ID: 1190653200

View in Genome Browser
Species Human (GRCh38)
Location X:52587635-52587657
Sequence CAGAATGAACTTAAGGAAGA AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 378
Summary {0: 1, 1: 0, 2: 0, 3: 26, 4: 351}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1190653198_1190653200 7 Left 1190653198 X:52587605-52587627 CCAAGAAATAAAAAAATTATAAA 0: 2
1: 0
2: 43
3: 556
4: 4470
Right 1190653200 X:52587635-52587657 CAGAATGAACTTAAGGAAGAAGG 0: 1
1: 0
2: 0
3: 26
4: 351

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1190653200 Original CRISPR CAGAATGAACTTAAGGAAGA AGG Intergenic
901750754 1:11406176-11406198 AAGAATAAACTTCAGGAAAAAGG - Intergenic
907003879 1:50891086-50891108 ATGAATGAAATTAAGCAAGAAGG - Intronic
907315106 1:53564003-53564025 AAGAATAAGCTTCAGGAAGAAGG + Intronic
907642390 1:56204092-56204114 CAGAATGACTTTAAGGATGATGG + Intergenic
909023565 1:70459098-70459120 CAGAATGAACTAGAGGAATTAGG - Intergenic
909174789 1:72343549-72343571 CTGAATGATCTTGATGAAGAAGG + Intergenic
909567807 1:77074971-77074993 TAGAATTAACTTATGTAAGAAGG - Intergenic
909937180 1:81565612-81565634 CAGCATGAAATGAAGGAAAATGG - Intronic
910401337 1:86840938-86840960 CAGAATGGACTTAGGGGAAAAGG - Intergenic
912427518 1:109607811-109607833 CAGTAAGACCTTAAGGTAGATGG - Exonic
912427765 1:109609830-109609852 CAGTAAGACCTTAAGGTAGACGG - Exonic
912806308 1:112759478-112759500 GAGAAAGAACGAAAGGAAGAAGG + Intergenic
913412186 1:118564302-118564324 CAGAAGCAGCCTAAGGAAGATGG - Intergenic
913630972 1:120709549-120709571 CAGAAGGAACATAAGGAGAATGG + Intergenic
914439376 1:147690533-147690555 CAGAATCAGCTTTAGAAAGATGG - Intergenic
915436403 1:155909969-155909991 CGTAATGAACTTAAGGTATAAGG + Intronic
915890208 1:159766272-159766294 CAGCAGGACCTTAAGGAAGTGGG + Intergenic
915917829 1:159951687-159951709 CAGAATGAAATTGAGGAAGGAGG - Exonic
916307328 1:163352431-163352453 ATGAATGAACTGAAGGAAAATGG - Intronic
916778504 1:167996193-167996215 AAGAATGAACCAAAGAAAGAAGG - Intronic
917185985 1:172356185-172356207 AAAAATGTACTTTAGGAAGAAGG + Intronic
917407834 1:174727307-174727329 CAGAAGGAACTTCAGTAAGTGGG + Intronic
918061716 1:181067262-181067284 CAGAATCAGCCTAAGGAACATGG + Intergenic
918526422 1:185469582-185469604 GAGCATGAAGATAAGGAAGAAGG + Intergenic
919654813 1:200186766-200186788 ATGAATGAAATGAAGGAAGAAGG + Intergenic
921890684 1:220350778-220350800 CTGAATTAAATTAAGGAAAAAGG + Intergenic
922273206 1:224053344-224053366 CAAGATGAATTTAAGGAAGAAGG - Intergenic
923002833 1:230021889-230021911 CAGAAAATACTTAAAGAAGAGGG + Intergenic
1063084207 10:2800376-2800398 CAGAATGACGTCAGGGAAGAAGG + Intergenic
1063297177 10:4818178-4818200 CAGGAGGAAATAAAGGAAGAGGG + Intronic
1064047267 10:12028645-12028667 CTGAAAGAACTTATGGAAAAGGG - Intronic
1064347559 10:14546733-14546755 CAGAATGAAATTAAGTAAGTTGG + Intronic
1064761806 10:18628670-18628692 CTGAATGAAATGAAGCAAGAAGG + Intronic
1065651499 10:27897172-27897194 CAGAGTGAAGTAAAGAAAGAAGG - Intronic
1066484776 10:35832900-35832922 CTGAATGAACTGAATGAAGGAGG + Intergenic
1067097072 10:43308554-43308576 CAGAATGGGCTGCAGGAAGAGGG - Intergenic
1068542579 10:58312089-58312111 TAGAAAGAATTTAAAGAAGAGGG + Intergenic
1069356358 10:67590707-67590729 CAAAATGAACAAAAGGAAAATGG - Intronic
1070219639 10:74427064-74427086 AAGAAAGAAATGAAGGAAGAAGG + Intronic
1070544310 10:77440683-77440705 CAGAATGAGCTCACGGTAGAGGG - Intronic
