGGG - Intronic
960077239 3:113501136-113501158 GAGTTCCAAGATCATTCAATGGG + Intronic
960881031 3:122345131-122345153 GGGTGCCAAGATAATTCGATGGG - Intergenic
960931078 3:122850962-122850984 AACTGCCAAGCTAATAGAGTGGG - Intronic
961409671 3:126710209-126710231 AGGTTCCAAGATAATTCAATGGG - Intronic
961411347 3:126723068-126723090 GGGTGCCAAGATGGTTCAGTGGG - Intronic
961912672 3:130336637-130336659 AAGTGCCAAGAACATACATTGGG + Intergenic
961946413 3:130694019-130694041 AGGTGTCAGGATATTTCAGTTGG - Intronic
962265525 3:133941841-133941863 AAGAGCAAAGAGAATTTAGTTGG - Intronic
962276278 3:134016976-134016998 AAGTGACAAGATTATACAGGTGG + Intronic
962291332 3:134138949-134138971 AAGTGCCAAAAACATTCACTGGG + Intronic
962347911 3:134634468-134634490 AAGTGCAAAGACAATTCAGTTGG + Intronic
962433331 3:135341127-135341149 GAGTACCAAGATAATTCAATGGG + Intergenic
962529777 3:136268290-136268312 ATGTGTCAAGACAATTCAATGGG - Intronic
962668523 3:137680880-137680902 AAGTGCCAAGAACATACAATGGG + Intergenic
962698832 3:137977502-137977524 AGGTGCCAAGAACATTCACTTGG - Intergenic
962871819 3:139502920-139502942 AAGTGCCACTATGATTCAATGGG + Intergenic
963079386 3:141376864-141376886 AAGGGCAAAGATTGTTCAGTGGG + Intronic
963242344 3:143019546-143019568 AAGTGCCAACATAATTTAATAGG - Intronic
963257792 3:143163106-143163128 AGGTGCCAAGTTAGTTCAATGGG + Intergenic
963731954 3:148983254-148983276 TCGTGCCAAGACAATTCAGTGGG + Intergenic
964085090 3:152807352-152807374 TAGTGTAAAGATAATTCAGCGGG - Intergenic
964278632 3:155036990-155037012 AGGTGCCAAGGCAATTCAATGGG - Intronic
964306874 3:155350834-155350856 AGATGCCAAGACCATTCAGTGGG - Intergenic
964537662 3:157742119-157742141 AAATGCCAGGATAATTCAATGGG + Intergenic
964671682 3:159233186-159233208 ATGTTCCAAGAGAATTAAGTCGG + Intronic
964725617 3:159811549-159811571 AGGTGCCAAGGTAATTCAATGGG - Intronic
964807125 3:160622687-160622709 AAGAGCCAAGGGAATGCAGTAGG - Intergenic
964939994 3:162147259-162147281 AAGTGCCTAGAACATTCACTGGG + Intergenic
965256314 3:166417550-166417572 AACTGCTAAGGTAATTCACTGGG + Intergenic
965604911 3:170488572-170488594 AGGTGCCAAGAACATTCACTGGG + Intronic
965611820 3:170552216-170552238 TAGTGTCAAGACAATTCAATAGG + Intronic
965744537 3:171910562-171910584 GAGTGTCAAGATTATTCAATGGG - Intronic
965854430 3:173071186-173071208 AAGTGCCAAGAACATACATTGGG + Intronic
966364727 3:179173225-179173247 AGGTGCCAAGGTAATTCAATGGG + Intronic
966707684 3:182934404-182934426 AGGTACCAAGATAATTAAGTGGG + Intergenic
967455348 3:189679881-189679903 AAGTGCCAAGAACATACAATAGG - Intronic
967618022 3:191597093-191597115 AAATGCCAAGGCAATTCAATAGG - Intergenic
967906265 3:194503046-194503068 GGGTGCCAAGACAATTCAATGGG + Intergenic
968543805 4:1185033-1185055 AAGTGCCAAGACCATTCAATGGG + Intronic
968580339 4:1387706-1387728 TGGTGCGAAGATAATTCAATGGG - Exonic
969372059 4:6738473-6738495 AAGTGTCAAGACCATTCAATGGG - Intergenic
969434193 4:7175425-7175447 AAGTGCCAAAACAATTCAATGGG - Intergenic
969553581 4:7890254-7890276 AGATGCCAAGATAATGCAATGGG + Intronic
970677728 4:18471661-18471683 AAGTGCCAAGAGTATTGATTTGG - Intergenic
971023157 4:22559069-22559091 GGGTGCCAAGACAATTCAATGGG - Intergenic
971071630 4:23100279-23100301 AAATGAAAAGATAATTCACTTGG - Intergenic
971229164 4:24784879-24784901 CAGTGCCAAGGTAATTTAATGGG - Intergenic
971285284 4:25283254-25283276 AGGTGCCAAGGCAATTCAATGGG + Intergenic
971386609 4:26146269-26146291 AAGTGCCAACATAATTTACTGGG + Intergenic
971404118 4:26305105-26305127 TAGTGTCAAAAGAATTCAGTGGG - Intronic
971868304 4:32202271-32202293 GGGTGCCAAGAGAATTGAGTAGG - Intergenic
972226065 4:37013547-37013569 AGGTACCAAGGGAATTCAGTAGG + Intergenic
972551434 4:40138668-40138690 GAGTGCCAAGAAAATTCAATGGG - Intronic
972761431 4:42109031-42109053 GAGTGCCAGGACAATTCAATGGG - Intergenic
