ID: 1190654069

View in Genome Browser
Species Human (GRCh38)
Location X:52595912-52595934
Sequence CACTGTAAACTGAGGGAGGC TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 266
Summary {0: 1, 1: 0, 2: 2, 3: 20, 4: 243}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1190654065_1190654069 -8 Left 1190654065 X:52595897-52595919 CCATACATGTCACTTCACTGTAA 0: 1
1: 2
2: 2
3: 16
4: 154
Right 1190654069 X:52595912-52595934 CACTGTAAACTGAGGGAGGCTGG 0: 1
1: 0
2: 2
3: 20
4: 243
1190654064_1190654069 1 Left 1190654064 X:52595888-52595910 CCGGATTTTCCATACATGTCACT 0: 1
1: 0
2: 1
3: 20
4: 202
Right 1190654069 X:52595912-52595934 CACTGTAAACTGAGGGAGGCTGG 0: 1
1: 0
2: 2
3: 20
4: 243
1190654063_1190654069 18 Left 1190654063 X:52595871-52595893 CCAGAGTCTTCAATAAACCGGAT 0: 1
1: 1
2: 5
3: 6
4: 69
Right 1190654069 X:52595912-52595934 CACTGTAAACTGAGGGAGGCTGG 0: 1
1: 0
2: 2
3: 20
4: 243

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1190654069 Original CRISPR CACTGTAAACTGAGGGAGGC TGG Intergenic
900967863 1:5971840-5971862 CACTGGAGACAGAGGGAGACGGG + Intronic
901046021 1:6396122-6396144 CACCGCAAGCTGAGGGAGCCGGG + Intergenic
902689938 1:18104805-18104827 CACCATGAACAGAGGGAGGCTGG + Intergenic
903918601 1:26783102-26783124 AAATGTAAACTGAGGGTGGTGGG + Intergenic
904046185 1:27610035-27610057 GCCTGTAATCTCAGGGAGGCAGG + Intergenic
904198105 1:28801172-28801194 TTCTGTAAACTGAAGGAGGGTGG + Intergenic
904256129 1:29256105-29256127 CACTGTAAAATGAGGCAAACAGG + Intronic
904400292 1:30252396-30252418 CTCTGTAAATTGAGGGAGAGAGG + Intergenic
904893942 1:33800139-33800161 CATTGTAAACTGAGGCTGGGTGG - Intronic
906479796 1:46192582-46192604 CTCAGGAAACTGAGAGAGGCAGG + Exonic
908121530 1:60990639-60990661 CACCCTAAAGTGAGGGAGGGAGG + Intronic
909302934 1:74037312-74037334 CACTGGCAACTGAGGTATGCAGG + Intronic
910310969 1:85824245-85824267 CACTAGAAACTGGAGGAGGCAGG + Intronic
911931641 1:103912031-103912053 CACTGTAAAGTATGGGACGCAGG - Intergenic
912448152 1:109752840-109752862 ATCTGTAAACTGGGGGAGGCAGG - Intronic
912488444 1:110047597-110047619 CACCATATACTGAGGCAGGCTGG - Exonic
912764278 1:112395052-112395074 GACTGTAAACTGCATGAGGCAGG + Intergenic
912971959 1:114292096-114292118 CCCAGGAAACTGAGGGAGACAGG - Intergenic
917745958 1:178007403-178007425 CAGAGCAAAATGAGGGAGGCAGG + Intergenic
918170619 1:181993757-181993779 TTCTGTAAACTGCTGGAGGCAGG - Intergenic
920674988 1:208032340-208032362 GCCTGTAAACTGTGGGAGCCAGG - Intronic
921273022 1:213489657-213489679 CAGTGGCAACTCAGGGAGGCAGG + Intergenic
923070382 1:230558838-230558860 CATTGTAGACTGAAGGAGGGTGG - Intergenic
923166770 1:231371947-231371969 CACTGGAACCTGAGGAAGGTTGG - Intronic
1063989557 10:11545231-11545253 CACTGGAGGCTGAGGGAGGGTGG - Intronic
1065092376 10:22247739-22247761 CAGTGTGAACTGAGTGAGCCAGG - Intergenic
