ID: 1190650998

View in Genome Browser
Species Human (GRCh38)
Location X:52568689-52568711
Sequence ATGTATGGCAAGCACCAAAG TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 163
Summary {0: 1, 1: 0, 2: 1, 3: 13, 4: 148}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1190650998_1190651000 -8 Left 1190650998 X:52568689-52568711 CCACTTTGGTGCTTGCCATACAT 0: 1
1: 0
2: 1
3: 13
4: 148
Right 1190651000 X:52568704-52568726 CCATACATGCAGATTAATAAAGG 0: 1
1: 0
2: 2
3: 13
4: 157
1190650998_1190651001 -7 Left 1190650998 X:52568689-52568711 CCACTTTGGTGCTTGCCATACAT 0: 1
1: 0
2: 1
3: 13
4: 148
Right 1190651001 X:52568705-52568727 CATACATGCAGATTAATAAAGGG 0: 1
1: 0
2: 0
3: 29
4: 328
1190650998_1190651003 18 Left 1190650998 X:52568689-52568711 CCACTTTGGTGCTTGCCATACAT 0: 1
1: 0
2: 1
3: 13
4: 148
Right 1190651003 X:52568730-52568752 CCACAGTCGTTTATGTCTTCCGG 0: 1
1: 1
2: 0
3: 7
4: 72
1190650998_1190651004 24 Left 1190650998 X:52568689-52568711 CCACTTTGGTGCTTGCCATACAT 0: 1
1: 0
2: 1
3: 13
4: 148
Right 1190651004 X:52568736-52568758 TCGTTTATGTCTTCCGGTGTAGG 0: 1
1: 0
2: 2
3: 3
4: 45

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1190650998 Original CRISPR ATGTATGGCAAGCACCAAAG TGG (reversed) Intergenic
900559710 1:3297879-3297901 CTGTATGGCAAGCTCCGCAGGGG + Intronic
900559716 1:3297907-3297929 CTGCATGGCAAGCTCCACAGGGG + Intronic
903303601 1:22396531-22396553 ATGTATGGGGAGCAGCAAGGGGG - Intergenic
906456268 1:45999973-45999995 AATTATGACAAGCACCATAGAGG + Intronic
908297522 1:62727908-62727930 AGGACAGGCAAGCACCAAAGTGG + Intergenic
910348097 1:86264050-86264072 ATGCATGGGCAGCACCAAAAAGG - Intergenic
910938186 1:92504432-92504454 AAGTACAGCAAGCACCAACGGGG + Intergenic
912468402 1:109889884-109889906 ATGTATGGCAGGCAGCACTGAGG + Intergenic
912639371 1:111330615-111330637 ATCTATGGCCAGCACTGAAGTGG - Intergenic
912648608 1:111418499-111418521 TTGTGTGGGAAGCACCAGAGAGG - Intronic
915102439 1:153510005-153510027 GTGTTTGCCAAGCACCAAAGTGG - Intergenic
916215264 1:162388393-162388415 ATGCAGTGGAAGCACCAAAGTGG + Intergenic
917255159 1:173108024-173108046 TTGTTAGGCAAGCAGCAAAGAGG + Intergenic
918679679 1:187336792-187336814 ATGTATAGCAAGCACACAAGGGG - Intergenic
922198274 1:223378889-223378911 ATATAGGCCAAGCCCCAAAGTGG + Intergenic
1072445069 10:95492146-95492168 ATGTATGGCAAGCATTTTAGTGG - Intronic
1072638021 10:97189768-97189790 ATGTATGATAAGCACCCCAGGGG - Intronic
1075781838 10:125022281-125022303 ATGTATAGCAGGCACCAAGATGG - Intronic
1078409896 11:11105873-11105895 AAGGAAGGCAAGCCCCAAAGTGG - Intergenic
1078532183 11:12145294-12145316 GTTTATGCCAAACACCAAAGGGG - Intronic
1079982498 11:27165925-27165947 ATTTAAGGCAAGCACCATAGAGG - Intergenic
1080756857 11:35208879-35208901 ATGTGTGGCAAGCAGTAAAATGG - Intronic
1082960906 11:58917997-58918019 ATTTATAGGAAGCATCAAAGGGG - Intronic
1084871626 11:72102594-72102616 TTGTCTGGGAAGCAACAAAGAGG - Intronic
1085835083 11:79946729-79946751 ATGAATGGCAAGCTACAAACAGG + Intergenic
1087760791 11:102102413-102102435 AGGTGTGGCATGCACCAAATAGG - Intergenic
1091831755 12:3555010-3555032 AAGTAGGTCAAGCACCAGAGAGG - Intronic