972955514 4:44385427-44385449 AAGTGCCAACACTATTCAATGGG + Intronic
973050933 4:45595419-45595441 AATTCCCTAGATAATTCAATTGG - Intergenic
973161375 4:47020949-47020971 AAGTGCAAAGATACTGAAGTAGG - Intronic
973545412 4:51976421-51976443 AAGGGCCAAGAACATTCACTGGG + Intergenic
973708082 4:53599690-53599712 AAGAGCCAAGATAAGGCTGTGGG - Intronic
973977568 4:56278383-56278405 GAGTGCTAAGACAATTCAATGGG + Intronic
974029861 4:56766895-56766917 AACTGCCAAGACAATTCAATGGG + Intergenic
974181598 4:58390474-58390496 AGGTGCCAAGACCATTCAATAGG - Intergenic
974205111 4:58691906-58691928 CAGTGCCAAGGTAATTCAATGGG + Intergenic
974369641 4:60998969-60998991 AAGTGCCAAGAACATACACTGGG - Intergenic
974831775 4:67198426-67198448 GAGTCCCAAGATCATGCAGTGGG - Intergenic
974854459 4:67442913-67442935 AAGTGGAAAGATAAATAAGTGGG + Intergenic
975020857 4:69486348-69486370 AAGTGCCAGAAAAATTCTGTGGG + Intronic
975276735 4:72511002-72511024 AAGTGCCAAGAACATACAATGGG + Intronic
975636465 4:76454424-76454446 GAGTGCCAAGATCATTCAGTAGG - Intronic
975688419 4:76941430-76941452 AAGTGCCAAGATAATTCTATGGG - Intergenic
976727050 4:88224951-88224973 AGGTGCCAAGACCATTCAATGGG - Intronic
976800367 4:88984029-88984051 GAGTGCTGAGATAATTCAATGGG + Intronic
977086952 4:92612228-92612250 AAGTGCCAAAATAATTCAACAGG - Intronic
977203014 4:94139245-94139267 AGGTGCCAAGACAATTCAACAGG + Intergenic
977236446 4:94512999-94513021 AAGTGCCAAGACCATACACTGGG - Intronic
977398545 4:96501947-96501969 AAGTGCCAAGAATATTCACTGGG + Intergenic
977468816 4:97415775-97415797 GGGTGCCAAGAAAATTCAATGGG - Intronic
978253610 4:106665128-106665150 ATGTGGCAAGATAATTCAATGGG - Intergenic
978258958 4:106728948-106728970 GAGTGCCAAGACCATTCAATGGG + Intergenic
979420518 4:120499609-120499631 ATGTACCAAGATAATTCAATGGG - Intergenic
979488454 4:121296082-121296104 AGGTGCCAAGAAAATACAATGGG + Intergenic
979590070 4:122468402-122468424 GGGTGCCAAGACAATTCAGTGGG + Intergenic
979781470 4:124656304-124656326 AAATGCCAAAGTAATTCAATGGG + Intergenic
979887682 4:126050202-126050224 GAGTGCTGAGATAATTCAATGGG - Intergenic
980048930 4:128019383-128019405 AACAGCCAATATACTTCAGTTGG - Intronic
980151763 4:129056286-129056308 AGGTGCCAAGAACATTCACTGGG - Intronic
980632728 4:135457010-135457032 AAGGGAGAAGAAAATTCAGTTGG - Intergenic
980634762 4:135487007-135487029 AAATGCTAAGAAAATTCAATGGG - Intergenic
980821222 4:138020181-138020203 GGGTGCCAAGACAATTCAATGGG + Intergenic
981999232 4:151007166-151007188 AAGTGCCAAGGTAATTCAATGGG + Intronic
982016244 4:151156549-151156571 AAGTGCCAAGAACAGTCATTGGG + Intronic
982806361 4:159769711-159769733 AAGTGCCAAGGTAATTGTATTGG + Intergenic
982935547 4:161470359-161470381 GGGTGCCAAGACCATTCAGTGGG - Intronic
983655281 4:170076974-170076996 GGGTGCCAAGATCATTCAGTGGG - Intronic
983794317 4:171841143-171841165 AAGTGGAAAGATAACACAGTAGG - Intronic
983827268 4:172278942-172278964 GGGTGCCAAGAGTATTCAGTGGG + Intronic
984068353 4:175079118-175079140 AAGTGCCAAGAACATACACTGGG - Intergenic
984621231 4:181954976-181954998 AGGTGCTAAGGTAATTCAATGGG - Intergenic
984722159 4:182983572-182983594 AAGTGCCAAGGTAATCAAATGGG + Intergenic
984949338 4:184995130-184995152 AAGTGCCAAAAGAACTCAGAGGG + Intergenic
986760195 5:10873050-10873072 AAATGCCAAGATAATTAAAAAGG - Intergenic
987796534 5:22635220-22635242 GATTGCCAAGAAAATTCAATGGG + Intronic
988326121 5:29770182-29770204 AATTGCAAAGATAATACAGGTGG + Intergenic
989352055 5:40497896-40497918 AAGAGCCAAAGGAATTCAGTTGG - Intergenic
989390199 5:40892385-40892407 AAGTGCCAAGAATATTCAATGGG + Intergenic
989417001 5:41190867-41190889 AGGTGCCAAGATCATGCACTGGG - Intronic
989819801 5:45782714-45782736 AGCTGCCAAGATAATTTAATTGG - Intergenic
990479148 5:56190975-56190997 GAGTGCCAAGACCATTCAATAGG - Intronic
990859289 5:60308756-60308778 GGGTTCCAAGATAATTCAGATGG + Intronic
