ID: 1190650959

View in Genome Browser
Species Human (GRCh38)
Location X:52568302-52568324
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 198
Summary {0: 2, 1: 4, 2: 6, 3: 27, 4: 159}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1190650955_1190650959 -3 Left 1190650955 X:52568282-52568304 CCGAACAAAGGGATCAATCACCT 0: 2
1: 1
2: 1
3: 12
4: 128
Right 1190650959 X:52568302-52568324 CCTTTTAAGTAGTTTGTGGCGGG 0: 2
1: 4
2: 6
3: 27
4: 159
1190650953_1190650959 -1 Left 1190650953 X:52568280-52568302 CCCCGAACAAAGGGATCAATCAC 0: 2
1: 4
2: 1
3: 6
4: 84
Right 1190650959 X:52568302-52568324 CCTTTTAAGTAGTTTGTGGCGGG 0: 2
1: 4
2: 6
3: 27
4: 159
1190650954_1190650959 -2 Left 1190650954 X:52568281-52568303 CCCGAACAAAGGGATCAATCACC 0: 5
1: 1
2: 1
3: 7
4: 94
Right 1190650959 X:52568302-52568324 CCTTTTAAGTAGTTTGTGGCGGG 0: 2
1: 4
2: 6
3: 27
4: 159
1190650950_1190650959 13 Left 1190650950 X:52568266-52568288 CCAGAAAGTCTGAGCCCCGAACA 0: 9
1: 14
2: 16
3: 25
4: 98
Right 1190650959 X:52568302-52568324 CCTTTTAAGTAGTTTGTGGCGGG 0: 2
1: 4
2: 6
3: 27
4: 159

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1190650959 Original CRISPR CCTTTTAAGTAGTTTGTGGC GGG Intergenic
900279377 1:1856266-1856288 CCTATTCAGGAGGTTGTGGCAGG - Intronic
902316488 1:15623762-15623784 TCTTATAAATAGTTAGTGGCCGG + Intronic
904063796 1:27732116-27732138 TCTTTTAATTATTATGTGGCTGG - Intronic
908159749 1:61394810-61394832 CCTTGAAAGTAGTCTTTGGCTGG + Intronic
908757274 1:67480364-67480386 CCATGTAAGAAGCTTGTGGCAGG + Intergenic
908795729 1:67829412-67829434 CTTTTTAAGTACTATTTGGCAGG + Intronic
908996406 1:70161394-70161416 CTTTTTAAGAAATTTTTGGCCGG + Intronic
909095786 1:71287012-71287034 GCTTTTAAGTAGTTTAATGCTGG - Intergenic
910489065 1:87747968-87747990 ACTTGTAAGTACCTTGTGGCAGG + Intergenic
913099821 1:115552682-115552704 CCTCTTAAGAAGTTTGCAGCTGG - Intergenic
917670315 1:177267730-177267752 CCTCTTAAGCAGTCTGTGGGTGG + Intronic
917728103 1:177846969-177846991 GATTTTAAGCAGTGTGTGGCTGG - Intergenic
919126573 1:193401512-193401534 TCTTTTATGTAGTTGTTGGCAGG - Intergenic
921079724 1:211729391-211729413 GCTTCTAAGCAGTTGGTGGCAGG + Intergenic
922128841 1:222756683-222756705 CCTTTTGAGTAATTTGTTGGGGG - Intergenic
924434015 1:244022580-244022602 CCCTTTGAGTAGTTTTTGACTGG + Intergenic
1064401853 10:15028110-15028132 CCTTTTAAGCAGTCAGTGGCTGG - Intergenic
1067004122 10:42645428-42645450 CCTTTTAAGCAGTCAGTGGCCGG - Intergenic
1067808464 10:49409282-49409304 TTTTTTAAGTTGTTTGTGCCGGG + Intergenic