1065156361 10:22874004-22874026 TACTTTAAACTGAGGGACGTTGG + Intergenic
1066758147 10:38730664-38730686 CCGTGGAAACTGAGGCAGGCAGG - Intergenic
1066963540 10:42242043-42242065 CCGTGGAAACTGAGGCAGGCAGG + Intergenic
1067748197 10:48952348-48952370 CACTGTAATCAGAGGGAGGCTGG - Intronic
1069422253 10:68257267-68257289 CTCTGTCCACTGAGAGAGGCTGG + Intergenic
1069931166 10:71882683-71882705 TACTGAAGACTCAGGGAGGCTGG - Intergenic
1074905315 10:117857508-117857530 CAATGCAAACCTAGGGAGGCTGG - Intergenic
1075877676 10:125822090-125822112 CTCTGTAAAATGAGGGGGGTGGG - Intronic
1076055919 10:127372820-127372842 CACTCTAAACTGAAGGAAGATGG - Intronic
1077913397 11:6594195-6594217 CATTCTAAACTGAGTGAGGAGGG + Intergenic
1078454310 11:11463142-11463164 CAGTGATAACTGAGGGAAGCAGG - Intronic
1079640640 11:22800611-22800633 CCCTGAAAACTGAGGGCAGCAGG - Intronic
1079743930 11:24101252-24101274 CACTGTGACCTGAGGGGAGCAGG - Intergenic
1082649831 11:55776128-55776150 CAGGGTAAACAGAGGGAAGCAGG + Intergenic
1083838857 11:65291467-65291489 CACCTTCATCTGAGGGAGGCAGG - Intronic
1085202419 11:74709670-74709692 CACTGAAAAGATAGGGAGGCAGG + Intronic
1085729495 11:78984086-78984108 CTCTGAAAAATGAGGGAAGCAGG + Intronic
1085891016 11:80579067-80579089 CACTTTAAACTGGGAGAGGATGG + Intergenic
1087879371 11:103396965-103396987 CACTGTAAAAGGTGGGAGGTGGG + Intronic
1089048689 11:115526892-115526914 ATATGTTAACTGAGGGAGGCTGG - Intergenic
1089176318 11:116551412-116551434 CACTGTAAAATGAGGTAGTTTGG + Intergenic
1089281930 11:117380785-117380807 AACTGTACACTGAGCCAGGCCGG - Intronic
1090652300 11:128817729-128817751 CTCTGTACACTGAGGGAGCCTGG - Intergenic
1095787413 12:46124908-46124930 CACTGTAAACTGAGGAGGTCAGG - Intergenic
1095862226 12:46930172-46930194 CTCTGTAACTTGAGGGAGGCAGG + Intergenic
1097409667 12:59235696-59235718 CCCTGTAAAATGATTGAGGCTGG - Intergenic
1097664236 12:62461627-62461649 CCCTGCAAGCTGAGGGAGCCGGG + Intergenic
1098753141 12:74321718-74321740 AACCGAAAAGTGAGGGAGGCAGG + Intergenic
1098892116 12:76019995-76020017 CACTGTAAAATGGGGAAGGATGG + Intergenic
1099877973 12:88432762-88432784 CACTGAGAACTGGGGCAGGCAGG - Intergenic
1101436256 12:104667326-104667348 CACAGTGAGCTGAGTGAGGCTGG - Intronic
1101918284 12:108912696-108912718 CACTGTAAACTGCCAGAGTCAGG + Exonic
1101962018 12:109257864-109257886 CAATTTAAACTGAAGGAGCCGGG - Intronic
1102347744 12:112170328-112170350 CACTGGAAATTGTGGGAGGTGGG - Exonic
1103821883 12:123705459-123705481 CACTTAAAACCGATGGAGGCAGG - Intronic
1104674039 12:130700621-130700643 CACTGGAAACTGGAAGAGGCAGG + Intronic
1108470983 13:50766708-50766730 CAGTTTAAACTCAGGCAGGCAGG + Intronic
1110159778 13:72361575-72361597 CACTGTAAAATGAGATAGTCTGG + Intergenic
1111167274 13:84476178-84476200 CACTGTAAAATGAGTTAGGGAGG + Intergenic
1114370130 14:22077342-22077364 CACTGGAATCTGAGGGAAGAAGG + Intergenic