990921210 5:60969989-60970011 AAGTGCCAAGAACACACAGTGGG - Intronic
990963753 5:61422332-61422354 AAGTGCCAAGAAAATCCTTTGGG - Intronic
991018369 5:61955500-61955522 AAGTGCCAAGAACATTCACTGGG - Intergenic
991236296 5:64402563-64402585 GAGTACCAGGATAATTCTGTGGG + Intergenic
991551321 5:67839658-67839680 ATGTACCAAGGTGATTCAGTGGG - Intergenic
991559175 5:67931046-67931068 AGGTGTAAAGACAATTCAGTTGG - Intergenic
992278741 5:75150830-75150852 AATTGCAAATAAAATTCAGTTGG - Intronic
992309967 5:75487206-75487228 AAGTGCCAAGAACATACATTGGG + Intronic
992598553 5:78371424-78371446 GTGTGCCAAGATCATTCAATGGG - Intronic
992983013 5:82196654-82196676 GGGTGCCAAGATAATTAAGTGGG - Intronic
993340272 5:86717067-86717089 AATCTCCAAGATAATTCTGTGGG + Intergenic
994341770 5:98638066-98638088 AAGTTCAAATATAATTGAGTTGG + Intergenic
994457660 5:100033083-100033105 AGGTGTCAAGAAAATTCATTGGG + Intergenic
994654627 5:102575684-102575706 GGGTGCCAAGACAATTCAATGGG - Intergenic
994889364 5:105610367-105610389 AAGTGCCAAGAACATACATTGGG + Intergenic
994893180 5:105665873-105665895 AGGTGCCAAGAACATTCACTGGG - Intergenic
995284655 5:110373969-110373991 AGGTGCCAAGGAAATTCAATGGG - Intronic
995649333 5:114350721-114350743 GGGTGCCTAGATAATTCATTGGG - Intergenic
995769024 5:115650155-115650177 TTGTGCTAAGACAATTCAGTGGG + Intergenic
995788140 5:115853721-115853743 AAGTACCAAGGCAATTCAATAGG - Intronic
995974360 5:118013724-118013746 CAGTGCTAAGATACTTCAGTGGG - Intergenic
996390657 5:122957281-122957303 GAGTGCCAAGATCATTCAAATGG - Intronic
996426816 5:123321792-123321814 AGGTGCCAAGACCATTCAATGGG - Intergenic
996854881 5:127994530-127994552 ACGTGTCAAGAGAATTTAGTGGG + Intergenic
997086085 5:130801334-130801356 AAGTGCCAAGAACATACAATGGG + Intergenic
997164877 5:131649885-131649907 AAGTGCCAAGACCATTCAACAGG - Intronic
997760044 5:136436922-136436944 AAGTGCCAAGGTAATTCAATAGG - Intergenic
997971887 5:138410411-138410433 AGGTGCCAAGGTAGTTCAGTGGG + Intronic
998943690 5:147313796-147313818 GGGTGCCAAGAAAATTCAATGGG + Intronic
999566665 5:152870726-152870748 AAGTGTCAAAAGAATTCAATAGG + Intergenic
999746349 5:154595467-154595489 AGGTGCCAAGACCATTCAATGGG - Intergenic
1000566975 5:162860546-162860568 AGGTGCCGAGACAATTTAGTAGG + Intergenic
1001509228 5:172307073-172307095 AGGTGCCAAGGCAATTCAATGGG + Intergenic
1002111751 5:176919758-176919780 GAATGTCAAGACAATTCAGTGGG - Intronic
1002444673 5:179282406-179282428 AAGGTCCAAGACAAGTCAGTGGG - Intronic
1002543588 5:179923306-179923328 AGGTGCCAAGACAGTTCAGTGGG - Intronic
1003597268 6:7485388-7485410 GAGTGCCAAGATCATTCAGTGGG - Intergenic
1004268458 6:14171709-14171731 GACTGCCAAGACAATTCAATAGG + Intergenic
1004859366 6:19785783-19785805 ATACGCCAAGATAATTCAATGGG + Intergenic
1005372456 6:25149590-25149612 AAGTGTCAAGACCATTCAATGGG + Intergenic
1005596757 6:27386631-27386653 AAGTGCCAAGACCATTCAATGGG + Intronic
1005608323 6:27498261-27498283 ATGTGACAAGATAAGTCAGCAGG - Intergenic
1005907160 6:30273276-30273298 TACTGCCAAGGCAATTCAGTGGG + Intergenic
1006311122 6:33261147-33261169 AAGTGCCAAGAACATACACTGGG + Intronic
1006659508 6:35628249-35628271 GGGTGCCAAGACCATTCAGTGGG - Intronic
1007854735 6:44844122-44844144 AGGTGCCAAGATAACTCAATAGG + Intronic
1008145207 6:47883304-47883326 AAGTGCCAATATAATTTTTTAGG - Intronic
1008617540 6:53240960-53240982 AAGTACCAAGATCAGTCAGGAGG + Intergenic
1008637481 6:53425418-53425440 GGGTGCCAAGATCACTCAGTGGG + Intergenic
1009191893 6:60639150-60639172 AGGTGCCAAAATAATTCAGTGGG - Intergenic
1009245968 6:61237902-61237924 AGGTGCCAAGAAAATACACTGGG + Intergenic
1009304306 6:62068761-62068783 TAATGCCAAGATCATTCAATAGG - Intronic
1010120939 6:72375345-72375367 AAGTATCAAGATTATTTAGTAGG - Intronic
1011033611 6:82949739-82949761 AAGTGCCAAGAACATATAGTGGG + Intronic