1069482861 10:68799523-68799545 ACTTTTAAAGAGTTCGTGGCTGG + Intergenic
1070340969 10:75498285-75498307 CCTTTTAAGTTCTGTATGGCAGG + Intronic
1081480344 11:43481034-43481056 CCTTTTTATTAGTTTGTACCTGG - Intronic
1082727530 11:56754226-56754248 CCTTTTTAGTATTTTTTGCCTGG + Intergenic
1082967916 11:58987069-58987091 CATTTAAAGTAGTGTGTGGAGGG - Intronic
1083206598 11:61153555-61153577 GCTTTTTAGTTTTTTGTGGCAGG - Intronic
1084111158 11:67014979-67015001 TCTTTTAAGTAGTTTGTGGCGGG - Intronic
1086110332 11:83192341-83192363 CCTTTTAAGCAATTTGTGGCGGG - Intergenic
1089211500 11:116806846-116806868 CCTTTTACAGAGTTTGAGGCTGG - Intergenic
1089828357 11:121300590-121300612 CCTTTTAAGTATTTTTGGTCAGG - Intronic
1091745665 12:2991359-2991381 TCTTTTAAGTAGTTTGTTTCAGG + Intronic
1092195075 12:6544463-6544485 CCTTTTAAGCTATTTTTGGCTGG - Intronic
1092357449 12:7808466-7808488 CCTTTTTAGTTGTTTTTGGTAGG + Intergenic
1092629578 12:10363666-10363688 CCTTTTAAGCATTTCGTGGGTGG - Intergenic
1093929743 12:24943686-24943708 CAGTTAAAGTAGTTTGAGGCCGG + Intronic
1094749302 12:33387039-33387061 CCTGGTAAGAAATTTGTGGCAGG + Intronic
1095551981 12:43453388-43453410 CCTTTTAAATAGTTTGATGAGGG + Intronic
1096063452 12:48721106-48721128 CATTTTAAGTGGATGGTGGCAGG + Intergenic
1098815601 12:75157969-75157991 CCATTTAAGTCATTTGCGGCAGG + Intronic
1099635727 12:85208336-85208358 CTTTTTAAGTGCTTTTTGGCAGG - Intronic
1100525355 12:95413992-95414014 TCTTTTAAGAAATTTCTGGCTGG - Intergenic
1100979044 12:100150379-100150401 CATTTTAAGTAATTTGGGCCAGG - Intergenic
1101890704 12:108712274-108712296 CCTTTTAAGAAGATGGAGGCCGG + Intronic
1102683947 12:114709707-114709729 CCTTTTAAGAAATCTGGGGCTGG - Intergenic
1106264262 13:28096056-28096078 ATTTTTAAGTAGTTTTAGGCTGG + Intronic
1107490278 13:40874888-40874910 CCTTTTAAGCAGTCAGTGGCTGG - Intergenic
1107645427 13:42489891-42489913 ACTTTTAAATAGTTTGTGTGGGG - Intergenic
1107808453 13:44176515-44176537 CCTTCTCAGTAGTTTGTTGTTGG - Intergenic
1107912366 13:45117532-45117554 CCTATTAAGCAGGTTGGGGCTGG + Intergenic
1108749337 13:53431283-53431305 CCTTTTTAGTAGCTTGGGACAGG - Intergenic
1113157288 13:107338288-107338310 CCTTTTACGTGGTTGGTGCCTGG + Intronic
1114232834 14:20799711-20799733 CCTTTTAAGCATTTTGAGGCAGG - Intergenic
1114242127 14:20877727-20877749 CCTCTTAGGTTTTTTGTGGCTGG + Intergenic
1114248997 14:20941343-20941365 CCTTTTAGGTTTTTTGTGGCTGG + Intergenic
1115096842 14:29647870-29647892 CCTTTTAAGCAGTTTATGGTGGG + Intronic
