ID: 1190650316

View in Genome Browser
Species Human (GRCh38)
Location X:52563044-52563066
Sequence TCTCAGGGTGAAGGGTCATG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 215
Summary {0: 1, 1: 0, 2: 1, 3: 15, 4: 198}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1190650316_1190650326 11 Left 1190650316 X:52563044-52563066 CCTCATGACCCTTCACCCTGAGA 0: 1
1: 0
2: 1
3: 15
4: 198
Right 1190650326 X:52563078-52563100 ATGCTGCCCCATGCTCTGGAAGG 0: 1
1: 0
2: 3
3: 22
4: 220
1190650316_1190650324 7 Left 1190650316 X:52563044-52563066 CCTCATGACCCTTCACCCTGAGA 0: 1
1: 0
2: 1
3: 15
4: 198
Right 1190650324 X:52563074-52563096 GACCATGCTGCCCCATGCTCTGG 0: 1
1: 0
2: 2
3: 13
4: 160

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1190650316 Original CRISPR TCTCAGGGTGAAGGGTCATG AGG (reversed) Intergenic
900097272 1:945041-945063 TCGGAGGGTGAATGGTCTTGGGG - Exonic
900308526 1:2022508-2022530 TCTCAGGGTGGTGGCACATGTGG - Intronic
900345872 1:2210025-2210047 CCTCAGGGTGGGGGGTCCTGAGG + Intronic
900456535 1:2777663-2777685 TCTCAGGGTGAAGAGGCAGAGGG + Intronic
901110199 1:6786959-6786981 TCACTGGGAAAAGGGTCATGTGG + Intronic
902274609 1:15330519-15330541 TCTCAGGGGGAAGGATGAGGTGG + Intronic
903576737 1:24344066-24344088 ACTCAGGGTGAAGGCCCCTGTGG + Intronic
904273634 1:29366493-29366515 GGTCAGGATGAAGGGTCCTGGGG + Intergenic
905016087 1:34779859-34779881 TCTGAAGGTCAAGGGTCATGGGG + Intronic
912186437 1:107282300-107282322 TCTCAGGATGAAGGTTCGTAGGG - Intronic
915582704 1:156824587-156824609 TCTCAGGCTGAATGGTCACTTGG + Intronic
915827757 1:159096823-159096845 CCTGAGGGTGAAGGATGATGGGG + Intronic
920866600 1:209758645-209758667 TCCCAGGGTGGTGGGTAATGAGG + Exonic
922532957 1:226358205-226358227 TTTCTGGGTGATGGGGCATGTGG + Intergenic
1062847261 10:717696-717718 TCTCAGGGTGGAGAGGCCTGGGG - Intergenic
1062920186 10:1273604-1273626 TCTCAGCGTGCAAGGTCGTGGGG - Intronic
1063654482 10:7974240-7974262 GTCCAGGGTCAAGGGTCATGAGG - Intronic
1067036697 10:42926070-42926092 TCTCAGGGTGCAGGAACATCAGG - Intergenic
1067922464 10:50473998-50474020 TGTCATGGTGAAAGGTCAAGAGG + Intronic
1069166299 10:65164714-65164736 TCTCAGGGGAAAGTGTCATGTGG - Intergenic
1069221479 10:65889012-65889034 CCTCAGGGTTAAAGGCCATGAGG - Intergenic
1070580674 10:77716739-77716761 TCTCAGGGAGACAGGCCATGCGG + Intergenic
1072549760 10:96468673-96468695 TCTCAGGTTCATGGTTCATGAGG + Intronic
1072692352 10:97580458-97580480 TCTCACAGTTAAGGGTCATCTGG + Intronic
1076771805 10:132670131-132670153 TCAGAGGGTGTAGGGTCTTGGGG - Intronic
1076810585 10:132884547-132884569 TGTCAGGGGCAAGGGCCATGTGG - Intronic