1114860746 14:26517437-26517459 GAATGTAAACTGATAGAGGCAGG + Intronic
1115441689 14:33443088-33443110 CAGTGTTAACTGAGGGAAGCTGG - Intronic
1115564468 14:34613171-34613193 CACTGAAAGCTGGAGGAGGCAGG + Intronic
1115648031 14:35383886-35383908 AAGGGTAAACTGAGGGAGGGAGG + Intergenic
1119666517 14:76488916-76488938 CACTGTAAACCGTTGAAGGCAGG + Intronic
1121218175 14:92264524-92264546 CACGGTTAACCCAGGGAGGCTGG - Intergenic
1122122288 14:99561009-99561031 CTGTGGAGACTGAGGGAGGCAGG - Intronic
1122823166 14:104357137-104357159 CACTGGAAGCTGGGAGAGGCAGG + Intergenic
1126798975 15:52283065-52283087 GCCTGTAAACTGAGGCAGCCAGG - Intronic
1127377416 15:58397946-58397968 CTCAGTTAACTGAGGGAGGGAGG - Intronic
1127560108 15:60127785-60127807 CACTGTAAGCCGAGACAGGCTGG + Intergenic
1128333969 15:66774319-66774341 GACTGCAGTCTGAGGGAGGCGGG - Intronic
1129117004 15:73369892-73369914 CACTGTACACTGGGAGAGACTGG - Intergenic
1129332938 15:74837058-74837080 CAGAGTAACCTGAGGGAGGCTGG + Exonic
1131029835 15:89177324-89177346 CACTGTAAAATGAAGGAGGTGGG + Intronic
1131652952 15:94422035-94422057 CATTTTAAACTGAGAGTGGCTGG + Intronic
1133062953 16:3187159-3187181 CACAGAAAAGTGAAGGAGGCTGG - Intergenic
1133285011 16:4686636-4686658 CACTGTCCACTGCGGGAGGCAGG + Intronic
1133853202 16:9525306-9525328 CACAGCAACCTGAGGGAGGAAGG - Intergenic
1133994928 16:10740903-10740925 CACTGAAAAATGAGAGAGGGAGG + Intergenic
1136719652 16:32310125-32310147 TAGTGGAAACTGAGGCAGGCAGG + Intergenic
1136724684 16:32348522-32348544 CCGTGGAAACTGAGGCAGGCAGG + Intergenic
1136843011 16:33554562-33554584 CCGTGGAAACTGAGGCAGGCAGG + Intergenic
1138434428 16:56989299-56989321 GACGGGAAACTGAGGCAGGCGGG - Intergenic
1138659023 16:58507072-58507094 CACTGCCCCCTGAGGGAGGCAGG + Intronic
1139153904 16:64417895-64417917 CATTGTGAATTGAAGGAGGCAGG + Intergenic
1139930527 16:70522715-70522737 CACTGAAAATTAAAGGAGGCAGG + Intronic
1140745698 16:77978313-77978335 ATCTGTAAACACAGGGAGGCAGG + Exonic
1203001746 16_KI270728v1_random:169233-169255 CCGTGGAAACTGAGGCAGGCAGG - Intergenic
1203006779 16_KI270728v1_random:207644-207666 TAGTGGAAACTGAGGCAGGCAGG - Intergenic
1203133349 16_KI270728v1_random:1705639-1705661 CCGTGGAAACTGAGGCAGGCAGG - Intergenic
1203153176 16_KI270728v1_random:1854860-1854882 CCGTGGAAACTGAGGCAGGCAGG + Intergenic
1143792356 17:9307717-9307739 TACTTTGAACTGAGGGAGACTGG + Intronic
1144070795 17:11669599-11669621 CACTTTAAACTGAGAAAGGAGGG - Exonic
1144074221 17:11702375-11702397 TACTGTTAACTGAGGGAAGGAGG - Intronic
1147728130 17:42579549-42579571 CACTGTGAACTGAGGAGGGGAGG - Exonic
1147992773 17:44345240-44345262 CAATGGAAACTGAGGTAGGCGGG + Intronic
1149315458 17:55434280-55434302 ACCTGTAAAATGGGGGAGGCCGG + Intergenic
1149393255 17:56213521-56213543 CAAGGAAAACAGAGGGAGGCAGG + Intronic
1149517038 17:57288555-57288577 CACCGGAGACTGAGGGAGGTTGG + Intronic