1115097191 14:29650653-29650675 CCTTTTAAGCAGTTTTTGGCAGG + Intronic
1115272056 14:31563627-31563649 ATTTTGAAGTAGTTTGAGGCAGG - Intronic
1115286060 14:31713592-31713614 CCTTTTAAGTGGCATGTGGATGG + Intronic
1115887412 14:37988448-37988470 CCTTTTAAGAATTTTGAGGCTGG + Intronic
1119504306 14:75158621-75158643 CCTCTGAAGTACTTTTTGGCTGG - Intronic
1120566303 14:86062575-86062597 CCTTTTAGGAAGTTTGCGGAAGG + Intergenic
1121321397 14:92993762-92993784 CTTTTTAAGCACTTTGGGGCAGG - Intronic
1124879825 15:33631649-33631671 CCTTGTAAGTCCTTTGTGGAAGG + Intronic
1128019037 15:64374243-64374265 CTTCTTAAAAAGTTTGTGGCCGG + Intronic
1128121048 15:65146818-65146840 CCTTTTAAATTGTTGGGGGCAGG - Intergenic
1128981674 15:72192750-72192772 ATTTTTAAGCAGTTTTTGGCTGG - Intronic
1129604728 15:77019312-77019334 CCTTTCAAGAAGTTGGAGGCCGG - Intronic
1129749498 15:78051139-78051161 CATGATAAGCAGTTTGTGGCTGG - Intronic
1130153595 15:81331182-81331204 CCTTTTAAGCAGTCGGTGGCCGG + Intergenic
1131527273 15:93162466-93162488 CCTTTTAAGTAGTCGGTGGCCGG + Intergenic
1131534290 15:93221690-93221712 CCTTTTAAGCAGTCGGTGGCTGG + Intergenic
1135227483 16:20674456-20674478 CCTTTTAAGCATTTTGGGGGTGG - Intronic
1135541870 16:23336228-23336250 CCTTTTAAGTATGTTGGGGTGGG - Intronic
1139667392 16:68467211-68467233 CCTTTCAAGAAGTTTGTGAGGGG - Intergenic
1147188875 17:38727485-38727507 TCTTTTCAGTGGTTTGGGGCAGG - Exonic
1148676714 17:49449859-49449881 CCTTTGAAGAAGTTTCTGGAAGG - Intronic
1149289634 17:55204996-55205018 CCTTTTTAGTAGTTCTTAGCAGG + Intergenic
1150822760 17:68448919-68448941 CCTTTTAAGTAGGGAGTAGCAGG - Intronic
1150886599 17:69093568-69093590 ACTTTTAAGCATTTTGGGGCGGG - Intronic
1155358708 18:24979360-24979382 CCATTGAAGTAGGTTTTGGCTGG - Intergenic
1155558023 18:27043267-27043289 CCTTTTAAGTAATTGGTTCCTGG - Intronic
1156772587 18:40747656-40747678 ACTTTTTAGAAGTTTGTGGGTGG + Intergenic
1159610483 18:70519776-70519798 TCTTTTAAGTTTTTGGTGGCTGG + Intergenic
1162251485 19:9447868-9447890 CATTTTATGTAGTATCTGGCAGG - Intergenic
1164545214 19:29154971-29154993 TCTTTTAAGTGGTTTGTGAGAGG - Intergenic
1166138477 19:40791927-40791949 CCTGTCAAGAAGTTTGGGGCCGG - Intronic
1166319936 19:42011254-42011276 ACTTGAAAGTATTTTGTGGCTGG + Intronic
926226958 2:10973583-10973605 CCTTTTAAGGAGTTTCTGGGAGG - Intergenic
926553636 2:14331181-14331203 CCTTGTAAGAACTTTGGGGCAGG - Intergenic
926999425 2:18777408-18777430 GCTTTTAAGTGGTTTGAGGCTGG - Intergenic
929026180 2:37604750-37604772 CATCCTATGTAGTTTGTGGCTGG - Intergenic