1071867757 10:89755494-89755516 CAGGATGAAGAAAAGGAAGAAGG - Intronic
1072064563 10:91853412-91853434 TTGAATGAACATAAAGAAGATGG - Intronic
1074511710 10:114118509-114118531 CAAAAGGAACTTGAGGAGGAGGG - Intergenic
1074543079 10:114382350-114382372 CAGCCTTGACTTAAGGAAGAAGG + Intronic
1075382877 10:122033104-122033126 CAGAATGACGTTATGCAAGACGG - Intronic
1075696113 10:124436729-124436751 CAGAATGAGATGAAGGAAGGAGG - Intergenic
1077524298 11:3055079-3055101 CTGAGTCAACTTAGGGAAGATGG + Intronic
1078415574 11:11162096-11162118 CAGAAGGCACTCCAGGAAGATGG - Intergenic
1078753802 11:14189702-14189724 CTACATAAACTTAAGGAAGAGGG + Intronic
1078875655 11:15393110-15393132 AAGAATAAACTTCTGGAAGAAGG + Intergenic
1079014195 11:16855005-16855027 CAGACTGAACTTTAGCAACAGGG + Intronic
1079613179 11:22458161-22458183 CAGAAAGAAGTGAAGGAAGGAGG - Intergenic
1080333476 11:31169825-31169847 AAGAAAGAACTTCAGGGAGAAGG + Intronic
1080580152 11:33635650-33635672 TAGAATGGGCTTAACGAAGAGGG - Intronic
1081266947 11:41036216-41036238 CAGAATGAATTTAAGAATGAAGG - Intronic
1081307880 11:41535639-41535661 CAAAATGTACTTAAGCAAGTGGG - Intergenic
1081751420 11:45513860-45513882 CAGAAGGAAGTGAAGGCAGAGGG + Intergenic
1082138108 11:48574279-48574301 AAGAATGATCTCTAGGAAGAAGG - Intergenic
1082183212 11:49145411-49145433 CACCATGAACTTCAGGAAGTGGG - Intergenic
1086017823 11:82188347-82188369 CTGACTGAACTTCAGAAAGAAGG - Intergenic
1086077814 11:82873243-82873265 CAGAAAGATCTCAATGAAGAAGG + Intronic
1086683150 11:89699921-89699943 CACCATGAACTTCAGGAAGTGGG + Intergenic
1086699360 11:89882545-89882567 CACCATGAACTTCAGGAAGTGGG - Intergenic
1086706811 11:89961969-89961991 CACCATGAACTTCAGGAAGTGGG + Intergenic
1087759143 11:102087128-102087150 CAAAAGTAACTTAAAGAAGAGGG + Intergenic
1088731004 11:112683276-112683298 ATGAATGAAATGAAGGAAGAAGG - Intergenic
1090029718 11:123196114-123196136 CAGAAAGAACATAAGGCAGAGGG + Intergenic
1090109003 11:123884566-123884588 CAGGATTAAGTTAAGGAGGAAGG + Exonic
1090234197 11:125134388-125134410 AAGAATAAACTTAAAGAAGGTGG - Intergenic
1091189221 11:133676080-133676102 CCAAATGAACTGAAGGAACATGG + Intergenic
1091629344 12:2147616-2147638 CAGAACTAACTGGAGGAAGAGGG + Intronic
1093145987 12:15567464-15567486 AAGAATGGACATAAGGGAGAAGG - Intronic
1094585687 12:31775431-31775453 AAGAAAAAACTTAAGCAAGAGGG - Intergenic
1095613425 12:44159798-44159820 CAGAATGAACTTAATTCAGATGG + Intronic
1096753105 12:53775823-53775845 CACAATGACCTTCAGGATGAAGG + Intergenic
1096896958 12:54830665-54830687 CAGAATGAACAGAGGGATGAAGG - Intronic
1097461403 12:59867731-59867753 CAGCCTGAACTCCAGGAAGAGGG - Intergenic
1099100295 12:78431556-78431578 CAGAATGAACTGATGGAAATGGG - Intergenic
1100296813 12:93270398-93270420 GGGAATGAACTTAACCAAGAAGG + Intergenic
1101192222 12:102346845-102346867 CTGAATGAAGTTAAAGTAGAGGG + Intergenic
1101703414 12:107197024-107197046 CAGAAGGACTTTTAGGAAGAGGG - Intergenic
1101932009 12:109022320-109022342 TACAAGGAACTAAAGGAAGAAGG + Intergenic
1104221751 12:126791252-126791274 CTGAATAAACTTCAGGCAGATGG + Intergenic
1105581957 13:21706439-21706461 CATAATGAAATTAAGGAAGGAGG - Intergenic
1106762982 13:32885233-32885255 CAGAATGACCTGAATGAAAATGG + Intergenic
1108707597 13:53003632-53003654 CAGAGTGAACTTAATCGAGAAGG - Intergenic
1109051304 13:57485317-57485339 TGGAATAAACTTAAGTAAGAAGG + Intergenic
