ID: 1190649934

View in Genome Browser
Species Human (GRCh38)
Location X:52559114-52559136
Sequence CACACTGCTTAGAGAGGGCA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 388
Summary {0: 1, 1: 0, 2: 0, 3: 26, 4: 361}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1190649934_1190649940 -8 Left 1190649934 X:52559114-52559136 CCTTGCCCTCTCTAAGCAGTGTG 0: 1
1: 0
2: 0
3: 26
4: 361
Right 1190649940 X:52559129-52559151 GCAGTGTGGATTTTGAGAAGGGG 0: 1
1: 1
2: 4
3: 29
4: 326
1190649934_1190649938 -10 Left 1190649934 X:52559114-52559136 CCTTGCCCTCTCTAAGCAGTGTG 0: 1
1: 0
2: 0
3: 26
4: 361
Right 1190649938 X:52559127-52559149 AAGCAGTGTGGATTTTGAGAAGG 0: 1
1: 1
2: 1
3: 36
4: 299
1190649934_1190649939 -9 Left 1190649934 X:52559114-52559136 CCTTGCCCTCTCTAAGCAGTGTG 0: 1
1: 0
2: 0
3: 26
4: 361
Right 1190649939 X:52559128-52559150 AGCAGTGTGGATTTTGAGAAGGG 0: 1
1: 0
2: 1
3: 37
4: 284
1190649934_1190649943 26 Left 1190649934 X:52559114-52559136 CCTTGCCCTCTCTAAGCAGTGTG 0: 1
1: 0
2: 0
3: 26
4: 361
Right 1190649943 X:52559163-52559185 GAATTATCTTTTATGGTGTGAGG 0: 1
1: 0
2: 2
3: 19
4: 286
1190649934_1190649942 19 Left 1190649934 X:52559114-52559136 CCTTGCCCTCTCTAAGCAGTGTG 0: 1
1: 0
2: 0
3: 26
4: 361
Right 1190649942 X:52559156-52559178 TACTGCAGAATTATCTTTTATGG 0: 1
1: 0
2: 2
3: 18
4: 271

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1190649934 Original CRISPR CACACTGCTTAGAGAGGGCA AGG (reversed) Intergenic
900643100 1:3696654-3696676 CCCACGGTTTGGAGAGGGCAGGG + Intronic
902817194 1:18923035-18923057 CACACGGCTCAGAGCGGGGAAGG + Intronic
902980421 1:20118702-20118724 CATACTGCTAAGAGATGGCGGGG + Intronic
903772481 1:25772646-25772668 CACACAGCATTCAGAGGGCAGGG - Intronic
904634559 1:31869800-31869822 CCCAGTGCTTTGGGAGGGCAAGG + Intergenic
905362065 1:37427882-37427904 CCCAGTGCTTCGGGAGGGCAAGG + Intergenic
905662133 1:39735779-39735801 CAGCATGCCTAGAGAGGGCATGG - Intronic
906274508 1:44506205-44506227 CACAGTGGTCAGAGAGGGCTGGG + Intronic
906386683 1:45375645-45375667 CCCAGTGCTTTGAGAGGCCAAGG + Intronic
906393925 1:45443926-45443948 CTCAATGCTTTGAGAGGCCAAGG + Intronic
907644646 1:56230158-56230180 CACACAGCTAGGAGACGGCAAGG + Intergenic
908355345 1:63322163-63322185 CACACTCCTTAGACAGGGACTGG - Intergenic
908368573 1:63455558-63455580 CACAGTGCTTTGGGAGGCCAAGG - Intronic
908974127 1:69877335-69877357 CCCATTGCTTTGAGAGGCCAAGG + Intronic
909428329 1:75554224-75554246 CCCAGTGCTTTGAGAGGCCAAGG + Intronic
909559814 1:76997746-76997768 CTCAATGCTTTGAGAGGCCAAGG + Intronic
910248431 1:85167861-85167883 CACAGTACTTTGAGAGGCCAAGG + Intronic
910946880 1:92602655-92602677 CCCAGTGCTTTGAGAGGCCAAGG - Intronic
912588233 1:110786910-110786932 CAAACTGATTAGAGAGGGAGTGG + Intergenic
912881952 1:113424157-113424179 CACACTCCTTGGAGCTGGCAGGG - Intronic
913203552 1:116515622-116515644 GAGACTGCTGGGAGAGGGCAGGG - Intronic
915195738 1:154188304-154188326 CACTTTGCTTTGAGAGGCCAGGG - Intronic
916174378 1:162025307-162025329 CCCAGTGCTTTGGGAGGGCAAGG - Intergenic
916181077 1:162084376-162084398 CACCCTGGTTGGAAAGGGCAGGG + Intronic
917168671 1:172144542-172144564 CACATTGGTTAGACTGGGCAAGG - Intronic
917828304 1:178848056-178848078 CCCAGTGCTTAGGGAGGCCAAGG + Intronic
919633551 1:199982378-199982400 CCCAGTGCTTTGAGAGGCCAAGG - Intergenic
919853507 1:201689983-201690005 CACACTGCATGGACAGGCCACGG - Intronic
919853552 1:201690309-201690331 CACACTGCATGGACAGGCCACGG - Intronic
919918568 1:202154188-202154210 CACTCAGCTCCGAGAGGGCAAGG - Exonic
920360720 1:205414330-205414352 CCCAGTGCTTTGAGAGGCCAAGG + Intronic