929437282 2:41938455-41938477 CCTTTCAAGTCGTTTGTGTGAGG - Exonic
933206674 2:79514064-79514086 CCTTTGAAGTAGGTAGTGACAGG - Intronic
935808842 2:106775470-106775492 CCTTCTAAATAGTGTGTGGCTGG + Intergenic
936384566 2:112017413-112017435 CCTTTCAAGGAGTTTGAGACTGG + Intronic
936443298 2:112574994-112575016 CATTTTAAGCAGATTGTGGCCGG + Exonic
941826936 2:169909132-169909154 CCTTTTAAGGAATTTGTGGCTGG + Intronic
942563682 2:177246162-177246184 CCTGTTAAGTCGTATGGGGCAGG - Intronic
942771586 2:179527111-179527133 GCTTTTAAGTATTTTGAGGCTGG + Intronic
944214103 2:197236697-197236719 TTTTTTGAGTAGTTTGTTGCAGG - Intronic
945208774 2:207360428-207360450 CCTCTGATGAAGTTTGTGGCGGG - Intergenic
947096215 2:226570148-226570170 CCTTTTAATTCCTTTGTGGAAGG + Intergenic
947691933 2:232146349-232146371 CTTTTTAAATAGTTTGTAGTAGG + Intronic
948448185 2:238050086-238050108 CATTTTAAGAAGTTCTTGGCTGG - Intronic
1169482208 20:5994373-5994395 CCTTTTACATAGTTTGAAGCTGG - Exonic
1170495716 20:16923020-16923042 CCTCTCAAGTAGTTTGAGGCTGG + Intergenic
1171101524 20:22388302-22388324 CCTTTTAAGTTGCTTGGGGATGG + Intergenic
1174042785 20:47711598-47711620 CCTTTAATGTAGTGTGTGGGTGG - Intronic
1176874548 21:14115381-14115403 CCTTTTAAGCTGTCAGTGGCCGG - Intronic
1178775784 21:35549048-35549070 CCCATTAAGTAGTTTGTGGGTGG + Intronic
949587583 3:5456967-5456989 GCTTTTAAGAAAATTGTGGCTGG - Intergenic
949729619 3:7093377-7093399 CCATAAAAGTAGTTAGTGGCCGG + Intronic
952415771 3:33090605-33090627 CCTTTTTGTTTGTTTGTGGCCGG - Exonic
953559313 3:43972252-43972274 CATTTCAAGTTGTTTGTTGCTGG + Intergenic
955809677 3:62774219-62774241 CCTTTTAAGAGCTTTGTGGCCGG - Intronic
957469518 3:80640209-80640231 CATTTTAACTATTTTGTGGCTGG - Intergenic
958984051 3:100759824-100759846 CATTTTATTTAGTTTGTGGTAGG - Intronic
959255300 3:104003365-104003387 CATTTTCAGTACTATGTGGCTGG - Intergenic
960079363 3:113524900-113524922 CCTTTACAGAAGTTTGTGGGTGG + Intergenic
962856648 3:139352164-139352186 CATATTAAGTACTTTTTGGCAGG - Intronic
963459377 3:145588827-145588849 CTTTTTAAATAGTTTGTTGAGGG - Intergenic
963674483 3:148291987-148292009 CATTATAAGTCGTATGTGGCAGG + Intergenic
963792602 3:149599590-149599612 CCATTTAAGTAGTTTGAGACTGG - Intronic
963820289 3:149884215-149884237 CCTTTTAATTTTGTTGTGGCTGG + Intronic
965299903 3:166996362-166996384 CCTGTTAAACAGTTTGTGTCAGG + Intergenic
965773247 3:172202853-172202875 CCTTTTTAATAGTTTGCTGCGGG + Intronic
966061277 3:175759650-175759672 CCTATAAAGTCTTTTGTGGCTGG - Intronic