1109318805 13:60784166-60784188 AAGAATAAACTTAACCAAGAAGG - Intergenic
1110018260 13:70436242-70436264 CAAAATAAACTTAAAGCAGAAGG + Intergenic
1110928322 13:81183669-81183691 CAAAATGACCATAAGGAAGTAGG - Intergenic
1111419371 13:87991259-87991281 CAGAATTAAGTTAAGGTATAAGG + Intergenic
1112595050 13:100800135-100800157 CAGCAAGAACTTAAGGATGATGG - Intergenic
1113072694 13:106436834-106436856 CAGAATGCATGGAAGGAAGATGG + Intergenic
1114488574 14:23080586-23080608 CTGAAAGAGTTTAAGGAAGAAGG - Exonic
1114553724 14:23549633-23549655 TAGAATGAACTGAAGGATGGGGG + Intronic
1114939967 14:27596742-27596764 CAGTATTAACTTAAGCAAAATGG + Intergenic
1114966685 14:27970097-27970119 AATAATGAAATTAAGGCAGAAGG + Intergenic
1115520920 14:34232111-34232133 CAGAATGGCAGTAAGGAAGAAGG + Intronic
1116173310 14:41430523-41430545 CAAAAGGAACGTTAGGAAGAAGG - Intergenic
1116785281 14:49281247-49281269 TAGAAAGAAATTAAGGAAGGAGG + Intergenic
1120068813 14:80079144-80079166 GAAAATGAAATTAAGGAATATGG - Intergenic
1120284904 14:82487399-82487421 CAGAATGACCTTTAGGAAAGAGG + Intergenic
1120745649 14:88148650-88148672 AAGAATGCACTAAAGAAAGAGGG - Intergenic
1120908258 14:89640395-89640417 CGGAAGGAATTTAAGGAGGAGGG + Intronic
1121233812 14:92377864-92377886 CTGAATGAAGGTGAGGAAGAAGG + Intronic
1121281730 14:92703926-92703948 CAGAATGATTTTATTGAAGAGGG - Exonic
1122367758 14:101204755-101204777 AAGAATGAACTTAACCAAGGAGG - Intergenic
1124044157 15:26132679-26132701 CAGAATAAAGTTAATAAAGAAGG + Intergenic
1125106165 15:35973993-35974015 CAGATTGAAGTTAAGGAGGGAGG - Intergenic
1125602777 15:40924628-40924650 CAGAAGGAAATGAAGGAAAAAGG - Intergenic
1125856209 15:42952229-42952251 CATGATGAACTTAAGGAATCTGG - Intronic
1126005586 15:44253298-44253320 GAGAATGAAATGAAGCAAGAAGG + Intergenic
1126337555 15:47603592-47603614 CACAATGAAATTAAGTAAAATGG - Intronic
1126446530 15:48752202-48752224 CAAAATGAAATCTAGGAAGAGGG + Intronic
1128592666 15:68915334-68915356 AAGAAATAACTTAGGGAAGAAGG - Intronic
1129661935 15:77557656-77557678 CAGGAGGTACTCAAGGAAGAGGG - Intergenic
1130870978 15:87972104-87972126 CAGAATGAACTTGAGGGCAAGGG + Intronic
1133958295 16:10467130-10467152 CAGAGTGAACTAGAGGTAGAAGG - Intronic
1134325613 16:13204886-13204908 AAGAATGAACTGAAGGAACCAGG - Intronic
1135492486 16:22921986-22922008 CAGCAAGAACTTCATGAAGAAGG + Intergenic
1135639343 16:24107551-24107573 CAGAACCAACGTGAGGAAGATGG - Intronic
1138510650 16:57506869-57506891 CACAATGATCTGAAGGGAGAGGG + Intergenic
1138780546 16:59779681-59779703 CAGAAAGAAATAAAGGAATAGGG - Intergenic
1138806165 16:60091388-60091410 TAGAATAAACTTTAAGAAGAAGG - Intergenic
1140891011 16:79285313-79285335 CAGAATGGACCTAAGGAAAGCGG - Intergenic
1141212728 16:81996228-81996250 GAGAATGGACTGAAGGAAGGAGG + Exonic
1143520446 17:7441363-7441385 GAGAATGAAAGGAAGGAAGAGGG - Intronic
1143927803 17:10388567-10388589 AAGAATGAACTTATAAAAGAGGG - Intergenic
1147382053 17:40062059-40062081 CAGAGTCAATCTAAGGAAGACGG - Intronic
1149294636 17:55250708-55250730 CAGAAAGAGCTTGAGGCAGAGGG + Intergenic
1150727882 17:67666356-67666378 GAGAAGGAACTTCAGGAAGGGGG + Intronic
1152360188 17:79829444-79829466 CAGCAGGAACTGAGGGAAGAAGG + Intergenic
1154368561 18:13734503-13734525 TACAATGAACTTCAGGAAGTTGG + Exonic
1155648414 18:28110408-28110430 CAGAATCAAATTTAGGAAAAAGG + Intronic
1155890999 18:31268904-31268926 CAGAATAAAATTAAGGGATATGG + Intergenic