920664951 1:207956488-207956510 CCCAATGCTTAGAGTGGCCAGGG + Intergenic
923108691 1:230873785-230873807 CCCAGTGCTTTGAGAGGCCAAGG + Intergenic
924430693 1:243994150-243994172 CCCACTGCTTTGGGAGGCCAAGG + Intergenic
1064612889 10:17122138-17122160 CACTCTGCTTAAAAAGGGAAGGG + Intronic
1064991167 10:21258316-21258338 CCCACTACTTGGAGAGGCCAAGG + Intergenic
1065405840 10:25363442-25363464 CACACTGGGTAGTGAGGCCATGG - Intronic
1065498224 10:26351613-26351635 CACAGTGCTTTGGGAGGCCAAGG - Intergenic
1072111061 10:92320305-92320327 CACAGTGCTTTGGGAGGCCAAGG - Intronic
1073014455 10:100386834-100386856 CACACTGTATAGAGGTGGCAAGG - Intergenic
1074077539 10:110142547-110142569 CACACTGCAGAGACAGGGAAGGG + Intergenic
1074478322 10:113793794-113793816 AACAATGCTTACAGAGGGCTTGG - Intergenic
1074676943 10:115861851-115861873 CTCAGTGCTTTGAGAGGCCAAGG + Intronic
1075234125 10:120711106-120711128 CACACCGCTTTGGGAGGCCAAGG - Intergenic
1076485249 10:130811509-130811531 CACACTTCTAGGTGAGGGCATGG - Intergenic
1077219020 11:1407220-1407242 CACCAAGCTCAGAGAGGGCAGGG - Intronic
1078891228 11:15560609-15560631 CACACTGCTAACATGGGGCAAGG + Intergenic
1080014482 11:27490150-27490172 CCCACTACTTTGAGAGGCCAAGG - Intergenic
1080925873 11:36755352-36755374 CACACTGCTTAGGGAAGGAGTGG + Intergenic
1081452989 11:43191191-43191213 CCCACTGATAAGAGAGAGCATGG + Intergenic
1081460250 11:43266253-43266275 CTCACCACTTAGAGAGGCCATGG + Intergenic
1081677089 11:44976618-44976640 CACACAGCTTATACATGGCAGGG + Intergenic
1082047526 11:47742226-47742248 CCCACTGCTTTGGGAGGCCAAGG + Intronic
1085195085 11:74665648-74665670 CCCAGTGCTTTGAGAGGCCAAGG - Intronic
1086323739 11:85677213-85677235 CCCAGTGCTTTGAGAGGCCAAGG - Intronic
1086930887 11:92691629-92691651 CCCAATGCTTTGAGAGGCCAAGG - Intronic
1088627125 11:111737453-111737475 CACAGTGCCTGGAGAGGACATGG - Exonic
1088675276 11:112186739-112186761 CACAGTGCTTTGGGAGGCCAAGG + Intronic
1089330891 11:117688311-117688333 CCCACTGCTTGGAGATGGGAGGG - Intronic
1089465908 11:118686433-118686455 CCCAGTGCTTCGAGAGGCCAAGG - Intergenic
1089539369 11:119180788-119180810 CCCACTGCTTTGGGAGGCCAAGG + Intronic
1089994550 11:122893296-122893318 CACACTCCTCAGAGCAGGCATGG + Intronic
1090213415 11:124939241-124939263 CAGAGTGCTCAGAGAAGGCAGGG - Intergenic
1090845273 11:130524996-130525018 CTCACTGCCCAGAGAGGACACGG + Intergenic
1091047301 11:132336089-132336111 CACACTGTTTAGAAATGGAAAGG + Intronic
1091215811 11:133900853-133900875 CAGACCGCTCATAGAGGGCATGG - Intergenic
1091515135 12:1172217-1172239 CCCAATGCTTTGAGAGGCCAAGG + Intronic
1092098708 12:5865113-5865135 GTCACTGCTAAGAGAAGGCAGGG - Intronic
1092410179 12:8246765-8246787 CCCACTGCTTTGGGAGGCCAAGG + Intergenic
1093400112 12:18735488-18735510 CCCAATGCTTTGAGAGGCCAAGG - Intronic
1094484849 12:30916555-30916577 AACTCTGCCTAGAGAGGCCAGGG + Intergenic
1095211027 12:39494924-39494946 CCCAATGCTTTGAGAGGCCAAGG - Intergenic
1096890529 12:54766300-54766322 CCCAGTGCTTTGAGAGGCCAAGG - Intergenic
1098354145 12:69594604-69594626 CCCAGTGCTTTGAGAGGCCAAGG + Intronic
1099972259 12:89512506-89512528 CCCAGTGCTTCGAGAGGCCAAGG + Intronic
1102685724 12:114723045-114723067 CCCAGTGCTTTGAGAGGCCAAGG - Intergenic
1103543872 12:121685806-121685828 CCCAGTGCTTTGAGAGGCCAAGG + Intergenic
1103718179 12:122958586-122958608 CCCAGTGCTTTGAGAGGCCAAGG + Intronic
1103937508 12:124484388-124484410 CAGTGTGCCTAGAGAGGGCATGG + Intronic
1104140974 12:125985128-125985150 CACACTGGATAGAGGTGGCATGG - Intergenic
1104713272 12:131000113-131000135 AACACTGCTCAGTGACGGCAGGG - Intronic