1011176152 6:84562934-84562956 AGGTGCCAAGAATATTCACTGGG + Intergenic
1011510155 6:88091765-88091787 AAGTTAAAAGATACTTCAGTAGG - Intergenic
1012266792 6:97154711-97154733 GAGTGCCAAGACAATTTAATTGG - Intronic
1013143969 6:107369043-107369065 AAGTGCCAAGACAATTCAATGGG + Intronic
1013331282 6:109103007-109103029 AAGTAACAAGGTAATTCAATTGG - Intronic
1013859761 6:114621681-114621703 AAGTGTCAAGTTATTTCAGAAGG + Intergenic
1013875095 6:114815847-114815869 GGGTGCCAAGATCATTCAATGGG - Intergenic
1014732583 6:125051010-125051032 AAATGCTAACATAATTTAGTAGG - Intronic
1014858001 6:126426610-126426632 TGATGCCAAGATAATTCAGTGGG + Intergenic
1014956597 6:127626067-127626089 AGGGGGCAAGACAATTCAGTGGG - Intergenic
1015193253 6:130495392-130495414 AAGTGCCAAGGTAACTCAATGGG - Intergenic
1015661436 6:135579398-135579420 AAGTGTCAAGATAATTCAACAGG - Intergenic
1015816912 6:137220159-137220181 AAGTGCCATGAAAAAACAGTAGG - Intergenic
1016116712 6:140295069-140295091 AAGTGCCAAGAATATACAATAGG + Intergenic
1016179675 6:141129606-141129628 AAGTGCCAAGGTAATGAAATAGG + Intergenic
1016219077 6:141644589-141644611 GGGTGCCAAGACAACTCAGTGGG + Intergenic
1016230182 6:141794379-141794401 AAGTGCCAAGAACATGCATTGGG + Intergenic
1016251939 6:142053853-142053875 AAGTGCCAAGAACATACATTGGG + Intergenic
1016294173 6:142556353-142556375 AAGTGCCAAGAACATTCATTGGG + Intergenic
1016421444 6:143888167-143888189 TGGTGCCAAGATTATTCAATGGG - Intronic
1016421705 6:143891952-143891974 AGATGCCAAGGTAATTCACTGGG + Intronic
1016591374 6:145748149-145748171 AGGTGCAAAGATCATTCTGTGGG + Intergenic
1016697400 6:147013700-147013722 TGGTGCCAAGGTAATTCAGTTGG + Intergenic
1017583320 6:155891610-155891632 GAATGCCAAGATAATTCAATAGG + Intergenic
1018317077 6:162567991-162568013 AAGTGCCAAGAACATACACTGGG + Intronic
1018741226 6:166730548-166730570 AATTGACAAGAAAATTTAGTTGG - Intronic
1018789220 6:167133368-167133390 AGGTGCCAAGGTAACTCAATGGG - Intronic
1019141827 6:169952475-169952497 ATACACCAAGATAATTCAGTAGG + Intergenic
1019405701 7:882764-882786 AAGTGCCCCAATAATCCAGTTGG - Intronic
1019456752 7:1131946-1131968 GAGTGCCATGACAATTCAGTGGG + Intronic
1019657826 7:2206554-2206576 AAGTGTCCAGATAATTCAGTGGG - Intronic
1020586201 7:10071955-10071977 AGATGCCAAGACAATTCATTGGG + Intergenic
1020694724 7:11399271-11399293 AAATGTCAAGATAATTTAGAAGG - Intronic
1020865019 7:13549248-13549270 AAGTGCCAAGAACATACATTGGG + Intergenic
1021281182 7:18719907-18719929 AGGTGCCAAGACAATTCAGCAGG - Intronic
1022149577 7:27587517-27587539 AAGTGACAAGAAATTTCATTAGG + Intronic
1022758246 7:33318239-33318261 AAGAGCAAAGAAAATTCAGAGGG - Intronic
1023288047 7:38639505-38639527 AAGTGCCAAGATCATTCAATGGG + Intergenic
1023417228 7:39944960-39944982 AGGTGCCAAGACAATACAATGGG - Intergenic
1023893394 7:44411019-44411041 GAGTACCAAGACAATTCAATGGG + Intronic
1024028953 7:45440010-45440032 AAGTGCCAAGAACATACACTGGG + Intergenic
1024145036 7:46505951-46505973 AGGTGCCAAGATCATACATTGGG + Intergenic
1024171152 7:46788417-46788439 GAGTGCCAAGATAATTCAATAGG - Intergenic
1024216171 7:47250521-47250543 AAATGCCAAGACAATCCAATAGG + Intergenic
1024372227 7:48598952-48598974 AGGTGCTATGACAATTCAGTGGG - Intronic
1024513647 7:50223705-50223727 CAGTGCCAACATTATTCATTTGG + Intergenic
1026020740 7:66703564-66703586 AGGTGTCAAGATCATTCAATGGG - Intronic
1026066442 7:67077933-67077955 AGGTGCCAAGGTCATGCAGTGGG - Intronic
1026410882 7:70121073-70121095 GAGTGCCAAGACACTTCAATGGG + Intronic
1026464832 7:70645061-70645083 TATTACCAAGATAATTGAGTTGG + Intronic
1026586894 7:71662967-71662989 GGGTGTCAAGACAATTCAGTGGG - Intronic
1026710483 7:72734406-72734428 AGGTGCCAAGGTCATGCAGTGGG + Intronic
1027307407 7:76914699-76914721 AAGTGGAAAGTTAAATCAGTTGG - Intergenic