1151967058 17:77436986-77437008 CACTGTAAACCGAGGGAGTGAGG - Intronic
1152539095 17:80965931-80965953 CCCTGTGAGCTGAGTGAGGCCGG - Exonic
1155047544 18:22115932-22115954 CCCTGTTAACTGTGTGAGGCAGG + Intergenic
1156016361 18:32551352-32551374 CACTGTAAAATGGGGGACGATGG + Intergenic
1157392182 18:47312029-47312051 CATTGGAAAGTGAGGGAGGTTGG + Intergenic
1157871732 18:51235654-51235676 GACTGGAAACTGATGGTGGCAGG + Intergenic
1158491760 18:57916442-57916464 CTCTCAAAGCTGAGGGAGGCAGG + Intergenic
1158530886 18:58259701-58259723 TAATGTAAACGGAGGGAGGAGGG + Intronic
1159245648 18:65801088-65801110 CACTGTAAGCTCATGAAGGCGGG + Intronic
1159870982 18:73759533-73759555 CCCTGGAATCCGAGGGAGGCTGG - Intergenic
1160813787 19:1026371-1026393 CACGGGAAACTGAGGCAGGGAGG - Intergenic
1162965965 19:14156241-14156263 CAGTGCTCACTGAGGGAGGCAGG - Intronic
1163146945 19:15386529-15386551 CACACTAAGCTGGGGGAGGCAGG - Intronic
1163230989 19:16002053-16002075 CCCTGTAAAGCGAGGTAGGCTGG + Intergenic
1165906976 19:39200144-39200166 CACAGTCCAGTGAGGGAGGCAGG - Intronic
1166040096 19:40197095-40197117 GAGGGTAAACTGATGGAGGCTGG + Intronic
1166732510 19:45067150-45067172 CTCTGTAGCCGGAGGGAGGCCGG + Intronic
1167378641 19:49125831-49125853 TCCTGTGACCTGAGGGAGGCGGG + Intronic
1168554387 19:57325970-57325992 AACTGTACTCTGAGGTAGGCAGG - Intronic
1168640664 19:58029360-58029382 CACTGCCAACTGAGGCAGGAGGG - Intergenic
926307465 2:11648805-11648827 CACTCCAAAATGAGGGAGGAGGG - Intergenic
927464746 2:23328747-23328769 CAGTGAAACCAGAGGGAGGCAGG - Intergenic
927495847 2:23551182-23551204 CAGCGTAAACTGAGGGAAGAAGG - Intronic
928216692 2:29367415-29367437 ATCTGTAAAATGAGGGAGGAAGG + Intronic
931214260 2:60226617-60226639 CACTGCAAGCTGAGGAACGCTGG - Intergenic
932513549 2:72321280-72321302 CACGATAAACTTTGGGAGGCTGG + Intronic
932872340 2:75414489-75414511 CATTGTAAACTGACGAAGACTGG - Intergenic
934972638 2:98775350-98775372 CACTGTGTTCTCAGGGAGGCAGG + Intergenic
938767254 2:134468672-134468694 CGCTGGAAACTTAGGGAGGAGGG - Intronic
939697933 2:145350994-145351016 CAATGAAAAATGAGGGATGCAGG - Intergenic
941122367 2:161545654-161545676 TAGTGGTAACTGAGGGAGGCAGG + Intronic
941206389 2:162578557-162578579 CACTGGAAACTTAGGAAGCCAGG + Intronic
944692437 2:202170114-202170136 GGCTGTCACCTGAGGGAGGCTGG - Intronic
944878309 2:203985416-203985438 CACAGTAGACACAGGGAGGCAGG - Intergenic
947501863 2:230676742-230676764 CACAGTTTACTCAGGGAGGCTGG + Intergenic
948055157 2:235005391-235005413 CACTGGAACCTGGGGGAGACAGG - Intronic
948384666 2:237574108-237574130 CTCTGTAAAGGGAGGCAGGCAGG + Intergenic
948761270 2:240192866-240192888 CGCTGTGAATTGAGAGAGGCAGG - Intergenic
1169887247 20:10413446-10413468 CACTGACAACTGAGAGAGTCAGG - Exonic
1169895229 20:10498264-10498286 AGCTGTAAACACAGGGAGGCAGG - Intronic
1170574995 20:17655640-17655662 CAGTGTAAACTGTGGCAGCCAGG - Intronic