1105296066 13:19088916-19088938 CACACTGCTCTGAGGGGGCAAGG - Intergenic
1105431864 13:20344196-20344218 TACAGTGCTTAAAGATGGCACGG - Intergenic
1105614676 13:22001015-22001037 CACACTGCTGTGAGATGGCAGGG + Intergenic
1106185426 13:27405461-27405483 CACTCTGCTTAGAGAGTGCTCGG - Intergenic
1107312364 13:39092991-39093013 CAGGATGCTTGGAGAGGGCAGGG + Intergenic
1107706937 13:43117255-43117277 CAAAGTGCTTTGAGAGGGGAGGG + Intergenic
1109345576 13:61111855-61111877 CACACAGCTTACAGATGCCAAGG + Intergenic
1109442176 13:62389422-62389444 TACACTGCTTTGACAGGGAATGG + Intergenic
1112008684 13:95276161-95276183 CTCACTGCTTTGAGGGGCCAAGG + Intronic
1112268129 13:97944442-97944464 AACACTGCTTAGAGAGAGGTAGG + Intergenic
1118394266 14:65322382-65322404 CCCAGTGCTTTGAGAGGCCAAGG + Intergenic
1119284644 14:73443110-73443132 CACAGTGCTTTGGGAGGCCAAGG - Intronic
1119644889 14:76341073-76341095 CACACAGATTAGAGGGGGCTTGG - Intronic
1119892279 14:78191864-78191886 CACACAGCTCAAAGAGGGGAAGG - Intergenic
1121667386 14:95683791-95683813 CAGACAGCCTAGACAGGGCATGG - Intergenic
1122505666 14:102230293-102230315 CCCAGTGCTTAGGGAGGCCAGGG - Intronic
1122684663 14:103495978-103496000 CACTCTGCTTGGAGAGCACATGG + Intronic
1124147683 15:27143328-27143350 CCCAGTGCTTAGAGAGGCTAAGG - Intronic
1125049656 15:35282427-35282449 CCCAGTGCTTTGAGAGGCCAAGG - Intronic
1125418662 15:39479709-39479731 CAAAGTGCTTAGAGAGTGGAAGG - Intergenic
1125633651 15:41168985-41169007 CACACTCCTAAAATAGGGCAAGG - Intergenic
1125755841 15:42064306-42064328 CCCAGTGCTTTGAGAGGCCAAGG - Intergenic
1127070055 15:55280224-55280246 AACAATGCATAGAGAGGACAGGG + Intronic
1128175868 15:65555157-65555179 CACACTGCTAATAAATGGCAGGG - Intronic
1128326337 15:66726348-66726370 CAGACTGCACAGAGAGGCCAAGG + Intronic
1128769581 15:70271856-70271878 CCCACTTCTTAGAGAAAGCAGGG + Intergenic
1129131342 15:73500068-73500090 CACTTTGCTTAGAGAGGTCATGG - Intronic
1129924493 15:79350782-79350804 GACACTGCTGAGGGAGAGCATGG + Intronic
1130028679 15:80292942-80292964 CACACTGCTGAGGGAGACCAGGG - Intergenic
1130109115 15:80950266-80950288 CACACAGCTAAGGGAGGGCCTGG + Exonic
1131625632 15:94117138-94117160 CCCAGTGCTTTGAGAGGCCAAGG - Intergenic
1132063165 15:98709382-98709404 AACATTGATTAGTGAGGGCAGGG + Intronic
1132117322 15:99146883-99146905 CACACAGCCTATAGTGGGCAAGG + Intronic
1132456896 16:29078-29100 CCCACTTCTCAGAGAGGTCAGGG + Intergenic
1132912863 16:2324528-2324550 CGCACTGCAAAGAGAGAGCACGG + Exonic
1132953214 16:2576717-2576739 CCCACTGCTTTGGGAGGCCAAGG - Intronic
1133789850 16:9001223-9001245 CCCACTGCTTTGGGAGGCCAAGG - Intergenic
1133800245 16:9079557-9079579 CCCACTGCTTTGGGAGGCCAAGG - Intergenic
1133845184 16:9446931-9446953 CACACTACTTTGGGAGGCCAAGG - Intergenic
1134515920 16:14886841-14886863 CCCACTGCTCAGAGACGGCGAGG + Exonic
1134703592 16:16285485-16285507 CCCACTGCTCAGAGATGGCGAGG + Exonic
1134963951 16:18426629-18426651 CCCACTGCTCAGAGATGGCGAGG - Exonic
1134968238 16:18509165-18509187 CCCACTGCTCAGAGATGGCGAGG - Intronic
1135022751 16:18976635-18976657 CGGAATGCCTAGAGAGGGCATGG + Intergenic
1135654563 16:24236316-24236338 AAACCTGCTTAGAGAGGTCAAGG + Intergenic
1136019011 16:27428232-27428254 TACAAGGCTCAGAGAGGGCAAGG + Intronic
1137014706 16:35363483-35363505 CACAATGCTTCTTGAGGGCAGGG - Intergenic
1137810413 16:51347187-51347209 CCCAGTGCTTTGAGAGGCCAAGG - Intergenic
1137979695 16:53059089-53059111 CTCAGTGCTTTGAGAGGCCAAGG - Intronic
1138968203 16:62111421-62111443 CCCAATGCTTTGAGAGGCCAAGG - Intergenic
1139483143 16:67241701-67241723 CACAGTGCTAAGAAAGGGGAGGG + Intronic