1092819382 12:12339099-12339121 AGGGCCGGCAAGCACCAAAGAGG + Intronic
1096948673 12:55440457-55440479 ATGTTTTGCATGCAGCAAAGAGG - Intergenic
1097660591 12:62426340-62426362 TTTTATGGCAAGCCACAAAGAGG - Intergenic
1100851067 12:98712110-98712132 ATGTATTTGAACCACCAAAGTGG + Intronic
1104118813 12:125778009-125778031 ATGTATGGGATGCAACTAAGTGG + Intergenic
1104485734 12:129149975-129149997 ATGTATGCCCAGCAACAGAGGGG + Intronic
1107374621 13:39788627-39788649 ATGTATGCAAAGCACTAAAATGG + Intronic
1108701105 13:52945049-52945071 ATGGATGGAAAGGAGCAAAGGGG + Intergenic
1112953351 13:105030008-105030030 ATGGAGGGCAAGCATCAAAGTGG - Intergenic
1115126775 14:30004699-30004721 ATCTATGGTAAGAAACAAAGAGG - Intronic
1115576917 14:34720308-34720330 ATGTCTTGTGAGCACCAAAGAGG + Intergenic
1115794150 14:36913799-36913821 ATGAATGGTAAGCACCACATGGG + Intronic
1117015969 14:51517245-51517267 ATGTATGGAAATAACCAAACCGG - Intronic
1117189416 14:53275857-53275879 GTGGATGGCAATCACCAAGGAGG - Intergenic
1118528926 14:66679434-66679456 AAGTATGGCAAACACCACACTGG - Intronic
1118951048 14:70437056-70437078 ATTTATAGGAAGCACCAAAGCGG - Intergenic
1119589210 14:75869518-75869540 CCATATGTCAAGCACCAAAGTGG + Intronic
1120105042 14:80484340-80484362 ATGCATGGCAAATATCAAAGTGG + Intronic
1121612284 14:95289781-95289803 ATGAATGGCCAGCTCCTAAGAGG - Intronic
1121737101 14:96226149-96226171 ATGAATGGCATGCAGGAAAGTGG + Intronic
1122251312 14:100441764-100441786 CTGTATGCCAAGCACCAATCAGG - Intronic
1127925021 15:63530810-63530832 CTGTAAGGCAAACACCATAGGGG + Intronic
1128496126 15:68199639-68199661 CTGTATGACAAGCAGCAGAGGGG - Exonic
1133708163 16:8375486-8375508 AAGTAAGCCAAGCCCCAAAGAGG + Intergenic
1134892114 16:17850493-17850515 ATGTATGGCAAGGAAGAAAGGGG - Intergenic
1137790521 16:51171033-51171055 ATGAAAGGCAAGCCCCAAATTGG + Intergenic
1140044993 16:71434528-71434550 CTCTATGGCAAGCACCAGGGTGG + Intergenic
1143928693 17:10397473-10397495 CTGTATGGAAAGATCCAAAGTGG + Intronic
1145353298 17:22109669-22109691 ATGTCTGGCTTGCACGAAAGAGG - Intergenic
1146578274 17:34013417-34013439 ATGTATGGCAAATTGCAAAGGGG - Intronic
1149073571 17:52573089-52573111 ATGCATGGCTAGCTCAAAAGTGG - Intergenic
1153084314 18:1266194-1266216 TTGTATCACAAGCAACAAAGAGG + Intergenic
1155857987 18:30858858-30858880 ATGTATGTGAAGAAGCAAAGGGG + Intergenic
1157094208 18:44672523-44672545 ATGTATGAAAAGCACCTATGTGG - Intergenic
1157542860 18:48524581-48524603 ATGGATGGCAGACACCAAGGAGG - Intergenic
1157626952 18:49058928-49058950 ATGTATGCTCAGCACAAAAGGGG + Intronic
1159019637 18:63132827-63132849 ATGTATTAAAAGCAACAAAGAGG + Intronic
1164740398 19:30571598-30571620 ATGTAGGGCCAGCACCAAGAAGG - Intronic
925201695 2:1972242-1972264 ATGTATTCCACGCACCCAAGTGG + Intronic
928521600 2:32094507-32094529 ATGTTTGTGAAGCAGCAAAGAGG + Intronic
928854710 2:35789911-35789933 ATGTATGGTGATCACCAAGGAGG + Intergenic
932619993 2:73259598-73259620 ATGAATGGCAAGGAACAGAGTGG + Intronic
935028602 2:99301261-99301283 AGGTATGGCAAGAAACAAATTGG - Intronic
935029385 2:99307246-99307268 AGGTATGGCAAGAAACAAATTGG + Intronic
937558399 2:123189572-123189594 ATCTATGGCAACCACCAATCAGG - Intergenic
938684915 2:133728933-133728955 GTGCATGGTAAGCACCAAAAGGG - Intergenic