1170918274 20:20649697-20649719 CACTGTACACTGAATGAGACAGG + Intronic
1171210886 20:23316114-23316136 TGATGGAAACTGAGGGAGGCTGG - Intergenic
1171436870 20:25130864-25130886 GACTGGAAACTGAGGCAGGCAGG - Intergenic
1171466190 20:25329409-25329431 CAGTGAAAACTGGGGGAAGCAGG - Intronic
1172420798 20:34815798-34815820 CATAGGAAAATGAGGGAGGCTGG + Intronic
1173441151 20:43077414-43077436 CACTGTCAACATAGGGAGCCTGG + Intronic
1174018229 20:47506562-47506584 CACTGTAAACTGACCTAGGCTGG - Intronic
1177675510 21:24293855-24293877 CACTGAAAACTCAGAGAGGTTGG + Intergenic
1178370162 21:32020812-32020834 CACTGAAAACTCAGGCAGGAGGG - Intronic
1178898799 21:36582898-36582920 CACTGCAAAATGAAGGATGCAGG + Intergenic
1179232324 21:39516017-39516039 TACAGTAAACTGAGGCAGGCAGG - Intergenic
1180253274 21:46604530-46604552 CACTTCAAACTGAGGGAAACTGG + Intronic
1180309717 22:11159073-11159095 CCGTGGAAACTGAGGCAGGCAGG - Intergenic
1180548194 22:16520883-16520905 CCGTGGAAACTGAGGCAGGCAGG - Intergenic
1181694276 22:24585174-24585196 CACTGTACCCTGTGGGAGGCAGG + Intronic
949808751 3:7983560-7983582 CAATGAAAACAGAGAGAGGCTGG + Intergenic
950303130 3:11899089-11899111 CACTGTAAGCTGAGTGCAGCAGG + Intergenic
950467514 3:13163869-13163891 CACTCTAAACACAGGGAAGCTGG + Intergenic
950915607 3:16641930-16641952 CTCTGGAAACTTAGGGAGACAGG - Intronic
954294857 3:49668605-49668627 CACAGTAAACAGAGGCGGGCTGG - Exonic
955872127 3:63450498-63450520 CATTTTAAACAGAGGAAGGCTGG + Intronic
956303364 3:67796841-67796863 CGCTGCAAACTGAGGGTGGATGG + Intergenic
956774064 3:72550365-72550387 CACCGGAAGCTGGGGGAGGCAGG - Intergenic
959121621 3:102240038-102240060 TACTGTAAACTGGGCTAGGCAGG - Intronic
959859506 3:111200876-111200898 CTGTGTAAACTGAGGTAGTCCGG + Intronic
960724206 3:120653899-120653921 CACTGGAACCTGGTGGAGGCAGG - Intronic
961838187 3:129682512-129682534 CACTGTAGGCTCAGGGAGGCAGG - Intronic
962324184 3:134419621-134419643 CACTATAGAGTCAGGGAGGCAGG - Intergenic
962418411 3:135204797-135204819 CATTTTAAACTGAAAGAGGCTGG - Intronic
963954217 3:151235272-151235294 CTTTGTAAACTGATGGGGGCAGG + Intronic
964045490 3:152319886-152319908 CACTGTACAATGAGGGACCCAGG - Intronic
964527572 3:157631370-157631392 CCCTGTCAGCTGAGGGTGGCAGG - Intronic
964746308 3:160015988-160016010 CACTGTAATCTGCAGTAGGCAGG - Intergenic
965520592 3:169665447-169665469 CCATCTAAACTGAGGGAAGCTGG - Intergenic
965526042 3:169719443-169719465 CACTGGAGCCTGTGGGAGGCAGG - Intergenic
966091718 3:176146152-176146174 CACTGTCAAATGAGAAAGGCAGG - Intergenic
966473935 3:180322888-180322910 CATTGTAAACAGGCGGAGGCTGG + Intergenic
967115557 3:186334346-186334368 GATTGTAAACTGATGGAGGGTGG + Intronic
970067550 4:12116216-12116238 CACTGTGATCTCAGGGAAGCAGG + Intergenic
971303792 4:25463204-25463226 CACTGTTGAATGGGGGAGGCAGG + Intergenic