1139548902 16:67662675-67662697 CACACTGCTGGGACATGGCAGGG + Exonic
1139690376 16:68637954-68637976 CCCACTGCTTAGGGAGGCCGAGG + Intronic
1140225730 16:73075196-73075218 CACAGTGCTTAGAGAGGCTGAGG + Intergenic
1140461265 16:75141632-75141654 CCCAGTGCTTTGAGAGGCCAAGG + Intergenic
1141008691 16:80376806-80376828 GACTCTGCTGAGAGAGGGGAGGG - Intergenic
1141756977 16:85997762-85997784 CCCCCAGCTTGGAGAGGGCATGG + Intergenic
1143908923 17:10231493-10231515 CCCAGTGCTTTGAGAGGCCAAGG + Intergenic
1144094901 17:11891613-11891635 CACAGTGCTTTGGGAGGCCAAGG - Intronic
1144155786 17:12499972-12499994 CCCACTGCTTTGGGAGGCCAAGG + Intergenic
1145040362 17:19573631-19573653 CCCACTGCTTTGGGAGGCCAAGG - Intronic
1145728605 17:27155856-27155878 CACAATCCTACGAGAGGGCAGGG - Intergenic
1145838738 17:27975772-27975794 CACAGTGCTTTGCGAGGCCAAGG + Intergenic
1145899430 17:28480605-28480627 AACACCCCTTAGAGATGGCAGGG - Intronic
1145918441 17:28591513-28591535 CCCACTGCTTTGGGAGGCCAAGG - Intronic
1146173105 17:30647894-30647916 CCCACTGCTTTGAGAGGCCTAGG + Intergenic
1146346565 17:32063927-32063949 CCCACTGCTTTGAGAGGCCTAGG + Intergenic
1146506217 17:33408034-33408056 CACACTTCTTCTAAAGGGCAGGG - Intronic
1146789681 17:35744239-35744261 CCCACTGCTTTGGGAGGCCAAGG + Intronic
1146939429 17:36834065-36834087 AAGACTGCTTAGGGAGGCCAAGG - Intergenic
1147131015 17:38408997-38409019 CTCAGTGCTTTGAGAGGCCAAGG - Intergenic
1147173753 17:38637970-38637992 CCCAGTGCTTTGAGAGGTCAAGG + Intergenic
1147243826 17:39108033-39108055 CACAGGGCCTAGAGAGGGCAAGG - Intronic
1148802053 17:50234760-50234782 CTCAGTGCTTTGAGAGGCCAAGG - Intergenic
1148869178 17:50645848-50645870 CCCAGTGCTTTGAGAGGCCAAGG - Intronic
1148884665 17:50763390-50763412 CACACTGCTCAGAAAGGTAAGGG - Intergenic
1148900587 17:50873171-50873193 CCCACTGCTTTGGGAGGCCAAGG - Intergenic
1149381887 17:56102827-56102849 CCCAGTGCTTTGAGAGGTCAAGG - Intergenic
1149916832 17:60617206-60617228 CACAGTGCTTTGGGAGGCCAAGG - Intronic
1149977076 17:61277010-61277032 CACAATGCTTTGGGAGGCCAAGG + Intronic
1150101450 17:62427250-62427272 CTCACTGCTCAGAGAGGGTAAGG - Intronic
1150416370 17:64991892-64991914 CCCAGTGCTTTGAGAGGCCAAGG - Intergenic
1150795307 17:68232244-68232266 CCCAGTGCTTTGAGAGGCCAAGG + Intergenic
1151548599 17:74808358-74808380 CACACTGCTTAGATGTGGCAGGG - Intronic
1203163198 17_GL000205v2_random:70612-70634 GATCCTGCCTAGAGAGGGCATGG + Intergenic
1153049748 18:890447-890469 CACAGTGCTTTGGGAGGCCAAGG - Intergenic
1156410415 18:36822847-36822869 CACAGTGCTTTGGGAGGCCATGG - Intronic
1156994351 18:43447954-43447976 CCCACTGCTTAGAGGTAGCAAGG - Intergenic
1157322355 18:46644465-46644487 CACAGTGCCTCGAGAGGCCAAGG + Intronic
1157532160 18:48430198-48430220 CGCAGTGCTGAGAGATGGCAGGG - Intergenic
1159353894 18:67310979-67311001 TAAACTGCTTTGAGATGGCATGG + Intergenic
1159841672 18:73405566-73405588 CCCAGTGCTTTGAGAGGTCAAGG - Intergenic
1160136322 18:76274611-76274633 CACACTGCTCAGAGTGAGCTGGG - Intergenic
1161519591 19:4716283-4716305 CAGCCTGCTTTGAGAGGGAAGGG + Intronic
1162055934 19:8064083-8064105 CTCAGTGCTTTGAGAGGCCAAGG - Intronic
1162524314 19:11198336-11198358 CTCAGTGCTTAGGGAGGCCAAGG + Intergenic
1162819509 19:13214063-13214085 CTCAGTGCTTTGAGAGGCCAGGG - Intronic
1164084845 19:21891650-21891672 CACAATGCTTTCTGAGGGCAGGG - Intergenic
1164643280 19:29841876-29841898 CACAGTGATTAGAGAAGGGATGG - Intergenic
1165116308 19:33531069-33531091 CCCAGTGCTTTGAGAGGCCAAGG - Intergenic
1165916187 19:39262251-39262273 CCCAGTGCTTTGAGAGGCCAAGG + Intergenic