1156839326 18:41592732-41592754 AAGAAAGAAATTAAGCAAGAAGG + Intergenic
1157271242 18:46277971-46277993 CAGAATGGACTTAATGAATGTGG + Intergenic
1157277437 18:46321759-46321781 AGGAATGAATTTAATGAAGAGGG - Intergenic
1158073391 18:53499812-53499834 CAGAATGAAGTTAGGGAATCAGG - Intronic
1158265754 18:55659287-55659309 CAGATTAAACTTCAGGAGGAAGG - Intronic
1158413662 18:57230862-57230884 CAGTATGAAGTGAAGGCAGAGGG - Intergenic
1158668378 18:59453133-59453155 CAGGATGATCTTTAGGAACAGGG - Intronic
1158994533 18:62904417-62904439 CAGAATGCATTTATAGAAGAAGG + Intronic
1162592248 19:11599502-11599524 CAAAATGTACTTCAGGCAGATGG + Intronic
1163043340 19:14619352-14619374 AAGAATGAAGCTAAGGAAAAGGG - Exonic
1164150550 19:22546714-22546736 CAGACAGAACCAAAGGAAGAAGG + Intergenic
1164322949 19:24167072-24167094 CAGCATGAAGTTACAGAAGATGG - Intergenic
1165264819 19:34651556-34651578 CAGAATAAATTTAACAAAGAAGG + Intronic
1166627482 19:44372071-44372093 CAGAATGAGCTGTAGGAAGGTGG - Intronic
926511818 2:13790858-13790880 CTGAATGGAATTTAGGAAGAGGG + Intergenic
927627515 2:24737585-24737607 CAGAGTTAACTTGAGGCAGAGGG - Intronic
928652319 2:33416310-33416332 CAGAATAAACCTAAAGAAAATGG - Intergenic
929146565 2:38711504-38711526 GAAAATGAATTTAAGGATGATGG - Intronic
930733937 2:54756040-54756062 CAGCCTAAACTTAAGGAAGAGGG - Intronic
930989220 2:57630836-57630858 CAGAATGAAATTACGGCAGAGGG + Intergenic
931105879 2:59055065-59055087 GAGAAAGAAATGAAGGAAGAAGG - Intergenic
931222657 2:60302075-60302097 CAGAGTGAACTTGGGGAAGCGGG + Intergenic
932656111 2:73612385-73612407 CAGCATGAAGTTACAGAAGAAGG - Intergenic
932890126 2:75587328-75587350 CAGAATGTGATTAAGGAAGTAGG + Intergenic
933203576 2:79479126-79479148 CTCAGTGAACTTCAGGAAGATGG - Intronic
933892462 2:86784375-86784397 AAGAAAGAACAAAAGGAAGAAGG + Intergenic
933977092 2:87520368-87520390 CAGTATGGACTTTGGGAAGATGG + Intergenic
935764894 2:106357049-106357071 CAGAATGAACTTCAGTGAAAGGG + Intergenic
936316725 2:111430437-111430459 CAGTATGGACTTTGGGAAGATGG - Intergenic
936755297 2:115702121-115702143 CACAATGACCTTGAGGAACAAGG + Intronic
936889283 2:117350287-117350309 CAGAATTGCCTCAAGGAAGATGG + Intergenic
936930133 2:117779568-117779590 ATGAATGAACTGAAGCAAGAAGG + Intergenic
937211092 2:120271759-120271781 CATAATGAACTCCAGGAAAAGGG - Intronic
937318118 2:120944961-120944983 AAGAATGGAAGTAAGGAAGAGGG - Intronic
937619579 2:123970548-123970570 CAGAAGGAAAGAAAGGAAGAAGG + Intergenic
938546023 2:132332490-132332512 CAGAATGAGCTGCAGGAAGGCGG + Intergenic
940314039 2:152308779-152308801 AAAAAAGAACATAAGGAAGAAGG + Intergenic
940585689 2:155645963-155645985 CAGAAAGAACTTGAGAAATAAGG + Intergenic
941078896 2:161037304-161037326 CAGATTGAGCTCAAGGAAGAAGG + Intergenic
941424517 2:165325308-165325330 AAGAATGAAGTTGAGGAAGCAGG - Intronic
941452760 2:165679207-165679229 AACAAAGAACTGAAGGAAGAGGG - Exonic
942644265 2:178094048-178094070 CAGAAGGAAAATAAGGATGATGG - Intronic
943794446 2:191974306-191974328 CAGACTCAACTGAAAGAAGAAGG - Intronic
944881109 2:204013879-204013901 CAGGATGAACTTAGGCAAGTAGG + Intergenic
944979215 2:205094905-205094927 TAGAAAAAACTTAAGGAAGTTGG - Intronic
945045344 2:205776680-205776702 CAAAATGAACCCAAGGAGGATGG - Intronic
945323084 2:208449637-208449659 CAGGCTGAACTTAAGTTAGATGG + Intronic
947075771 2:226343736-226343758 CAGAAAGAAGTAAGGGAAGAGGG + Intergenic
948791954 2:240383734-240383756 AAGAAAGAACAAAAGGAAGATGG - Intergenic