1080083008 11:28243772-28243794 TCTCCGGGGGAAGACTCATGAGG - Intronic
1080690002 11:34548666-34548688 TCTCAGAGGGCAGGGTTATGTGG - Intergenic
1081743042 11:45454213-45454235 TCTCAGGGTGCAGTACCATGGGG + Intergenic
1083415185 11:62520985-62521007 TCCCAAGGTGAAGGGTGATGTGG - Exonic
1083415288 11:62521591-62521613 TCCCAAGGTGAAGGGTGATGTGG - Exonic
1083415886 11:62525473-62525495 TCCCAAGGTGAAGGGCGATGTGG - Exonic
1083416079 11:62526625-62526647 TCCCAAGGTGAAGGGCGATGTGG - Exonic
1084787374 11:71450703-71450725 TCACTGGGTGAAAGGTCATTTGG - Intronic
1085701540 11:78750562-78750584 TCTCATGGTGTAGGCTCAGGGGG + Intronic
1089782549 11:120883799-120883821 TCTCAGGCAGAAGCGTGATGGGG - Intronic
1091090503 11:132766637-132766659 CCTCAGTGTGAGGGGTCAGGAGG - Intronic
1096401002 12:51306209-51306231 TGTCAGTTTGAAGGGACATGAGG + Intronic
1097827031 12:64184694-64184716 TCCCAGCTTGAAGGGACATGAGG - Intergenic
1098981458 12:76961287-76961309 ACCCAGGCTGAAGGGTAATGGGG + Intergenic
1100535802 12:95507707-95507729 TCTCAGTGTGAAAGCACATGTGG + Intronic
1100539160 12:95541742-95541764 TGACAGGTAGAAGGGTCATGAGG - Intronic
1102048462 12:109845201-109845223 CCTCAGTGTGGAGGGTCATTAGG - Intergenic
1102689919 12:114752251-114752273 TATGAGGGTGAAAGGTCAGGAGG - Intergenic
1104883013 12:132084900-132084922 GGACTGGGTGAAGGGTCATGAGG - Intronic
1105209236 13:18248025-18248047 TCCCAGGGTCAAGGGTGAAGGGG - Intergenic
1106437465 13:29736036-29736058 TCTAAGAGAGAAGGGTCAGGCGG + Intergenic
1109770600 13:66966723-66966745 TCTTTTGCTGAAGGGTCATGAGG + Intronic
1110893316 13:80716919-80716941 TCTCTGTGTGAAGGGTAGTGAGG - Intergenic
1113143753 13:107184067-107184089 TCTCAGGTTCAAGGTTCAGGTGG + Intronic
1113360655 13:109628319-109628341 TCACAGGCTGAAGAGTCATCTGG - Intergenic
1113459259 13:110470463-110470485 TCTCAGGGTGTGTGGTTATGAGG - Intronic
1113499136 13:110759587-110759609 TCTTAGGGTGCAGGGTGTTGAGG + Intergenic
1114198552 14:20501367-20501389 TTGCAGGGTCAAGGATCATGGGG - Intergenic
1118028179 14:61791979-61792001 TCTCAGTGTGCAGGCTCAGGAGG + Intronic
1118905143 14:70018236-70018258 TGTCAGCATGAAGGGTGATGAGG + Intronic
1119181362 14:72607386-72607408 TCACATGGTGAAGGGGCAAGGGG + Intergenic
1119618871 14:76116794-76116816 ACTCAAGATGAAGGGACATGGGG - Intergenic
1121451574 14:94011584-94011606 TTTGAAGGTGCAGGGTCATGGGG - Intergenic
1121494059 14:94379922-94379944 TCTCTGGGTGTAGGGCCCTGGGG - Intronic
1121863349 14:97339784-97339806 TCTCTGGGAGAGGGATCATGGGG - Intergenic
1122284432 14:100642295-100642317 GCTCAAGGTGGAGGGGCATGAGG + Intergenic
1122290463 14:100678026-100678048 TCCCAGGGTGGAGGGTTAGGAGG + Intergenic
1122309384 14:100784961-100784983 TCACAGGGGGAACTGTCATGTGG + Intergenic