1167137612 19:47626656-47626678 CTCACTGCTTTGGGAGGCCAAGG - Intronic
1167267261 19:48489766-48489788 CACACAGCTAAGAAATGGCAGGG + Intronic
1167521687 19:49959357-49959379 CACACTGCACAGAGAGGTCCAGG + Exonic
1167523696 19:49971365-49971387 CACACTGCACAGAGAGGTCCAGG - Intergenic
1167756372 19:51415895-51415917 CACACTGCACAGAGAGGTCCAGG + Exonic
925971566 2:9110142-9110164 CACTCTGCTCTGGGAGGGCAGGG - Intergenic
926195252 2:10759829-10759851 CACTTTGCTCAGAGAGGTCAAGG + Intronic
926196472 2:10766384-10766406 CACTTTGCTCAGAGAGGTCAAGG + Intronic
927423485 2:22956481-22956503 CACACTGCTCAGGGAGATCAGGG - Intergenic
927613064 2:24561684-24561706 CACAGTACTTGGAGTGGGCAAGG + Intronic
928305773 2:30169341-30169363 CTCAGTGCTTTGAGAGGCCAAGG - Intergenic
929296804 2:40257649-40257671 CACACTGCTTTGAAAGGGAAGGG - Intronic
930671707 2:54158454-54158476 CCCAGTGCTTTGAGAGGTCAAGG - Intronic
931684772 2:64784012-64784034 CACAATGCTTAGGGAGAGCTTGG + Intergenic
932063074 2:68527682-68527704 CTCACTGCCCAGACAGGGCAGGG + Intronic
932227105 2:70050697-70050719 CCCAATGCTTTGAGAGGCCAAGG + Intergenic
932389010 2:71367819-71367841 CCCACTGCTTTGGGAGGCCAAGG - Intronic
933828296 2:86184424-86184446 CTCAGTGCTTTGAGAGGCCAAGG - Intronic
936117297 2:109712315-109712337 CACAGGGCCTGGAGAGGGCAAGG - Intergenic
936490168 2:112963265-112963287 CACACTGTGTGCAGAGGGCAAGG - Intergenic
937414944 2:121707049-121707071 CCCAGTGCTTTGAGAGGCCAAGG + Intergenic
938385039 2:130859496-130859518 CCCAGTACTTAGAGAGGCCAAGG + Intronic
938385420 2:130862972-130862994 CCCAGTACTTAGAGAGGCCAAGG + Intronic
938637793 2:133248440-133248462 CACACTGCAGAGGAAGGGCATGG - Intronic
939480889 2:142745779-142745801 CCCAGTACTTTGAGAGGGCAAGG + Intergenic
940009352 2:149038420-149038442 CACCCAGCTTAAAGAGGGGAGGG - Intronic
940220298 2:151344405-151344427 CCCACAGCTTCGAGAGGCCAAGG + Intergenic
944638164 2:201694862-201694884 CCCAGTGCTTAGAGAAGCCAAGG - Intronic
944655454 2:201872705-201872727 GAGACTGCGTAGAGAGGGCCTGG - Intronic
944752220 2:202721882-202721904 CCCAGTGCTTTGAGAGGCCAAGG - Intronic
945622596 2:212159689-212159711 CACACTGCTTGAAGAAAGCAAGG + Intronic
945799255 2:214405375-214405397 CCCAATGCTTTGAGAGGCCAAGG - Intronic
946080456 2:217114093-217114115 AATACTTCTTAGGGAGGGCATGG - Intergenic
946168131 2:217877799-217877821 CTCACTGCCAGGAGAGGGCAAGG + Intronic
947229024 2:227866826-227866848 CACAGTGCTTTGGGAGGCCAAGG - Intergenic
948686277 2:239671640-239671662 CACCCTGCTCGGAGAGGGCTCGG - Intergenic
1169001059 20:2168386-2168408 CAGACAGCTCAGAGAGGTCAAGG - Intronic
1169297467 20:4412492-4412514 CTCAGTGCTTAGAGATGGTATGG - Intergenic
1170397627 20:15945027-15945049 CACACAGCTTAGTCAGGGTAGGG - Intronic
1171427411 20:25057608-25057630 GCCACTGCTTAGAGCGGGCGGGG + Intronic
1172607784 20:36226247-36226269 CACACAGCTAATAAAGGGCAGGG - Intronic
1173794401 20:45848951-45848973 CACACTGCTCAGAGAAGTGAAGG - Intronic
1173959284 20:47058592-47058614 CCCAGTGCTTTGAGAGGTCAAGG + Intronic
1176338280 21:5619255-5619277 AACTCTGCCTAGAGAGGGCATGG - Intergenic
1176339688 21:5682328-5682350 AACTCTGCCTAGAGAGGGCATGG - Intergenic
1176471942 21:7114481-7114503 AACTCTGCCTAGAGAGGGCATGG - Intergenic
1176495503 21:7496259-7496281 AACTCTGCCTAGAGAGGGCATGG - Intergenic
1176505139 21:7642128-7642150 AACTCTGCCTAGAGAGGGCATGG + Intergenic
1177044890 21:16157124-16157146 CACACAGCTTGTAGATGGCAGGG - Intergenic
1178293155 21:31386720-31386742 CATACATCTTAGGGAGGGCACGG + Intronic
1178574786 21:33776299-33776321 CCCAATACTTTGAGAGGGCAAGG + Intronic
1178752412 21:35317367-35317389 AACACTGCACAGAGAGGCCAAGG - Intronic