1169245053 20:4018523-4018545 GAGAATGAACGGAAGGAGGAGGG + Intergenic
1169303033 20:4462051-4462073 CAAAATAAACTAAAAGAAGAAGG + Intergenic
1169522017 20:6384486-6384508 CAGGATGAGCTCATGGAAGAGGG - Intergenic
1171874886 20:30565223-30565245 CAGAATGAGCTGCAGGAAGGCGG + Intergenic
1173231204 20:41200270-41200292 GAGAATGATGTTATGGAAGATGG - Intronic
1173339322 20:42139523-42139545 CAGAAGGAACTTCAGGAGAACGG + Intronic
1174383202 20:50170905-50170927 CAGAGGGAACGAAAGGAAGAGGG + Intergenic
1174968170 20:55243041-55243063 CAGAATGAAGTCATGGAAAAAGG + Intergenic
1175232921 20:57485942-57485964 CACATAGAACTTAAGGTAGAGGG - Intergenic
1175748408 20:61477579-61477601 CAGACTGAGCTCAAGGAAGGCGG - Intronic
1179065366 21:38019773-38019795 AAGAAGGAACTACAGGAAGAAGG + Intronic
1179406974 21:41134476-41134498 CAGAATGAATATAAGGGGGATGG + Intergenic
1179986587 21:44925385-44925407 CAGAAAGAAAGAAAGGAAGAAGG + Intronic
1181294144 22:21821618-21821640 GAAAAAGCACTTAAGGAAGAAGG + Intronic
1181472303 22:23148170-23148192 AAGAAGGAACTTAGGGAGGAAGG - Intronic
949134039 3:540986-541008 CAGAATGGAGGGAAGGAAGAGGG - Intergenic
951906628 3:27713649-27713671 CAGAAAGAACTTGAGGAGGAGGG - Intergenic
952887530 3:38020760-38020782 CAGAGTGAACTGAAGGAAGCTGG + Intronic
952995783 3:38880906-38880928 GAGAATGAAAGAAAGGAAGACGG + Intronic
954065016 3:48098848-48098870 TAAAATTAACTAAAGGAAGAGGG - Intergenic
954886043 3:53874815-53874837 CAGAATGAATGGATGGAAGAAGG + Intronic
955034856 3:55257658-55257680 AAGAAAGAAATTAAGGAAAAAGG + Intergenic
955986402 3:64577934-64577956 CACAATGAGCTTACAGAAGAAGG - Intronic
956033385 3:65063657-65063679 CATAACCAACTTAAGGAACAAGG - Intergenic
956818211 3:72928396-72928418 TTGAATGAACTTCAGGTAGAAGG - Intronic
958131904 3:89437818-89437840 CAAAATGAACTTAAGGACATAGG - Intronic
958769369 3:98407988-98408010 ATGAATGAAATGAAGGAAGAAGG + Intergenic
959171833 3:102853454-102853476 TATAATGAATTTATGGAAGAAGG - Intergenic
959820801 3:110733136-110733158 CAAAATGAGCTTAAGGGAAAAGG + Intergenic
962542001 3:136391729-136391751 CAGAAGGAGCTGAAGGAAGAAGG + Intronic
963268408 3:143261633-143261655 CATATGGAAGTTAAGGAAGATGG - Intergenic
964472670 3:157071146-157071168 CAGGATCAGCTTGAGGAAGAGGG - Intergenic
969202393 4:5616300-5616322 CAGAAAGGGCTGAAGGAAGAGGG + Intronic
971094633 4:23386973-23386995 CAGAATCAACTTCATGAAAAAGG + Intergenic
972439071 4:39067582-39067604 GAGAATTAACTGAAGAAAGAAGG - Intronic
972971140 4:44577198-44577220 TTGTAAGAACTTAAGGAAGATGG - Intergenic
973227793 4:47805528-47805550 CAGAAAGAAATGAAGGCAGAGGG - Intronic
973290265 4:48464018-48464040 CACCATGTACTTGAGGAAGATGG - Intergenic
974756607 4:66217317-66217339 TTGAATGCACTAAAGGAAGATGG - Intergenic
974807199 4:66896165-66896187 CAATCTGAACTTAAGGTAGATGG + Intergenic
976871659 4:89801204-89801226 CAAAATGAACTAAATGAACAGGG - Intronic
977361175 4:96008062-96008084 CAAAATGAAATTAATTAAGAAGG - Intergenic
978258946 4:106728578-106728600 AGGAATGAACTTAAGCAAGGAGG + Intergenic
978337732 4:107687903-107687925 CAGAGGGACCATAAGGAAGATGG - Intronic
978756722 4:112310744-112310766 CAAAAAAAACTTAAGGAAAATGG - Intronic
979305061 4:119132833-119132855 CAGAATGAACTTATAAAATAAGG + Intergenic
980230526 4:130040668-130040690 CCCAATGATCTTAAGGAATAGGG + Intergenic
981028232 4:140097595-140097617 AGGAATGTACTGAAGGAAGACGG + Intronic