1027511199 7:79082486-79082508 GAATGCCAAGATAATTCAATGGG - Intronic
1027820647 7:83039474-83039496 GAGTGCCAAGAATATTCAGTAGG - Intronic
1027887395 7:83926808-83926830 CAGTGCCAAGAAAATTCAATGGG - Intergenic
1028264295 7:88704090-88704112 AAGTGCCAAGAACATACACTGGG - Intergenic
1028627202 7:92890297-92890319 AAGTGCCAAGAACATACATTGGG + Intergenic
1028815428 7:95138248-95138270 AAGTACCATGATAATTCCATTGG + Intronic
1029245696 7:99199472-99199494 AGGTACCAAGACAATTCAATGGG + Intronic
1029340292 7:99937430-99937452 GAGTGTCAAGACAATTCAGTCGG - Intergenic
1029950702 7:104581748-104581770 ACATGCCAAAATAATTCAATGGG - Intronic
1030015414 7:105215063-105215085 GATTGCCAAGACAATTCAATTGG + Intronic
1030414536 7:109225695-109225717 AGATGCCAAGAAAATTCAATGGG - Intergenic
1030506444 7:110430074-110430096 CAGTTCCAAGGTAATTCAATGGG + Intergenic
1030963757 7:115962566-115962588 AGGTGCCAAGACCACTCAGTGGG + Intronic
1031091082 7:117355447-117355469 GGGTGCCAAGACAATTCAATGGG + Intergenic
1031243629 7:119277880-119277902 AAGTGCCAAGAACATACACTGGG - Intergenic
1031269395 7:119627401-119627423 ATGTGCCAAGACAATTCCCTGGG - Intergenic
1031462977 7:122074741-122074763 TAGTGCTAAGACAATTCAATGGG - Intergenic
1031862800 7:127001140-127001162 AAGTGCCAAGATAATTTAATAGG + Intronic
1032142325 7:129343563-129343585 AGAAGCCAAGATAATTCTGTGGG + Intronic
1032276250 7:130458300-130458322 GGGTGCCAAGACAATTCACTAGG - Intergenic
1032348152 7:131135978-131136000 AAGTGACAAGGGAATTCAGGTGG + Intronic
1032363870 7:131281303-131281325 GAGTGCCAAGACAATTCGATAGG - Intronic
1033269259 7:139916009-139916031 AAGTGCCAAGAAGATTGATTTGG - Intronic
1033296635 7:140144233-140144255 GAGTGCCAAGATCATTCAAAGGG + Intronic
1033495141 7:141886597-141886619 ATATGCCAAGAAAATTGAGTTGG - Intergenic
1033521430 7:142164966-142164988 AGGTGGCAACATTATTCAGTAGG - Intronic
1033820763 7:145131583-145131605 ACTTGCTAAGAGAATTCAGTAGG - Intergenic
1034580454 7:152037327-152037349 AAGTGCCAAGAACATACATTGGG - Intronic
1035144903 7:156805097-156805119 AGGTGCCAAGGGAATTTAGTGGG - Intronic
1035150360 7:156865804-156865826 GAGTATCAAGATAATTCAGTTGG + Intronic
1035549905 8:514331-514353 GAGTGCCAAGACAATTCAATGGG + Intronic
1036554453 8:9846373-9846395 GAGTGCCAAGACAATTCAGTGGG + Intergenic
1036729769 8:11252153-11252175 GGGTGCCAAGACCATTCAGTGGG + Intergenic
1036734682 8:11301379-11301401 AAGTACCAATACAATTCAATTGG + Intronic
1037353767 8:17995294-17995316 AGGTGCCAAGAACATACAGTGGG - Intronic
1037848044 8:22301877-22301899 AGGTGTCAAGGTAAATCAGTAGG - Intronic
1037954747 8:23046831-23046853 AAGTGCCAAGAATACACAGTGGG + Intronic
1038180434 8:25222350-25222372 AAATGGAAATATAATTCAGTGGG + Intronic
1038815081 8:30894585-30894607 GGGTGCCAAGACCATTCAGTGGG + Intergenic
1039163730 8:34652272-34652294 AGGTGCCAAGATTATTGAATGGG + Intergenic
1039651438 8:39343742-39343764 AATTGCCAAGACAATTAAGTGGG - Intergenic
1039771423 8:40691556-40691578 AAGTGCCAGGAGAATTAATTTGG + Intronic
1040643864 8:49375443-49375465 GGATGCCAAGATAATTCAATGGG + Intergenic
1040958874 8:53009726-53009748 AGGCGCCAAGACAATTCAATGGG - Intergenic
1041033941 8:53767691-53767713 GGATGCCAAGATAATTCAATAGG + Intronic
1041357833 8:57020553-57020575 AATTGCCAAAATAATTTAATGGG + Intergenic
1041553697 8:59129057-59129079 AGATGCCAAGGTAATTCAGTGGG + Intergenic
1042092136 8:65170021-65170043 AAGAGCAAAGATATTTCAGTAGG + Intergenic
1042376631 8:68059744-68059766 CAGTGCCAAGCTTATTCAGGTGG + Intronic
1042726418 8:71882894-71882916 AAGTGCCAAGAACATACACTGGG - Intronic
1042733216 8:71960273-71960295 AAGTGCAAAGATCATTCGTTTGG + Intronic
1042853634 8:73241851-73241873 AAGTGCCAAGAATATACACTAGG + Intronic
1042901079 8:73728206-73728228 ACATGCCAGGATGATTCAGTGGG - Intronic
1043228794 8:77771553-77771575 AAGTGCCAAGAACATACATTAGG + Intergenic