1179085974 21:38218137-38218159 CCCACTACTTTGAGAGGACAAGG + Intronic
1179547981 21:42125059-42125081 CACACTCCTTAGTGGGGACAGGG + Intronic
1180038968 21:45266024-45266046 CACACTGTCTAGCCAGGGCATGG + Intronic
1181727712 22:24823066-24823088 CACAAGGCTTAGAAATGGCAGGG - Intronic
1182792867 22:32967519-32967541 GACTCTGCTTAGAGTGGGCTGGG + Intronic
1182889965 22:33809374-33809396 CTCACTGCTTATTGAGGGCATGG - Intronic
1184354786 22:43971947-43971969 CACAGTGCTTTGGGAGGACAAGG - Intronic
1184373419 22:44097107-44097129 CACACAGCTCAGAGATGGCATGG + Intronic
1184408311 22:44312651-44312673 CCCAGTGCTTAGCCAGGGCAGGG + Intronic
1185383340 22:50520502-50520524 CCCAGTGCTTTGAGAGGCCAAGG - Intronic
950105527 3:10386103-10386125 CACACTGTTGCGTGAGGGCATGG + Intronic
952654763 3:35771711-35771733 CACACTGCATAGAATGTGCAGGG + Intronic
952758634 3:36894261-36894283 CACACTGGGAAGAGAGGACAAGG + Intronic
953600362 3:44357152-44357174 CCCATTGCTTTGAGAGGGTAAGG + Intronic
955319199 3:57962069-57962091 CACACAGCTTAGACATAGCAGGG - Intergenic
956463322 3:69494128-69494150 CCCAGTGCTTAGGGAGGCCAAGG - Intronic
956961936 3:74413245-74413267 CCCACTGCTTAGAGGGTACATGG + Intronic
957129303 3:76202894-76202916 CACTCTGCCTAGAGAGCCCAAGG - Intronic
959624580 3:108434832-108434854 CACACTGCTAATGGAGAGCAAGG - Intronic
960465525 3:117993027-117993049 AACAGTGCTTTGAGAGGCCAAGG + Intergenic
961674548 3:128556509-128556531 CCCCCTTGTTAGAGAGGGCAAGG - Intergenic
962294637 3:134171614-134171636 CCCAGTGCTTTGAGAGGTCAAGG + Intronic
964782565 3:160356769-160356791 CCCAGTGCTTTGAGAGGCCAAGG - Intronic
965716631 3:171611827-171611849 CCCAGTGCTTTGAGAGGCCAAGG + Intronic
965716761 3:171612915-171612937 CCCAGTGCTTTGAGAGGCCAAGG + Intronic
968309485 3:197671596-197671618 CACACTGGTTGGAGATGACAAGG + Intronic
968337167 3:197923814-197923836 CCCAATGCTTTGAGAGGCCAAGG + Intronic
968451789 4:679359-679381 CACAGAGCTGACAGAGGGCATGG + Intronic
968753533 4:2402606-2402628 CACACAGCAGAGAGCGGGCAGGG + Intronic
969238153 4:5881462-5881484 CACACTGCAGTGGGAGGGCATGG - Intronic
969505154 4:7581731-7581753 CACACTGTGTACAGAGGGCTGGG - Intronic
969546281 4:7830857-7830879 CCCAGTGCTTTGGGAGGGCAAGG - Intronic
969620583 4:8276874-8276896 AACAAGGCTTAGAGAGGCCACGG - Intronic
969622499 4:8285757-8285779 CACACCGTTCACAGAGGGCAGGG + Intronic
970750665 4:19355326-19355348 CACAGTTCTTTGAGAGGCCAAGG - Intergenic
974708293 4:65552531-65552553 CCCACTTCTTAAAGAGGTCAGGG - Intronic
975921354 4:79393978-79394000 CACAGTGCTTTGGGAGGCCAAGG - Intergenic
976566212 4:86553368-86553390 CACAAAGCTGAGAGAGGGCTTGG + Intronic
978389151 4:108206328-108206350 CACAGTGCTTTGGGAGGCCAAGG - Intergenic
978539067 4:109796549-109796571 CCCAGTGCTTTGAGAGGCCATGG + Intronic
978568760 4:110113327-110113349 CCCAATGCTTTGGGAGGGCAAGG + Intronic
982689837 4:158535557-158535579 AGCAATCCTTAGAGAGGGCATGG + Intronic
982715658 4:158804660-158804682 CGCAGTGCTTTGAGAGGCCAAGG - Intronic
983230993 4:165128685-165128707 CACAATGCTTTGGGAGGCCAAGG + Intronic
983945959 4:173585636-173585658 CCCATTGCTTGGAGAGGCCAAGG + Intergenic
984012726 4:174389996-174390018 CCCAGTGCTTTGAGAGGTCAAGG + Intergenic
984022590 4:174503972-174503994 CACAATGCTTTGGGAGGCCAAGG - Intronic
985617419 5:932007-932029 CACACCGCTTCAAGAGAGCATGG + Intergenic
986035991 5:3940546-3940568 CACAGTGACTAGAGAGGGCTGGG + Intergenic
986442661 5:7795467-7795489 CACCCTGCTGAGAGGGGGCTGGG - Intronic
986574153 5:9195420-9195442 CACAGTGCTTTGTGAGGCCAAGG - Intronic
988057341 5:26115373-26115395 CACAGTTCTTTGGGAGGGCAAGG - Intergenic