981575337 4:146198292-146198314 CAGAATGAACTTCCAGCAGATGG - Intronic
982285479 4:153729227-153729249 CAGAATGAACATAAGGGGAACGG + Intronic
982816055 4:159886206-159886228 CAAAATGAGGTTAAGGAAGCAGG - Intergenic
983380325 4:166982933-166982955 AGGAAAGAACTTAGGGAAGAGGG - Intronic
984622744 4:181972534-181972556 CAGAAAGATCCTAAAGAAGATGG + Intergenic
986044325 5:4022827-4022849 CAGAAAGAAAATAGGGAAGATGG - Intergenic
986743322 5:10722868-10722890 CAGACTGCACTTAAGAAGGAAGG + Intronic
986751454 5:10791605-10791627 AAAAATGCACTTAAAGAAGACGG - Intergenic
987083112 5:14443637-14443659 CCCAATGAACTTCAGGAAGCAGG - Intronic
987733915 5:21813633-21813655 TGGAATGAAGTGAAGGAAGAGGG - Intronic
988072030 5:26303812-26303834 CAGCATGATTTTATGGAAGATGG - Intergenic
988410829 5:30883863-30883885 CAGCATGAAGTGAAGAAAGAGGG + Intergenic
989639682 5:43570868-43570890 CAGCATGAAGTTACAGAAGAGGG + Intergenic
990589146 5:57244071-57244093 AAGAATGTACTTTAGGCAGAAGG - Intronic
991170011 5:63613900-63613922 CTGAATGAACTGCATGAAGAGGG + Intergenic
991596700 5:68314078-68314100 CAAACTGAACTTTAGGTAGAGGG - Intergenic
992480377 5:77145622-77145644 CAGCAGGAACTCAAGGTAGAAGG + Intergenic
992574158 5:78094606-78094628 CAGAATAAAGTTATGGAGGAGGG - Intronic
993041715 5:82822187-82822209 CAGAATAAGCTTGAGGAGGAGGG - Intergenic
993299110 5:86184505-86184527 TAGAATGAAATTAAGGCAGTTGG - Intergenic
993681545 5:90884635-90884657 CACAAAGCACATAAGGAAGAGGG - Intronic
995829549 5:116339422-116339444 AAGAATAAACTTAAGTAACAAGG + Intronic
997022939 5:130023333-130023355 CAGAAATTACATAAGGAAGAAGG + Intronic
998464943 5:142336246-142336268 AAGAATGAATTTCAGGCAGAAGG - Intergenic
999544689 5:152614466-152614488 CTGAAAGAACTTAAAGGAGAAGG + Intergenic
999653711 5:153792689-153792711 CAGAAAGAAAGAAAGGAAGAAGG - Intronic
999695443 5:154184928-154184950 CAGAATATACTTCAGCAAGAAGG - Intronic
1000166708 5:158656881-158656903 CAGAATGAATCTAAGGATAATGG - Intergenic
1001045028 5:168365040-168365062 CAAACTGAATTAAAGGAAGAAGG + Intronic
1003094387 6:3131208-3131230 CAGAATGGACTAAAGAAGGAAGG - Intronic
1003099232 6:3164409-3164431 AAGAAGGAGATTAAGGAAGATGG + Intergenic
1003703207 6:8493872-8493894 GAGAAGGAAATGAAGGAAGAAGG + Intergenic
1004417997 6:15442485-15442507 CAGATAGATCTTAAGGCAGAAGG - Intronic
1005101750 6:22179584-22179606 ATGAATGAACTGAAGCAAGAAGG - Intergenic
1005136255 6:22571496-22571518 CATAATGACCATTAGGAAGAGGG - Exonic
1006591282 6:35159870-35159892 CAGAAAGAACTTGAGGAGAAGGG - Intergenic
1006624451 6:35387332-35387354 CAGGATGAACTCTAGGAAGCTGG + Intronic
1007149628 6:39676446-39676468 AAGGATGTACTTCAGGAAGAAGG + Intronic
1009575644 6:65455215-65455237 AAGAATCAACTTAACCAAGAAGG - Intronic
1010041656 6:71391736-71391758 CAGAATGTACTTCATGAAGTAGG - Intergenic
1010267941 6:73888180-73888202 CGGAATAAACTTAAATAAGAAGG - Intergenic
1010809250 6:80279988-80280010 CAGAATGAACTATATGAATAAGG + Intronic
1010917793 6:81641999-81642021 AAGAATGAACTGAAGAAGGAAGG + Intronic
1012279741 6:97314586-97314608 CAGAAAGATCATATGGAAGAAGG - Intergenic
1012477588 6:99631610-99631632 AAGGAGGAATTTAAGGAAGATGG + Intergenic
1014071177 6:117183095-117183117 AAGAATGAAATGAAGCAAGAAGG + Intergenic
1015138621 6:129903383-129903405 AAGAATGCACTTCAGGCAGAAGG + Intergenic
1016731642 6:147433708-147433730 AAGAATGATGTAAAGGAAGAGGG - Intergenic
1017219136 6:151945424-151945446 GAGAATCAACTGAAGGAACAAGG - Intronic