1043539808 8:81248058-81248080 AGATGCCAAGACCATTCAGTGGG + Intergenic
1043751288 8:83938832-83938854 GGATGCCAAGATAATTCAATGGG - Intergenic
1043762716 8:84088991-84089013 AGGTGCCAAGAACATTCATTTGG - Intergenic
1043875697 8:85483933-85483955 AGGTACCAAAACAATTCAGTGGG - Intergenic
1043916741 8:85931253-85931275 GAGTGCCAAGACCATTCAATGGG + Intergenic
1043953378 8:86334947-86334969 AAGTTCCAAAGTAATTCAATGGG + Intergenic
1044352502 8:91183636-91183658 AAGTGCAAAGAGAATGTAGTGGG + Intronic
1044594535 8:93945644-93945666 GGGTGCCAAGACAATTCAGTTGG + Intergenic
1044850942 8:96426979-96427001 AAGTGCCAAGAATATACATTGGG - Intergenic
1044901773 8:96953861-96953883 AACTGACAAGATAATTCAGTGGG - Intronic
1045102110 8:98855389-98855411 AAGAACCAAGATCATTCAATGGG + Intronic
1045122644 8:99054841-99054863 GAGTGACAAGACCATTCAGTGGG - Intronic
1045509369 8:102802521-102802543 AAGTGCCAAGAACATACATTGGG + Intergenic
1045715752 8:105042666-105042688 AAGTGACAAGTTATTTCAATAGG + Intronic
1045980135 8:108175593-108175615 AAATGCCAAGAGAAATGAGTTGG + Intergenic
1046000545 8:108415973-108415995 AAGTGCCAAGAAAATTGAATGGG + Intronic
1046120048 8:109834543-109834565 ACATGCCAAGGTAATTCAATAGG + Intergenic
1046120819 8:109844087-109844109 AGGTGCCACTACAATTCAGTAGG - Intergenic
1047562396 8:126001800-126001822 AAGTGCCAAAGGAATTCAATGGG + Intergenic
1047676008 8:127202975-127202997 AGGTGCCAAGGCAATTGAGTAGG + Intergenic
1048490602 8:134889165-134889187 ATGTGCCATGATAATTCAATGGG - Intergenic
1049049015 8:140177405-140177427 ATGTGCCAAGGTAATTCAAAGGG - Intronic
1049158695 8:141083517-141083539 GGGTGTCAAGACAATTCAGTTGG - Intergenic
1049926448 9:413135-413157 GAGTGCCAAAACAATTCAATGGG + Intronic
1050368343 9:4894594-4894616 AAGAGCCAAGACAATTGAGGAGG - Intergenic
1050458585 9:5857452-5857474 AAGTGCCATGAAAATTGATTTGG + Intergenic
1050698247 9:8303846-8303868 AGGTGCCAAGACCATTCAGTGGG - Intergenic
1050748786 9:8911319-8911341 AAGTGCCAAGGCAATTCAGTTGG + Intronic
1051280320 9:15436431-15436453 AAGGGCCAAGATCATTCACTAGG - Intronic
1051454670 9:17241321-17241343 AAGTGCCAAGAAAATACCTTTGG - Intronic
1051966901 9:22839228-22839250 AGGTGCAAAGGTAATTCAGTGGG - Intergenic
1052004788 9:23333659-23333681 GGGTGCCAAGACAATTCAATAGG + Intergenic
1052063174 9:23986034-23986056 AAGTGCCAAGAACATACAATGGG - Intergenic
1052897795 9:33764116-33764138 AGATGCCAAGACAATTCAATAGG + Intronic
1053398104 9:37793456-37793478 AGGTGCCAAGACAATTCAATGGG + Intronic
1053689704 9:40578285-40578307 AAGTGCCAAGAAAAAGCATTTGG - Intergenic
1054300951 9:63379224-63379246 AAGTGCCAAGAAAAAGCATTTGG - Intergenic
1054356120 9:64065243-64065265 GGGTGCCAAGATTATTCAGTGGG + Intergenic
1054711866 9:68518811-68518833 AAGTGCTAACATAATTTAGTTGG + Intronic
1055153426 9:73031398-73031420 GAATGCCAAGATTATTCAATGGG - Intronic
1055203984 9:73704663-73704685 AAGTACCAAGACAATTCAATGGG + Intergenic
1055254404 9:74350305-74350327 AAATGCCAGGATAGTTCAATGGG - Intergenic
1055555952 9:77473886-77473908 AGGTGCCAAGCTAATTCAATGGG + Intronic
1055844897 9:80549722-80549744 AAGAACCAAGATAAATGAGTAGG - Intergenic
1056378792 9:86038661-86038683 AGGTGCCAAGACAATTCAGTGGG + Intronic
1056394686 9:86170912-86170934 GAGTACCAAGACAATTCAATCGG - Intergenic
1056432184 9:86538916-86538938 AAGTGTCAAGACCATTCAGTGGG + Intergenic
1056510814 9:87303590-87303612 GAGTGCCAAGACAATTTAATGGG + Intergenic
1056564757 9:87761306-87761328 AAGTGCCAAGAACATACAATAGG - Intergenic
1056871442 9:90284727-90284749 TCGTGCCAAGAAAATTCAATGGG + Intergenic
1057121119 9:92574939-92574961 ATGTGCCAAGACCATTCAATGGG + Intronic
1057344468 9:94236462-94236484 AAGTGCTAAGGCAATCCAGTAGG + Intergenic
1057446599 9:95120276-95120298 AGATGCCAAGACAATTCAATGGG - Intronic
1057456136 9:95213530-95213552 GGGTGCCAAGATCATTCAATGGG + Intronic