941031154 2:160513006-160513028 ATGTATGGAAAGGACTAAGGTGG - Intergenic
942420188 2:175798964-175798986 TGGTAAGGCAAGCCCCAAAGTGG - Intergenic
944391875 2:199226706-199226728 ATGGATGGTAATCACCAAAGAGG - Intergenic
945874457 2:215263872-215263894 ATATGTGCCAAGCACCAAAAAGG - Intergenic
946569691 2:221010157-221010179 AATCATCGCAAGCACCAAAGGGG - Intergenic
947996476 2:234531858-234531880 ATATCTGGCACACACCAAAGGGG + Intergenic
1169009697 20:2239885-2239907 GTGTATGGTAAGGACAAAAGGGG - Intergenic
1169822405 20:9726870-9726892 ATGTATGCTAGACACCAAAGAGG + Intronic
1171563545 20:26153857-26153879 ATGTCTGGCTTGCACAAAAGAGG - Intergenic
1175252172 20:57616374-57616396 AGGAATGCCAAGCACCCAAGAGG - Exonic
1175623661 20:60472704-60472726 CTGTAGTGCCAGCACCAAAGGGG - Intergenic
1175860371 20:62147278-62147300 CTCTGTGGCAAGCACCACAGAGG + Intronic
1175860425 20:62147504-62147526 CTGCATGCCAAGCAGCAAAGAGG - Intronic
1176875644 21:14124285-14124307 ATTTATAGCGAGCACCAAAGGGG + Intronic
1177249765 21:18577709-18577731 ATGTTTGGCTAGCACCAATGTGG + Intergenic
1177399987 21:20591504-20591526 AGGTATGACAAACTCCAAAGAGG - Intergenic
1178607386 21:34051626-34051648 ATTTATGGCAACCCCAAAAGTGG - Intergenic
1179375352 21:40846127-40846149 ATGTATCTCCAGCACCAAGGAGG - Intronic
1182163748 22:28150860-28150882 AGGTAGGGTGAGCACCAAAGTGG + Intronic
953455117 3:43034835-43034857 GAGTATGGCAACCTCCAAAGGGG - Intronic
953638842 3:44686485-44686507 AAGTCAGGCAAGCCCCAAAGTGG - Intergenic
956738845 3:72259269-72259291 ACACATGGCAAGCACCAAATTGG + Intergenic
958673846 3:97240069-97240091 ATGAATGGCAATCACAAAACTGG - Intronic
959207464 3:103328915-103328937 ATGTGTGTAAAGCACCAGAGAGG - Intergenic
960329515 3:116341445-116341467 ATGTATGGCAGGCACCTTTGAGG + Intronic
962123883 3:132593828-132593850 ATTTATGGTAAGCAGCAAAATGG + Intronic
962422713 3:135242163-135242185 ATGTATGCAAAACACAAAAGAGG - Intronic
962857438 3:139360684-139360706 ATTTATGGCAAGAACAAAAGGGG - Intronic
963673917 3:148284781-148284803 ATGTATAAGAAGCTCCAAAGTGG + Intergenic
963932951 3:151023296-151023318 ATGTATGGTAAGGACAAAAGGGG + Intergenic
967565832 3:190971139-190971161 GTCTAGGGCAAGCACCAGAGAGG + Intergenic
968167404 3:196478425-196478447 ATGTATGGAAAGCAGAAATGAGG - Intronic
969030623 4:4210109-4210131 ATCTATGGCACACACCATAGGGG - Intronic
971987946 4:33851057-33851079 ATGTCTGGCTTGCACGAAAGAGG + Intergenic
974482455 4:62463532-62463554 ATGTATGGTATTCATCAAAGTGG + Intergenic
975058707 4:69969868-69969890 ATGAATAGCAATCACTAAAGAGG - Intergenic
977210892 4:94216308-94216330 TTCTATGGCAAACAACAAAGGGG - Intronic
977481750 4:97587010-97587032 ATGTATGGCAATTATCAAAGTGG + Intronic
978953363 4:114588707-114588729 ATTTGTGTCAAGCACCAAAAGGG - Intergenic
980565895 4:134540133-134540155 ATGTTTTCCAAGTACCAAAGAGG - Intergenic
981295049 4:143122267-143122289 AGTTATGGCAAGTCCCAAAGGGG - Intergenic
981398980 4:144289547-144289569 ATGAATAGCAACCACAAAAGGGG + Intergenic
982144255 4:152365560-152365582 ATGCATGGCAAGTAAAAAAGAGG + Intronic
983873307 4:172847307-172847329 ATGTATTGCTAGTTCCAAAGAGG - Intronic
984209040 4:176823294-176823316 ATGTCTGGAAACTACCAAAGTGG + Intergenic