1018083834 6:160283865-160283887 AAGAAAGAACATAAGGAAAAAGG - Intergenic
1018296215 6:162347162-162347184 CAGAAAGAACCTAAAGAAAATGG - Intronic
1018550768 6:164996138-164996160 CAGCAAAAACATAAGGAAGAGGG + Intergenic
1018641982 6:165912456-165912478 CAGAATGGGCTGAAGCAAGAAGG - Intronic
1019895601 7:3980078-3980100 CAGAGTGAAGTCAAAGAAGATGG + Intronic
1020508296 7:9020390-9020412 CAGCATGAAGTTACAGAAGACGG + Intergenic
1021732642 7:23610763-23610785 CAAAATGAAAGTTAGGAAGAAGG - Intronic
1022033314 7:26512224-26512246 CTGAAGGTACTGAAGGAAGACGG + Intergenic
1023723582 7:43119515-43119537 GAGAAGGAATTTAAGTAAGAAGG - Intronic
1024272800 7:47655295-47655317 CAGAGTCAACAGAAGGAAGACGG + Exonic
1024377336 7:48654673-48654695 CACAATGATGTAAAGGAAGAGGG - Intergenic
1024438285 7:49384853-49384875 CAGAAAAAACTTGAGGAGGAGGG - Intergenic
1024473322 7:49785869-49785891 AAGGATGAAATTTAGGAAGAAGG + Intronic
1026462236 7:70624731-70624753 CAGAATAAACTTAGGAAAGAGGG + Intronic
1027194470 7:76020205-76020227 CAGGATGAGCTTAGGGAAGAAGG + Intronic
1027535542 7:79395649-79395671 CAGAATGATCTTAATAAAAATGG - Intronic
1027842884 7:83336781-83336803 TTGAATGAACTGAAGAAAGATGG - Intergenic
1028116990 7:87009365-87009387 CAGACAGAACATTAGGAAGAAGG + Intronic
1028453837 7:91016971-91016993 CAAAATGATATTAAGGAAGAAGG + Intronic
1028764392 7:94535730-94535752 GAGAAAGAAGTTAGGGAAGAGGG + Intronic
1028889310 7:95969252-95969274 AAGACTGAAGATAAGGAAGATGG + Intronic
1028914879 7:96247609-96247631 CAAAATGAACTTAAAGAATAAGG + Intronic
1029286137 7:99467413-99467435 CAGAATGAACTGAACGAGGGTGG - Intergenic
1031391419 7:121219357-121219379 CAGAATGGACTTCAGCAAGCAGG + Intronic
1031907163 7:127473308-127473330 CAGAAAGAAAAAAAGGAAGAAGG + Intergenic
1031935429 7:127731118-127731140 CAGAAAGAGCCTAAGGGAGACGG - Intronic
1036721422 8:11179155-11179177 CAAAATGAATTAAAAGAAGAGGG - Intronic
1036935076 8:12993849-12993871 CAAAATCAACTAAAGCAAGAAGG + Intronic
1037339817 8:17832286-17832308 CAGAAGGAACGGAAGGAGGAAGG + Intergenic
1037444949 8:18956090-18956112 CTGAATGAATGGAAGGAAGAAGG + Intronic
1038711646 8:29952372-29952394 CAGAATGGTCTTAAAGATGAGGG + Intergenic
1038722050 8:30046040-30046062 AAGAATGTACTTAAGGGAGGTGG + Intergenic
1039364489 8:36916019-36916041 AAGAATGAAGGAAAGGAAGAAGG + Intronic
1039770789 8:40684812-40684834 TAGAATGAATTTACGGAAGTTGG + Intronic
1039978597 8:42387791-42387813 CAGAAAGACCTGAAGCAAGAAGG - Intergenic
1041436984 8:57852816-57852838 CAGAATTGATTCAAGGAAGAAGG + Intergenic
1042123683 8:65515117-65515139 CAGAGTAAAATTAAGAAAGATGG + Intergenic
1042426955 8:68660336-68660358 AAGAATAAAATAAAGGAAGATGG - Intronic
1042430695 8:68703084-68703106 CAAAATAGACTTAAGGAAGATGG - Intronic
1043277882 8:78423149-78423171 AGGAATAAATTTAAGGAAGAAGG - Intergenic
1043513462 8:80973868-80973890 CAGAGTGAACCTTAGAAAGATGG - Exonic
1043566303 8:81552355-81552377 CAGGAAACACTTAAGGAAGAAGG + Intergenic
1044512587 8:93099529-93099551 AGGAAGGAACTTTAGGAAGAAGG - Intergenic
1044822165 8:96161707-96161729 CAGAAGGAACTTGGGGAAGGAGG - Intergenic
1044979530 8:97701906-97701928 CATAACAAACTTGAGGAAGATGG - Intronic
1046001496 8:108425776-108425798 CAGGGTGAAATTAAGGAAAAAGG + Intronic
1046124306 8:109884944-109884966 CAGAATAAAGATAATGAAGAAGG - Intergenic
1046209753 8:111054359-111054381 CAGAATCAATTTAACCAAGAAGG - Intergenic
1046976205 8:120280874-120280896 AAGAATAAACATAAGGAATATGG - Intronic