1057703439 9:97380632-97380654 AGGTGCCAAGACAATTTAATGGG - Intergenic
1057756505 9:97842398-97842420 CAGTGCCAAGGTAATTCAATGGG + Intergenic
1057926583 9:99157207-99157229 ATGTGCAAAGATAATTCAACAGG + Intergenic
1058086139 9:100750229-100750251 AGGTGCCAAGATCATACATTAGG - Intergenic
1058304211 9:103416754-103416776 GAGTGCCAAGACAATTCAATGGG - Intergenic
1058992161 9:110264813-110264835 AAGGTACAAGATCATTCAGTGGG + Intergenic
1059163157 9:112054262-112054284 GAGTGCCAAGACCATTCAATAGG + Intronic
1059370902 9:113834042-113834064 GAGAGCCAAGAAAATTCAATGGG + Intergenic
1059667189 9:116459130-116459152 GGGTGCCAAGAAAATACAGTGGG + Intronic
1059795468 9:117691056-117691078 GGGTGCCAATATCATTCAGTAGG + Intergenic
1059947484 9:119426027-119426049 AGGTGCCAGGACAATTCAGTAGG - Intergenic
1060447118 9:123700023-123700045 AGGTGCCAAGGTAATTCAAAGGG - Intronic
1060546179 9:124461545-124461567 AGGTGACAAGAAAATTCAATGGG - Intronic
1061011519 9:127958061-127958083 CAGTGCCAAAATAATTCAGTGGG + Intronic
1062307487 9:135917363-135917385 GGGTGCCAAGACCATTCAGTGGG + Intergenic
1203744251 Un_GL000218v1:32180-32202 GAGTGCCAAGATTATTCAGTGGG + Intergenic
1203565858 Un_KI270744v1:87334-87356 GAGTGCCAAGATTATTCAGTGGG - Intergenic
1186776984 X:12874642-12874664 AAGGTTCAGGATAATTCAGTTGG + Intronic
1186839473 X:13470613-13470635 AATTGCCAAGATGACTCAGAGGG + Intergenic
1187228813 X:17401114-17401136 GGGTGCCAAGACAATTCAATGGG + Intronic
1187362176 X:18638914-18638936 GGGTGCCAAGATCATTCAATGGG + Intronic
1187421896 X:19142414-19142436 GAGTGCCAAAACAATTCAATAGG + Intergenic
1187777526 X:22779010-22779032 GGGTACCAAGAAAATTCAGTGGG - Intergenic
1187908451 X:24088710-24088732 AGATGCCAAGATAATCCAGTGGG - Intergenic
1188020261 X:25149502-25149524 AAGTGCCAAGAACATACATTGGG - Intergenic
1188118428 X:26274966-26274988 AAGTGCCAAGAACATACATTGGG - Intergenic
1188180868 X:27053976-27053998 TAGTACCAAGATAATTCAACAGG - Intergenic
1188285208 X:28318351-28318373 AGGTGCCAAAAACATTCAGTGGG + Intergenic
1188563850 X:31501997-31502019 AGGTGCCAAGAACATACAGTGGG + Intronic
1188766010 X:34091735-34091757 GGATGCCAAGATGATTCAGTCGG + Intergenic
1188794939 X:34451776-34451798 ATATGCCAAGATAATTCAATGGG + Intergenic
1189647664 X:43151475-43151497 AAGTGCCAAGATAATGGAAAAGG + Intergenic
1189750550 X:44216590-44216612 AGGTGCCAAGATCATACACTGGG + Intronic
1189862264 X:45285634-45285656 GGGTGCCAAGACAATTCAATTGG - Intergenic
1190135458 X:47792427-47792449 ATGTGCTAAGATTAATCAGTGGG - Intergenic
1190145416 X:47887089-47887111 AAGTGCCAATGTGATTCAATGGG - Intronic
1190534789 X:51415230-51415252 AAGTACAAAGACAATTCAGTGGG - Intergenic
1190538290 X:51450668-51450690 AGGGGCCAAGATAATTTTGTGGG - Intergenic
1190631422 X:52390698-52390720 GGGTGCCAAGATAATTCAGTGGG + Intergenic
1190635491 X:52428882-52428904 AGGTGCCAAGATAATTTAGTGGG - Intergenic
1190639468 X:52468868-52468890 AGGTCCCAAGATAATTTAGTGGG - Intergenic
1190640505 X:52479435-52479457 AAGTGCCAAGAGAATTCAGTGGG - Intergenic
1190647167 X:52533430-52533452 AAGTGCCAAGAGAATTCAGTGGG + Intergenic
1190649299 X:52553610-52553632 AAGTGCCAAGATAATTCAGTGGG + Intergenic
1190824740 X:54007138-54007160 AGGTGTCAAGACAATTCAATGGG + Intronic
1190835783 X:54099732-54099754 GGGTGCCAAGATAATTCAATGGG - Intronic
1190841278 X:54146859-54146881 AAGTGCAAAGGTAATTCAATGGG + Intronic
1190860068 X:54336362-54336384 GGTTGCCAAGAAAATTCAGTGGG + Intronic
1190934796 X:54988713-54988735 GGGTGCCAAGACAATTAAGTAGG + Intronic
1190994283 X:55590897-55590919 GAGTGTCAAGATCATTAAGTGGG + Intergenic
1191896106 X:65995054-65995076 AAGTCACAACATAATTGAGTAGG + Intergenic
1192241547 X:69333812-69333834 GAGTGTCAAGACAATTCAGTGGG - Intergenic
1192281309 X:69689015-69689037 GAGTGCCGAGAGAATTCAATAGG - Intronic
1192302275 X:69917407-69917429 AAATGGCAACATAACTCAGTGGG - Intronic