967328791 3:188269374-188269396 CCTTTTAAGTATTACCTGGCTGG + Intronic
970093994 4:12441993-12442015 ACTTTTAAGTACTTTGCTGCTGG + Intergenic
971359692 4:25925542-25925564 GCTTTTAAGTATTTATTGGCAGG + Intronic
976733799 4:88289945-88289967 CCTTTGATGTAGTTTGTTACTGG + Intergenic
978634519 4:110788509-110788531 TCTTTTAAGTAGTTATTTGCAGG + Intergenic
979556973 4:122059037-122059059 CCCTGTAAATAGCTTGTGGCTGG - Intergenic
980099653 4:128528972-128528994 CCTCTAAGGTAGCTTGTGGCTGG - Intergenic
980114581 4:128666932-128666954 CTCTTTAATTAGTTTGGGGCTGG - Intergenic
980822035 4:138029873-138029895 CCTTTTAAATAATTTATGGTGGG + Intergenic
981795982 4:148596117-148596139 CATTTAAAGTAGTGTGTGGAGGG - Intergenic
983142253 4:164165611-164165633 TCTATTAAGTAGTTGGTGCCTGG + Intronic
987102713 5:14606179-14606201 CATTTTATGTGGTTGGTGGCAGG + Intronic
988414329 5:30927081-30927103 TCTTTTAAGTAATATTTGGCAGG - Intergenic
988827915 5:34958253-34958275 CAGTTAAAGTAGTGTGTGGCTGG + Exonic
990996148 5:61734158-61734180 CCCTTTAGGTAGCCTGTGGCAGG + Intronic
993824049 5:92659252-92659274 CCTTTAAATTAGTGTGTGCCAGG - Intergenic
993979459 5:94527388-94527410 CCTTTTAACTATTTTATGACTGG - Intronic
994626915 5:102231724-102231746 CCTTTTAAGGACTTTGCAGCTGG + Intergenic
996046589 5:118881105-118881127 CATGTTAAGTATTTTGTTGCAGG - Intronic
1006932303 6:37695755-37695777 CCTTTTTAGTGATGTGTGGCTGG - Intronic
1009520979 6:64681782-64681804 CCTTTTAAGCTGTTTGTGGCGGG + Intronic
1009529322 6:64789938-64789960 CGTTATAACTAGTTTGTGGTGGG + Intronic
1014405637 6:121047145-121047167 CCTTTTAAGTAGAAAGGGGCAGG + Intergenic
1015207156 6:130652793-130652815 CCATTTAAGATCTTTGTGGCTGG - Intergenic
1015248575 6:131103251-131103273 ACTCTTAAGTAATTTGGGGCTGG - Intergenic
1015764084 6:136697642-136697664 CATTTTAAGTGGTTTTTTGCAGG - Intronic
1016972705 6:149779339-149779361 CCTTTTAAGCAGTTTGTGGCAGG - Intronic
1017280719 6:152621442-152621464 CCTTTGATATAGTGTGTGGCAGG - Intronic
1021981641 7:26061175-26061197 CCTTTAGAGTAGATTCTGGCAGG - Intergenic
1022352484 7:29578910-29578932 CCATACAAGAAGTTTGTGGCAGG + Intergenic
1025781510 7:64605928-64605950 CCTTTTAAGTATTTTGAGGCGGG + Intergenic
1026459351 7:70599789-70599811 CCTTCTAAGTTGTCTGTGGTGGG + Intronic
1028509451 7:91607741-91607763 CCTGTTAAGGAGTTGGTTGCTGG - Intergenic
1028557075 7:92135840-92135862 CCTTTTAAGCAGTTTGTGTTGGG - Intronic
1029328746 7:99833304-99833326 CCTTTTAAGCATTTCGTGGGAGG + Intronic
1030076054 7:105737824-105737846 ACTTTTAAGAATTTTGTGGCTGG + Intronic