1122963231 14:105109093-105109115 TCTGAGGGTGATGGGGCATCGGG + Intergenic
1123989290 15:25671501-25671523 TCTGAAAGTGAAGGGTGATGAGG + Intergenic
1126264551 15:46737408-46737430 TCTGAGGGTCAAGGGTCAGAAGG + Intergenic
1127718268 15:61673403-61673425 TAGCTGGGTGAAGGGTGATGTGG - Intergenic
1129119842 15:73389598-73389620 ACCTAGGGTGAAGGGTCAGGTGG + Intergenic
1129520319 15:76181978-76182000 TCTCAGGGTGAATGGTGCTGAGG - Intronic
1131932411 15:97458249-97458271 TATCAGGGTGTAGAGTCATTTGG - Intergenic
1132627323 16:897686-897708 TCTCAGGGTGAAGGGACCGCTGG + Intronic
1132685942 16:1162174-1162196 GCCCAGGGCGAGGGGTCATGGGG - Intronic
1133952450 16:10407781-10407803 ACTCAGGGGAAAGGGTGATGAGG - Intronic
1135401536 16:22169575-22169597 TCCCAGGGTGTAGGGTCAAAGGG + Intronic
1138559816 16:57794842-57794864 TCCCAGGCAGAGGGGTCATGAGG + Intronic
1139945076 16:70635220-70635242 TCTCAGGATGCATGGTAATGGGG - Intronic
1140876494 16:79157747-79157769 TGTCAGAGTGGAGGGACATGGGG + Intronic
1141608060 16:85166832-85166854 TCTGAGGGAGAAGGATCACGGGG - Intergenic
1141758724 16:86012667-86012689 TCTCAGTTTCAAGGTTCATGTGG - Intergenic
1142438310 16:90077161-90077183 TCTCAGGGTGAGGGGATCTGGGG + Intronic
1203106093 16_KI270728v1_random:1360497-1360519 GCTCAGGGCAAAGGGGCATGTGG + Intergenic
1203127421 16_KI270728v1_random:1601871-1601893 GCTCAGGGCAAAGGGGCATGTGG - Intergenic
1143131993 17:4684624-4684646 TGTCAGTGGGAAGAGTCATGTGG - Intronic
1143406171 17:6678394-6678416 TCGCAGGGTGAGGGGCCATCTGG + Intergenic
1146322375 17:31857075-31857097 TGCCACGGTGAAGTGTCATGAGG - Intronic
1146626144 17:34437019-34437041 TCTCAGGGCGAAGGGTCAGGTGG - Intergenic
1152234596 17:79132169-79132191 TCCCAGGGTGAGGGGGCTTGAGG + Intronic
1152444095 17:80330588-80330610 TCTCAGGGGGAAGGAGGATGGGG - Intronic
1153627726 18:7037898-7037920 TGGAAGGGTCAAGGGTCATGAGG - Intronic
1159950405 18:74478544-74478566 ACTCAGGGTAATGGGTCATGGGG - Intergenic
1163446654 19:17350994-17351016 TTCCAGGTTGAAGGGTCTTGTGG + Intergenic
1165003179 19:32781825-32781847 TCCCAGGGGTAAGGGACATGAGG - Intronic
1166552383 19:43674756-43674778 ACTCAGGTTTGAGGGTCATGCGG + Intergenic
1166755048 19:45185446-45185468 TCTGAGGGTGATGTGTTATGTGG - Intronic
1167367905 19:49064503-49064525 TCTGAGGGAGAAGGGTGCTGGGG - Intronic
1167367922 19:49064550-49064572 TCTGAGGGAGAAGGGTGCTGGGG - Intronic
1167559740 19:50218758-50218780 ACTCAGGGTGAAGGGTAGTGGGG - Intronic
1168240493 19:55086657-55086679 GCTCAGGGCGAGGGGTCCTGGGG - Intronic
926543778 2:14212794-14212816 TCACAGGATGAAGGGGCAGGAGG + Intergenic
926862762 2:17326284-17326306 TTTCAGTGAGAAAGGTCATGAGG + Intergenic