1192622370 X:72691173-72691195 AGGTGCCAAGATAATTCAATGGG - Intronic
1193057658 X:77171270-77171292 AAGTGCCAAGAACATTCATTGGG + Intergenic
1193126425 X:77875339-77875361 AAGGGCCAAGTTAGTGCAGTAGG - Intronic
1193378255 X:80787499-80787521 ATGTGCCACGATAATCCAATGGG + Intronic
1193503664 X:82311320-82311342 GAGTGTCAAGAAAATTCAATGGG - Intergenic
1193761324 X:85469983-85470005 AGGTGCCAAGAAAATACACTGGG - Intergenic
1193875041 X:86852058-86852080 GGGTGCCAAAATCATTCAGTGGG - Intergenic
1193903162 X:87208798-87208820 GAGTTCCAAGATCATTCAGTAGG + Intergenic
1193982042 X:88193406-88193428 AGGTGCCAAGAAAATACACTCGG + Intergenic
1194110727 X:89830766-89830788 AAGTGCCAAGAACATACAATAGG + Intergenic
1194348801 X:92799500-92799522 AAGTGCCAAGAATATACACTGGG + Intergenic
1194495228 X:94608182-94608204 AAGTGCCAAGAACATACACTGGG - Intergenic
1194980114 X:100431829-100431851 AATTGTCAAGGTCATTCAGTTGG - Intergenic
1195073101 X:101300312-101300334 AGGTGCCAAGAACATTCATTGGG - Intergenic
1195116227 X:101701332-101701354 AAGTGCCAAGAACATACACTGGG + Intergenic
1195377262 X:104239929-104239951 AAGTTCCAAGATAAATGTGTAGG - Intergenic
1195580742 X:106498577-106498599 GAGTGCCAGGACAATTCAATGGG - Intergenic
1195601915 X:106758657-106758679 AAGTGCCAAGAACATACATTGGG + Intronic
1195840661 X:109172466-109172488 AATTGGCAAGATAATGCTGTTGG - Intergenic
1195972230 X:110485692-110485714 AAGTGCCAGGATCATTCAATGGG - Intergenic
1196067436 X:111480125-111480147 GAGTGCCAAGACAATTCAATGGG - Intergenic
1196121208 X:112052877-112052899 GAGTGCCAAGACCATTCAATGGG - Intronic
1196281359 X:113826866-113826888 AGGTGCCAAGAAAATTCAATGGG + Intergenic
1196297023 X:114009819-114009841 AGTTGCCAAGACCATTCAGTTGG - Intergenic
1196310674 X:114161957-114161979 AAGTGCCAAGAACATACACTGGG - Intergenic
1196822989 X:119718237-119718259 AAGTATCAAGACAATTCAATGGG + Intergenic
1197091229 X:122539928-122539950 AACTGCCAATATAATTCACTGGG + Intergenic
1197179997 X:123524271-123524293 GAGTACCAAGATCATTCAATGGG - Intergenic
1197403634 X:126025068-126025090 GAGTGCTAAGACAATTCAGTGGG - Intergenic
1197559237 X:127997488-127997510 AAGTGCCAAGAACATACACTGGG + Intergenic
1197626064 X:128803855-128803877 AAGGGCCAAGAAAATTCAAGTGG - Intergenic
1198134541 X:133735334-133735356 TAGTGCCAAGACAATTCATGGGG + Intronic
1198180511 X:134203491-134203513 GAGTGCCAAGACAATTCAAAAGG + Intergenic
1198195912 X:134361770-134361792 GGGTGCCAAGACAATTCAGCAGG + Intergenic
1198315158 X:135458086-135458108 GAGTGCCAAGATAATTCAATAGG - Intergenic
1198591271 X:138185399-138185421 GAGTACCAAGGTAATCCAGTGGG + Intergenic
1199016595 X:142823220-142823242 GAGTGCCAAGAGCATTCAATAGG - Intergenic
1199141282 X:144316538-144316560 AAATGCCAAGATAATTTAATGGG + Intergenic
1199159690 X:144594133-144594155 AGGTGCCAAGAACATTCACTGGG - Intergenic
1199164260 X:144651369-144651391 AACTGTCAAGCAAATTCAGTAGG + Intergenic
1199588710 X:149444636-149444658 AACTACTAAGACAATTCAGTAGG + Intergenic
1199722879 X:150555280-150555302 AGGTGCCAAGACAATTCAATGGG + Intergenic
1199723634 X:150561299-150561321 AGGTGCCAAGACCATTCAATGGG - Intergenic
1199859084 X:151783557-151783579 ATGGGCCATGATAATTCAGTCGG + Intergenic
1199923548 X:152436607-152436629 GGGTGCCAAGGTAATTCAATGGG + Intronic
1200288902 X:154852470-154852492 AAGTGCCAAGACCATTTTGTGGG - Intronic
1200328819 X:155272624-155272646 AAGTGCCAAGAACATGCATTGGG - Intergenic
1200333978 X:155328850-155328872 AGGTGCCAAGATCATACACTGGG + Intronic
1200369602 X:155709926-155709948 AAGTGCCAAGAACATACATTGGG - Intergenic
1200657130 Y:5916121-5916143 AAGTGCCAAGAATATACACTGGG + Intergenic
1201157576 Y:11147161-11147183 GGGTGCCAAGATTATTCAGTGGG + Intergenic
1202097452 Y:21266608-21266630 AAGTGCATGGATATTTCAGTGGG - Intergenic
1202581045 Y:26381004-26381026 AGGTGCCAAGACCATTCACTGGG - Intergenic