1032783303 7:135181848-135181870 TCTTTTAAGCATTTTGAGGCAGG - Intergenic
1034870214 7:154676781-154676803 CCTTTTAAGCATTTTGAGGCAGG + Intronic
1036961186 8:13245996-13246018 ATTTTAAAATAGTTTGTGGCTGG - Intronic
1037079781 8:14769817-14769839 CCATTGAAGTATTTTGTTGCTGG - Intronic
1037960823 8:23096758-23096780 CCTTTTAAGCAGTTTGTGGCAGG + Intronic
1040060964 8:43102483-43102505 CCTGTTTGGTACTTTGTGGCAGG + Exonic
1041340074 8:56835630-56835652 CATTTAAAGAAGTTTGTGGGGGG - Intergenic
1041623031 8:59995495-59995517 ATTTTTCAGTAGTTTGTGGAAGG - Intergenic
1043237344 8:77884702-77884724 TCTTTAAAGTAGTCTGTGGTAGG + Intergenic
1045462163 8:102434603-102434625 CATTTAAAGAAGTTTGTAGCAGG - Intergenic
1046038054 8:108867856-108867878 CTTTTTAGGAAGCTTGTGGCTGG - Intergenic
1046186745 8:110731792-110731814 CCTTTTAAGAAGTTTGGGATGGG - Intergenic
1047127357 8:121977079-121977101 CATTTTAAGTAGTACATGGCAGG + Intergenic
1048713720 8:137243352-137243374 CATTTAAAGTAGTTTGTAGCGGG + Intergenic
1052427227 9:28321367-28321389 TCTTTTATGTAGTTTCTGCCTGG - Intronic
1054996016 9:71390545-71390567 TCTTTTAGGTAGTTTATAGCTGG + Intronic
1056979987 9:91300756-91300778 TGTTTTAAGTAGTTTGGGGCTGG - Intronic
1059982474 9:119788206-119788228 CCATTTAAATAATTTGTGGAAGG - Intergenic
1185874459 X:3691135-3691157 CCTTTTAAGCAGTTTGTGGCGGG + Intronic
1186520755 X:10204796-10204818 CCTTTTTAGGGGTTTGCGGCTGG + Intronic
1187652717 X:21427057-21427079 CCTTTTAAGTAGGTTTAGGTCGG - Intronic
1189053493 X:37672228-37672250 CCCATTAAGTATTTTCTGGCAGG + Intronic
1190428060 X:50351034-50351056 CCATCCCAGTAGTTTGTGGCTGG + Intronic
1190650959 X:52568302-52568324 CCTTTTAAGTAGTTTGTGGCGGG + Intergenic
1190652261 X:52578467-52578489 CCTTTTAAGTAGTTTGTGGCGGG + Intergenic
1191673246 X:63768793-63768815 CATTTTAAGTGGATGGTGGCAGG - Intronic
1195861351 X:109386667-109386689 CCTTTTAAGTACTTTGTGCTTGG - Intronic
1197329159 X:125132586-125132608 CTTTTTGAGTAGTTGGTGTCTGG + Intergenic
1197712600 X:129682572-129682594 TCCTCTAAGTAGTCTGTGGCTGG - Intergenic
1198257977 X:134941695-134941717 CCTTTTAAAAAGTTATTGGCTGG + Intergenic
1200425696 Y:3018325-3018347 TCCTTTAAGTAGTCTGTGGTAGG - Intergenic
1200757398 Y:7002690-7002712 CCCTTTAAGTATCTTGAGGCAGG + Intronic
1200915616 Y:8568738-8568760 CCTTTTAATTGGGTTGTTGCTGG + Intergenic
1201539149 Y:15087362-15087384 CCTTTTAAGCAGTTAATGGTGGG + Intergenic
1201574436 Y:15446901-15446923 CCTTTTCAGCAGTGTCTGGCAGG - Intergenic
1202051885 Y:20789915-20789937 CCTTTTAAGCATTTTGAGGCAGG + Intergenic