989567890 5:42919192-42919214 CCCACTGCTTTGGGAGGCCAAGG + Intergenic
990402293 5:55451167-55451189 CCCAGTGCTTAGGGAGGCCAAGG + Intronic
995226027 5:109702031-109702053 GACTGTGCTTAGTGAGGGCAGGG + Intronic
998011704 5:138700368-138700390 CCCAGTGCTTTGAGAGGCCAAGG - Intronic
1000105704 5:158056929-158056951 CACACTGCAGAGAGAGGGAAAGG - Intergenic
1000314743 5:160078886-160078908 CGCACTGTTTATAAAGGGCAAGG + Intronic
1001206764 5:169770548-169770570 CTCAGTGCTTTGAGAGGCCAAGG - Intronic
1003294613 6:4814028-4814050 CCCAATGCTTTGAGAGGCCAAGG - Intronic
1003680090 6:8244441-8244463 CCCACTGCTTTGGGAGGTCAAGG - Intergenic
1003817498 6:9858551-9858573 CACACTGCAAAGAGATGGCAGGG + Intronic
1004063573 6:12221558-12221580 CCCAGTGCTTTGAGAGGCCAAGG + Intergenic
1005111802 6:22290191-22290213 CAAACGGCTTCTAGAGGGCATGG - Exonic
1007420317 6:41715240-41715262 CACACAGCTTAGGGAGAGCTAGG + Intronic
1008764645 6:54896526-54896548 CACACTGATAAGAGAAGGAAGGG + Intronic
1008780413 6:55096518-55096540 CTCAGTGCTTTGAGAGGCCAAGG - Intergenic
1010008073 6:71017603-71017625 CTCAGTGCTTTGAGAGGCCAAGG + Intergenic
1011731149 6:90265212-90265234 TACACAGCTGAGAGAGAGCATGG + Intronic
1013097449 6:106958643-106958665 CACACTACTTTGGGAGGCCAAGG + Intergenic
1013311458 6:108898397-108898419 CACCCTGCCCCGAGAGGGCATGG + Intronic
1013385878 6:109630030-109630052 CATACTTCTTAGATAGTGCAAGG - Intronic
1014161643 6:118176443-118176465 CCCAGTGCTTTGAGAGGCCAAGG - Intronic
1015434194 6:133167080-133167102 CACTCTGTTCTGAGAGGGCAGGG - Intergenic
1015928133 6:138330296-138330318 CACACGGCAGAAAGAGGGCAAGG - Intronic
1016821502 6:148350202-148350224 CCCACTGCTTTGGGAGGCCAAGG + Intronic
1016888253 6:148979724-148979746 CACAGAGCTAAGAGCGGGCATGG - Intronic
1017687370 6:156926928-156926950 CTCAGTGCTTTGAGAGGCCAAGG - Intronic
1019627081 7:2021833-2021855 CACACTGCTTACAGGGGCCAGGG - Intronic
1019891317 7:3949349-3949371 CATACTGCTTAGGCAGTGCAAGG + Intronic
1019942699 7:4303737-4303759 CCCAGTGCTTTGAGAGGCCAAGG + Intergenic
1021486459 7:21173654-21173676 CACACAGCTTCCAGAGGGAATGG + Intergenic
1021708590 7:23392879-23392901 CACAGTACTTTGAGAGGCCAAGG - Intronic
1022372452 7:29784253-29784275 CACAATGCTTTGAGGGGCCAGGG + Intergenic
1025996244 7:66529295-66529317 CACCCTGCTTAGAAAGGGAACGG + Intergenic
1026689512 7:72539867-72539889 CCCAGTGCTTTGAGAGGCCAAGG + Intergenic
1026961759 7:74412821-74412843 CTCAGTGCTTTGAGAGGACAAGG + Intergenic
1026988209 7:74568201-74568223 CACCCTGCTTAGAAAGGGAACGG + Intronic
1027049923 7:75015526-75015548 CCCACTGCTTTGGGAGGCCAAGG - Intronic
1027661702 7:80995814-80995836 CACACTCCTGAGAGAGGTCGAGG + Intergenic
1030912594 7:115270370-115270392 CCCAGTGCTTTGAGAGGGTAAGG - Intergenic
1032030600 7:128480109-128480131 CTCACTGCTCAGAGAGGGTAAGG - Intronic
1032105221 7:129022874-129022896 CAAACTGATTAGAGAGAACAAGG + Intronic
1032311379 7:130790539-130790561 CCCAGTGCTTTGAGAGGCCACGG + Intergenic
1033118517 7:138647032-138647054 GACATTGCTTAGAGAAGGAAAGG + Intronic
1035367569 7:158359012-158359034 CAGACTCCTTAGAGTGGGGATGG - Intronic
1036070857 8:5439730-5439752 CACAATGCTTATGGAGGCCAGGG + Intergenic
1036927837 8:12924625-12924647 CCCAGTGCTTTGGGAGGGCAAGG + Intergenic
1038794633 8:30699033-30699055 CCTACTGCTTTGAGAGGCCAAGG + Intronic
1039429190 8:37512249-37512271 CCCAGTGCTTTGGGAGGGCAAGG + Intergenic
1039504891 8:38044688-38044710 CACAATGCTTTGGGAGGCCAAGG - Intronic
1039923751 8:41910818-41910840 CACAGTACTTAGGGAGGCCAAGG + Intergenic
1039995562 8:42529217-42529239 TACAGTGCTTTGAGAGGCCAAGG - Intronic