926977928 2:18533546-18533568 TCTCTGGATGAAGGGCCATTTGG + Intergenic
927511433 2:23646568-23646590 GCCTAGGGTGAGGGGTCATGAGG + Intronic
927878356 2:26673809-26673831 TGTCAGGGTCAAGGGACAGGGGG + Intergenic
929035435 2:37687118-37687140 TCTAAGGGTTCAGGGTCATCAGG - Intronic
929889683 2:45908593-45908615 TCTGAGGGGCAAGGGTCCTGAGG + Intronic
931700647 2:64906247-64906269 TCTCAGGGGAAAGGGCGATGGGG + Intergenic
934634579 2:95972486-95972508 GCTCAGGGCAAAGGGGCATGTGG - Intronic
934799056 2:97132750-97132772 ACTCAGGGCAAAGGGGCATGTGG + Intronic
934834381 2:97570721-97570743 GCTCAGGGCAAAGGGGCATGTGG - Intronic
935189148 2:100761953-100761975 TGTCAAGGTGATGGGTGATGGGG - Intergenic
936012190 2:108932010-108932032 TCTGAGGGTGAAAGGTCTTAGGG - Intronic
937232043 2:120403907-120403929 TCTCAGGGAGCAGGGTTGTGGGG + Intergenic
937282548 2:120730256-120730278 GCCCAGAGTGAAGGGCCATGAGG - Intergenic
937571533 2:123368941-123368963 TCTCAGGTTGAAGTGTCCTTTGG + Intergenic
937813118 2:126220899-126220921 TCTCACAGGGGAGGGTCATGGGG - Intergenic
939943028 2:148374636-148374658 CCTCAGGGTGAAGGAGCATATGG - Intronic
941646517 2:168046760-168046782 CCTCAGGGAGAGGGGTCAGGTGG + Intronic
941740308 2:169028612-169028634 TCTCAGTGGTAAGGATCATGAGG - Intronic
941920424 2:170845327-170845349 TCCCAGGGTAAAGGGTCCAGTGG + Intronic
944285924 2:197949689-197949711 CTTCAGGGTGAAGGGACCTGAGG + Intronic
945793540 2:214334063-214334085 TCTGAGGGTGCTGGGTCAAGGGG - Intronic
946188775 2:217996334-217996356 CCTAAGGGTGAGGGGGCATGGGG - Intronic
946941520 2:224774647-224774669 TGTAAGTGTGAAGGGTGATGGGG - Intronic
947126549 2:226874566-226874588 TCTCTGTGTCCAGGGTCATGTGG + Intronic
948352574 2:237353110-237353132 ACTCGGGGTGGAGGGTGATGGGG + Intronic
948549728 2:238762623-238762645 TATCAGGGTAAATGGTCTTGAGG + Intergenic
1169602000 20:7272078-7272100 TCTCAGGGTTAAGAGTATTGTGG + Intergenic
1173522493 20:43710134-43710156 CCTCAGAGGGAAGGGTCCTGTGG - Intronic
1173678663 20:44860565-44860587 TCACATGGTGAAAGGTCAAGAGG + Intergenic
1174528167 20:51190174-51190196 TCACAGGGGCCAGGGTCATGGGG - Intergenic
1175190140 20:57206227-57206249 GCTCAGGGTGAAAGGCCCTGAGG + Intronic
1175194676 20:57234670-57234692 TTTCATGGTGAATGGTCATCTGG - Intronic
1175572446 20:60034344-60034366 GCTCTGGGGGAAGGGTCATGAGG + Intergenic
1175599872 20:60264626-60264648 CCACAGGGTGATGGGTTATGAGG - Intergenic
1178128844 21:29546400-29546422 TCACAGGGTGAAGGGCCAGGAGG - Intronic
1178667658 21:34563088-34563110 TTTCAGGGTAAAGGAACATGGGG + Intronic
1180194991 21:46188553-46188575 TGTCAGGGTGATGAGTCATCTGG + Exonic
1180732649 22:17993687-17993709 TCTCAGGGGGCAGAGTCAGGAGG - Intronic