984361894 4:178744563-178744585 ATATATGGCCAACACCAAAATGG + Intergenic
984685113 4:182658553-182658575 ATGCATGGAAAACACCCAAGTGG - Intronic
985979804 5:3452896-3452918 ATGAATGACAAGCGCCACAGAGG + Intergenic
986891088 5:12306955-12306977 ATTGATGACAAGCAACAAAGAGG - Intergenic
987878627 5:23712124-23712146 ATCTATGGCCAGCACTCAAGTGG + Intergenic
989308833 5:39988892-39988914 AGGTATGGCTAGCATAAAAGTGG - Intergenic
990810330 5:59715542-59715564 ATGAATGGTGATCACCAAAGAGG + Intronic
996716534 5:126592454-126592476 ATGAATGGCAAGTACAAAAAAGG + Intronic
996958885 5:129219718-129219740 ACTTATGGCTAGCACCAAAATGG - Intergenic
1002827091 6:783698-783720 ATGCATGGCAATGACCCAAGTGG + Intergenic
1006587307 6:35124354-35124376 ATGTCTTGCAAGCACCAATAAGG + Intronic
1013866012 6:114697166-114697188 ATGTGTGCCCAGCACCAAATAGG + Intergenic
1017327094 6:153152089-153152111 ATGAGTGGCAATCACCAAGGAGG + Intergenic
1018661286 6:166089522-166089544 ATGTATGGCAAGTTTTAAAGTGG - Intergenic
1020142725 7:5621468-5621490 ATGTATTTCAAGGACTAAAGTGG - Intronic
1021549672 7:21856647-21856669 ATGTATGCCAAGAATCAAATTGG + Intronic
1021813826 7:24428450-24428472 ATGTTTTGCATACACCAAAGAGG - Intergenic
1022671931 7:32463767-32463789 AGGTATGGGAATTACCAAAGTGG - Intergenic
1023050439 7:36246454-36246476 GTATATCGTAAGCACCAAAGTGG + Intronic
1026981449 7:74529115-74529137 CTGTAGGGGAAGCACCAAGGGGG + Intronic
1028600986 7:92600278-92600300 TTGTATGGCATGTACCAAATTGG + Intergenic
1031491631 7:122396758-122396780 TTGTATGACAAGAACCACAGTGG - Intronic
1038264218 8:26024935-26024957 ATGTAAAGCAAGCACGAAATAGG + Intronic
1039509833 8:38082345-38082367 ATTTATGGCGAGCACCAAAGGGG - Intergenic
1040610721 8:48978764-48978786 ATGTATTGCATTCACCAAAATGG - Intergenic
1043358212 8:79439043-79439065 TAGTATGCCAAGCACCAAATGGG + Intergenic
1046401952 8:113715799-113715821 ATGTATGTCAAGCACCAGTATGG - Intergenic
1047372649 8:124268692-124268714 ATGTCTGTCAGGGACCAAAGGGG - Intergenic
1049125918 8:140787771-140787793 GTGTGTGGCAAGCACCAAAAGGG + Intronic
1050838405 9:10113677-10113699 AAGTTTGGCAAACACCAAATGGG + Intronic
1050900153 9:10938117-10938139 TCGAATGGCAATCACCAAAGGGG + Intergenic
1052326451 9:27220826-27220848 ATGGGTTGCAAGCACCAAACTGG + Intronic
1055588947 9:77789313-77789335 ATAAATGGCAAGCTACAAAGTGG + Intronic
1055694446 9:78868550-78868572 ATGGCTGCCAAGCAGCAAAGTGG - Intergenic
1056048710 9:82745868-82745890 AGTTATGGCAATAACCAAAGTGG + Intergenic
1056126692 9:83541559-83541581 ATCTTTGAAAAGCACCAAAGTGG + Intergenic
1058467952 9:105246942-105246964 ATGCATGTCATGCACCCAAGGGG + Intronic
1189893366 X:45628617-45628639 GTGTATGGCAGGCCCCTAAGAGG + Intergenic
1190650998 X:52568689-52568711 ATGTATGGCAAGCACCAAAGTGG - Intergenic
1192055694 X:67770464-67770486 ATCTATGGCCAGCACTTAAGTGG + Intergenic
1194736984 X:97524054-97524076 AAGTATGGTAAGGAGCAAAGAGG - Intronic
1194913925 X:99681866-99681888 ATATAAGGCAAGCAGCACAGTGG + Intergenic
1195177778 X:102327438-102327460 ACGTATGCCAAACACGAAAGTGG - Intergenic
1195181086 X:102359655-102359677 ACGTATGCCAAACACGAAAGTGG + Intergenic
1195431462 X:104794272-104794294 AAGTATGGCAAGCATTTAAGTGG + Intronic