1040296893 8:46154484-46154506 AACACTGCTTTGAGAGGTCTGGG - Intergenic
1040358640 8:46643739-46643761 CGCCCTGCCTAGAGAGGGCATGG + Intergenic
1040699418 8:50042845-50042867 CCCACTGCTTTGAGAGGCTAAGG - Intronic
1041927169 8:63248834-63248856 CCCACTGCTTTGGGAGGTCAAGG - Intergenic
1043286369 8:78536990-78537012 GACACTTCTTAGAGAAGGAAAGG - Intronic
1045074581 8:98549767-98549789 CACAGTGCTTTGGGAGGTCAGGG + Intronic
1046941084 8:119932233-119932255 CCCAGTGCTTTGAGAGGCCAAGG - Intronic
1047840005 8:128741280-128741302 CAGAAAGCTTAGACAGGGCATGG - Intergenic
1048850335 8:138639234-138639256 CACACAGCTTATAGAAAGCAAGG + Intronic
1049546683 8:143235113-143235135 ACCACGGCTCAGAGAGGGCAGGG - Intergenic
1049646217 8:143736964-143736986 CCCTCTGCTTAGAGTGGGCCTGG + Intergenic
1049850714 8:144828726-144828748 CAGACTGCTTCGTGAAGGCAGGG + Intronic
1051109293 9:13617168-13617190 CCCAATGCTTTGAGAGGCCAAGG - Intergenic
1051554089 9:18363463-18363485 CACACAGCTTAGAAGAGGCAAGG - Intergenic
1052169246 9:25373753-25373775 CCCACTGCTTTGAGAGGCCAAGG + Intergenic
1052980838 9:34448119-34448141 CCCAGTGCTTAGAGAGGCCAAGG - Intronic
1055748945 9:79483044-79483066 CACAGTGCTTTGGGAGGCCAAGG - Intergenic
1057263720 9:93600436-93600458 CACACTGCTTTGAGGGGGAAAGG + Intronic
1058502738 9:105637797-105637819 CTCCCTGCTTAGAGAGGACTGGG - Exonic
1060366383 9:123019563-123019585 TCCACTGCTTTGAGAGGCCAAGG - Intronic
1060392120 9:123286620-123286642 CACACAGCTGAGAGAGGACAGGG + Intergenic
1061464912 9:130770254-130770276 CCCAATGCTTTGAGAGGCCAAGG + Intronic
1061856084 9:133442730-133442752 CACACTCACTAGGGAGGGCAGGG - Exonic
1203423383 Un_GL000195v1:15665-15687 AACTCTGCCTACAGAGGGCATGG + Intergenic
1185660554 X:1725469-1725491 CAGACTGTTTTGAGAGGGTATGG - Intergenic
1185800385 X:3005297-3005319 CCCAGTGCTTTGAGAGGCCAAGG - Intergenic
1185821162 X:3206046-3206068 CCCAGTGCTTTGAGAGGCCAAGG - Intergenic
1186407101 X:9313728-9313750 CACACTGCTCAGAGAGGTGGTGG + Intergenic
1188400907 X:29742932-29742954 CACACAACTAAGAAAGGGCAGGG - Intronic
1188930464 X:36103463-36103485 CACTCAGCTCACAGAGGGCAAGG - Intronic
1189273693 X:39769620-39769642 CACACTTCTGAGAGACAGCATGG + Intergenic
1189377353 X:40475999-40476021 CTCCCTGCTCAGAGAGGCCAGGG - Intergenic
1190622397 X:52300354-52300376 TGCACTGCTTAGGGAGGGGAAGG + Intergenic
1190649934 X:52559114-52559136 CACACTGCTTAGAGAGGGCAAGG - Intergenic
1190684127 X:52855329-52855351 CATACTGCTTAAGGAGGGGAAGG - Intergenic
1191000005 X:55649724-55649746 CATACTGCTTAAGGAGGGGAAGG - Intergenic
1192131184 X:68552638-68552660 CACAGTGCTTTGGGAGGCCAAGG + Intergenic
1192200697 X:69064812-69064834 CATGGTGCTTAGAGAGGCCATGG + Intergenic
1192342860 X:70278309-70278331 CACGATGCTGAGCGAGGGCAGGG + Intronic
1192377727 X:70581254-70581276 AAAACTGCTTAGTGAGGCCAAGG - Intronic
1193519778 X:82514218-82514240 CTCAGTGCTTTGAGAGGCCAAGG - Intergenic
1194084440 X:89508948-89508970 CCCAGTGCTTTGAGAGGCCAAGG - Intergenic
1196656881 X:118227829-118227851 CCCAGTGCTTTGAGAGGCCAAGG + Intergenic
1196823009 X:119718397-119718419 CCCAGTGCTTTGAGAGGCCAAGG + Intergenic
1197723672 X:129761569-129761591 CCCACTGCTTTGGGAGGCCAAGG + Intronic
1198590368 X:138173753-138173775 CACACTGCTTAGGGAACACAAGG + Intergenic
1199265346 X:145821202-145821224 CACAATGCCTATGGAGGGCAGGG - Exonic
1200399464 X:156010645-156010667 CCCACTTCTCAGAGAGGTCAGGG - Intronic
1200437082 Y:3164833-3164855 CCCAGTGCTTTGAGAGGCCAAGG - Intergenic
1201259623 Y:12146169-12146191 CCCAATGCTTTGAGAGGCCAAGG + Intergenic
1201602802 Y:15749267-15749289 TACAGTTCTTAGAGATGGCACGG - Intergenic