1180896995 22:19343088-19343110 ACTCAGGGGGAAGGGTGAAGAGG + Intronic
1180965986 22:19788201-19788223 CCTCGGGGTGAGGGGTCATGTGG + Exonic
1181495410 22:23284754-23284776 TCTAAGGTTGAAGGCTCATGTGG - Intronic
1181517399 22:23423009-23423031 TCTCAGGGGGCAGAGTCAGGAGG - Intergenic
1181762223 22:25066627-25066649 TGTCGAGGTTAAGGGTCATGAGG - Intronic
1182423315 22:30259012-30259034 TCTCATGGTGGATGGTCGTGGGG + Intergenic
950505189 3:13390209-13390231 CATCAGGGTGACGGGACATGAGG + Intronic
953920773 3:46949713-46949735 TTTCATGGTGCAGGGTCATGCGG - Intronic
954178361 3:48862072-48862094 TCTCAGTGTGAAAGTCCATGTGG + Intronic
958915086 3:100040802-100040824 TCTCAGGTTGTAGGATCATTAGG + Intronic
959498352 3:107076797-107076819 TCTGAGGAAGGAGGGTCATGGGG + Intergenic
960065017 3:113362267-113362289 TGTCTGGGTGAAGGGACAGGAGG + Intronic
960264687 3:115606950-115606972 ACTCAGGGAGAAGGGTGAGGTGG - Intergenic
961076933 3:123991565-123991587 CCTCTGGGTGAATTGTCATGTGG - Intronic
961307648 3:125969746-125969768 CCTCTGGGTGAATTGTCATGTGG + Intronic
961782468 3:129328602-129328624 CATCAGGGTGATGGGACATGAGG + Intergenic
964539993 3:157769267-157769289 GCTCAAGGTGCAGGGACATGGGG - Intergenic
975360052 4:73458668-73458690 TCTAAGCCAGAAGGGTCATGAGG - Intergenic
978679245 4:111358785-111358807 TCTCAGGGTGAATGAAGATGTGG - Intergenic
979080464 4:116332531-116332553 TATCAGGTTGAAAGCTCATGTGG - Intergenic
979856620 4:125640357-125640379 TCTCAAGGTCAACTGTCATGGGG + Intergenic
982401463 4:154972491-154972513 TCTCAGGCTTCTGGGTCATGCGG - Intergenic
983933535 4:173478596-173478618 TCCCAGGGTGAAGGGGTGTGGGG - Intergenic
984489298 4:180412273-180412295 ACTCAAGGTGAAGGGTTAGGAGG - Intergenic
985552831 5:541974-541996 TCTCAGGTGGAAGGGGCAGGTGG + Intergenic
990261165 5:54023984-54024006 TCTCAGGGGAAAGGGTGATGGGG - Intronic
993505924 5:88708435-88708457 TCTTAGAGTCAAGGGTCAAGGGG - Intergenic
994118559 5:96088767-96088789 TCTCGGGGAAAAGGATCATGGGG - Intergenic
994226817 5:97262066-97262088 TGTCATGGTGAAGGATCCTGTGG - Intergenic
994619199 5:102142830-102142852 TGTCAGAGTGAAGGGTCATTAGG - Intergenic
999383693 5:151139584-151139606 TGTCAGGGCAGAGGGTCATGGGG + Intronic
1000992122 5:167922202-167922224 TCTCATGGATATGGGTCATGAGG - Intronic
1004039415 6:11961025-11961047 TCTCACTGTGAAGGATCTTGTGG - Intergenic
1005922985 6:30417354-30417376 ACTCAGGGTGCAGGGCCATGTGG - Intergenic
1006320014 6:33314678-33314700 TCACAGGGTCAGGGGTCAGGTGG - Exonic
1013469279 6:110447234-110447256 TCCCAGGTTAAAGGGTCCTGCGG - Intronic
1015215703 6:130747680-130747702 TCTCAGGGTGATGAATTATGGGG - Intergenic
1022126958 7:27367706-27367728 GCTCAGGGTGAAGGCACAAGAGG - Intergenic