1047009077 8:120651670-120651692 CATAATGAACATATGGAAGGAGG + Intronic
1047059870 8:121213350-121213372 CAGAATGATTTGAAGGAAAAGGG + Intergenic
1047988560 8:130261934-130261956 CAGAATGAACAAAAGGAATATGG + Intronic
1048178884 8:132177460-132177482 CAGAATGGATTTAAGGGACAAGG - Intronic
1049505950 8:142998297-142998319 TAGACTGAACTAAAGGAAGACGG - Intergenic
1050506970 9:6358595-6358617 CAGAAAGAAATTCAGCAAGATGG - Intergenic
1051358521 9:16261781-16261803 AAGAATGGACCTCAGGAAGACGG + Intronic
1051877498 9:21807258-21807280 CATAATGATATTAAGGGAGATGG + Intronic
1052299506 9:26937624-26937646 CTCAAAGAACTAAAGGAAGATGG + Intronic
1052411844 9:28131334-28131356 CAGTAGGATTTTAAGGAAGAAGG - Intronic
1052528787 9:29655767-29655789 CAGCATGAAGTTACAGAAGATGG - Intergenic
1052538312 9:29776175-29776197 CAGCATGAAGTTACAGAAGACGG - Intergenic
1052682719 9:31715121-31715143 CATAAGGAACTTAAGGCAAACGG + Intergenic
1052718926 9:32150351-32150373 AAGAATGAAATGAAGCAAGAAGG + Intergenic
1052719983 9:32162726-32162748 CAGAACAAACTTAAGTAAAATGG + Intergenic
1056270474 9:84943631-84943653 CAAAATGAACCTGAAGAAGAGGG + Intronic
1057283528 9:93729436-93729458 CAGAATGAACTGATGGGACAGGG - Intergenic
1058031433 9:100202379-100202401 CAGAGAGAACTTCAGGCAGAGGG + Intronic
1058095178 9:100852077-100852099 CAGAATGAAGTTTAGGTAAAAGG + Intergenic
1059804250 9:117781471-117781493 TAGAAAGAAATTCAGGAAGAAGG - Intergenic
1060878011 9:127097030-127097052 CAGAACGAACTCAAGAATGAGGG + Intronic
1187004704 X:15220650-15220672 CAGAATGGGCTTATGGGAGAAGG - Intergenic
1187399801 X:18949488-18949510 CAGAAGGAAGTAAATGAAGATGG + Intronic
1188397234 X:29700400-29700422 CAAAATGAACTGAAGCAAGTGGG - Intronic
1188578003 X:31676193-31676215 CAGAAAGAACTTACGGAGCAAGG + Intronic
1190504474 X:51113127-51113149 TAGAATGAAATGAAGCAAGAAGG + Intergenic
1190633084 X:52408035-52408057 CAGAATAAACTTAAGGGAAAAGG - Intergenic
1190653200 X:52587635-52587657 CAGAATGAACTTAAGGAAGAAGG + Intergenic
1190679893 X:52816913-52816935 CAGAATAAACTTAAGGGAAAAGG + Intronic
1190796587 X:53750479-53750501 AAGAATGTATTTCAGGAAGAAGG - Intergenic
1191064109 X:56329718-56329740 ATGAATGAACTAAAGCAAGAAGG - Intergenic
1191158676 X:57303331-57303353 CAAAATGAAATTTAGGAAGTGGG - Intronic
1192144472 X:68672229-68672251 CAGATTGGCCTTAAGGAAGAAGG - Intronic
1192470430 X:71394021-71394043 CAGAAAGAACTAAAGAAATATGG - Intronic
1192734865 X:73840943-73840965 TAGAATAAACTTAAGGAAGTGGG - Intergenic
1192980678 X:76337149-76337171 CAGAATACATTTAAGTAAGAAGG + Intergenic
1193807683 X:86013860-86013882 CAGACACATCTTAAGGAAGAAGG + Intronic
1193808519 X:86023018-86023040 CAGAATGAATAAAAGGTAGAAGG - Intronic
1194638292 X:96372591-96372613 CAGAATGGAGCTCAGGAAGACGG + Intergenic
1194639265 X:96383102-96383124 CTGAATTAACAAAAGGAAGAAGG + Intergenic
1197047049 X:122010227-122010249 AAAAAGGAACTTGAGGAAGAGGG + Intergenic
1197373399 X:125652614-125652636 AAGAATAAACTTAACCAAGAAGG - Intergenic
1197588586 X:128381213-128381235 CAGAGTAAACTTAACCAAGAAGG + Intergenic
1197619737 X:128734145-128734167 CTGAATGAAATGAAGCAAGAAGG + Intergenic
1197835737 X:130692022-130692044 CATATTGAACAAAAGGAAGAGGG - Intronic
1197919272 X:131573645-131573667 GAGAATGGACATAATGAAGATGG + Intergenic
1199770734 X:150973645-150973667 CAGAGTGAAATTGGGGAAGAGGG + Intergenic
1200229105 X:154435261-154435283 CAGAATGAACCTGGGGAAGGTGG - Exonic