1028898841 7:96073240-96073262 TCTTGGGGTGAAGGGTGATAAGG + Intronic
1029687984 7:102162125-102162147 GATAAGGGGGAAGGGTCATGGGG + Intronic
1034426105 7:151015006-151015028 TTTCAGAGTGCAGGGTCAAGTGG - Exonic
1035698885 8:1622869-1622891 TTTCAGGGGGAAGAGTCAGGTGG + Intronic
1035930409 8:3774181-3774203 TATAAGGTTGAAGGGTCAGGCGG - Intronic
1038398129 8:27261997-27262019 GGTCGGGGAGAAGGGTCATGGGG + Intergenic
1044426356 8:92055481-92055503 GCTCAGGCTGGAGTGTCATGGGG + Intronic
1045244656 8:100432564-100432586 TGGCAGGGTGAAGGGTCTGGGGG - Intergenic
1045392784 8:101731961-101731983 TCTGATGGTGAAGAGACATGTGG - Intronic
1047899919 8:129409137-129409159 ACCCAGGGTGAAGAGTCATAAGG + Intergenic
1049414133 8:142487752-142487774 GCTCAGGGTGGATGGGCATGGGG - Intronic
1050253778 9:3772954-3772976 TCACAGGCTGATGGGTCATCAGG - Intergenic
1051039434 9:12788956-12788978 TCTCAGGAGGCAGGGTCAGGAGG + Intronic
1053286413 9:36852228-36852250 TCAAAGGGTGAAGGGGCAGGGGG - Intronic
1054987037 9:71273891-71273913 ACTCAGGGAGGAGGGTCTTGGGG - Intronic
1057647599 9:96891525-96891547 TTTCACGGGGAAGGGCCATGAGG - Intergenic
1057868190 9:98698107-98698129 TCTCATGGTACAGGGTCAGGAGG - Intronic
1057874925 9:98746690-98746712 TCTGCGGCTGAAGGGTGATGTGG - Intronic
1059328161 9:113517300-113517322 TCTCACGGTGAGGGTTGATGGGG + Intronic
1059572187 9:115451085-115451107 TCCCAGTGTGAAGGGAAATGGGG + Intergenic
1061907296 9:133705233-133705255 TCTCAGGGTGAGGGCAGATGGGG - Intronic
1061907309 9:133705282-133705304 TCTCAGGGTGAGGGCAGATGGGG - Intronic
1061907322 9:133705331-133705353 TCTCAGGGTGAGGGCAGATGGGG - Intronic
1061907335 9:133705384-133705406 TCTCAGGGTGAGGGCAGATGGGG - Intronic
1061907348 9:133705437-133705459 TCTCAGGGTGAGGGCAGATGGGG - Intronic
1061907371 9:133705535-133705557 TCTCAGGGTGAGGGCAGATGGGG - Intronic
1062146292 9:134991575-134991597 TCTCAAAGCGAAGGGTCCTGTGG + Intergenic
1186285375 X:8038123-8038145 TCCAAGTTTGAAGGGTCATGAGG + Intergenic
1186438150 X:9561104-9561126 TGTCATGGTGATGGGTCATTGGG - Intronic
1186840900 X:13484033-13484055 CCTGAGGGTGAATAGTCATGGGG + Intergenic
1188409170 X:29850302-29850324 TCTGAAGGAGCAGGGTCATGGGG - Intronic
1189039941 X:37531675-37531697 TCTGATTGTGAAGGGTCTTGTGG - Intronic
1190650316 X:52563044-52563066 TCTCAGGGTGAAGGGTCATGAGG - Intergenic
1194732173 X:97468008-97468030 TCCCAGGCTGAAGGTTCATTAGG + Intronic
1196111948 X:111955810-111955832 TATAAAGGTAAAGGGTCATGGGG - Intronic
1198133274 X:133720880-133720902 ACTCAGGGGGAAGGGTGAGGGGG + Intronic
1201741611 Y:17330151-17330173 TCTCAGAGGGAAGAATCATGGGG + Intergenic
1202585924 Y:26426986-26427008 GCTCAGGGCAAAGGGGCATGTGG + Intergenic