971866597 4:32180106-32180128 CAATTCAAACAGAGGGAGGCAGG + Intergenic
972867927 4:43257169-43257191 CACTGGAAAGTGAGAAAGGCAGG + Intergenic
973792864 4:54394633-54394655 CACTGTTCAGAGAGGGAGGCAGG - Intergenic
976367426 4:84246484-84246506 CTCTGTAAACTGAGGGTGTAGGG - Intergenic
976456025 4:85247568-85247590 CAGAGCAAAATGAGGGAGGCAGG - Intergenic
978382372 4:108143206-108143228 CCCAGTAAACTGAAGTAGGCAGG - Intronic
985186922 4:187327562-187327584 GAGTGTAAACTTAGGGAGACAGG - Intergenic
986007452 5:3679945-3679967 GACTGTAAACTGAGGGATTGGGG - Intergenic
986239782 5:5950776-5950798 CACTGTTACCTGAGGGTGACCGG - Intergenic
988934408 5:36067713-36067735 CCCTGTAGACTGAAGAAGGCAGG - Intronic
990020362 5:51119141-51119163 CACTGTAGACTGCTAGAGGCAGG + Intergenic
990303252 5:54470238-54470260 CATTGGAAAATGAGGGAGGAAGG - Intergenic
992816921 5:80451110-80451132 CACTGAAAAATCAAGGAGGCAGG - Intronic
992847829 5:80771565-80771587 CTCTGAGAAGTGAGGGAGGCAGG + Intronic
993687821 5:90961563-90961585 CGTAGTAAACTGAGGGAGGAGGG + Intronic
994111431 5:96008969-96008991 CACTGTCGACTGATAGAGGCGGG - Intergenic
994595259 5:101824566-101824588 CAATGTAAAGTGTGGGAGCCAGG - Intergenic
994737313 5:103571128-103571150 CACTGTAAACTGAGTGATCATGG - Intergenic
997680964 5:135750429-135750451 CACTGAATACTGAGAGAGGGAGG - Intergenic
998721600 5:144957918-144957940 CAATGTATACTGGAGGAGGCGGG + Intergenic
999844321 5:155461832-155461854 CATTGTAAGCTGCTGGAGGCTGG + Intergenic
1000537309 5:162494454-162494476 CACTGTAAATGGAGGGAGGGAGG + Intergenic
1002710885 5:181194453-181194475 CACTGGAAAGTGCGGGAGTCAGG + Exonic
1006360535 6:33584693-33584715 CACAGTCAGGTGAGGGAGGCAGG - Intergenic
1011293682 6:85804940-85804962 CACTGTGAACTGAGAGAAGTAGG - Intergenic
1012655239 6:101809252-101809274 GCCTGTAAACTCAGGCAGGCAGG - Intronic
1013266227 6:108501744-108501766 CACTTAAATCTAAGGGAGGCTGG + Intronic
1013858212 6:114601588-114601610 CAAGGTAAATTGAGGGAGGCAGG + Intergenic
1014007182 6:116433058-116433080 CATTGGAAAATGAGGAAGGCAGG + Intronic
1014347072 6:120285213-120285235 CATTGTAAGCTGAGGTATGCTGG - Intergenic
1014690044 6:124552348-124552370 CACTGAAATCTGAATGAGGCAGG + Intronic
1016320124 6:142833426-142833448 TACTGCAAACTGAAGGAGACAGG + Intronic
1019182841 6:170202630-170202652 CACTGTAAGCTCAGGGAGGGCGG - Intergenic
1019438260 7:1032688-1032710 CACTGTCACCTGAGGGTGCCTGG - Intronic
1020021830 7:4873866-4873888 CACTCCAACCTGAGGCAGGCTGG + Intronic
1021273747 7:18624210-18624232 CACAATAAACTTAGGGTGGCAGG - Intronic
1022891676 7:34707466-34707488 CTGTGGAAACTGAGTGAGGCAGG - Intronic
1023107950 7:36781319-36781341 CACTGTCAAGTAAGGGAGACAGG + Intergenic
1024056070 7:45660518-45660540 CTCTGTGAACTGAGGGGTGCTGG + Intronic
1027423357 7:78038692-78038714 CTTTGTAAACTGTGGGAGGCAGG + Intronic
1029486988 7:100849343-100849365 CACTCTAAACTGGGCTAGGCAGG + Intronic
1030121909 7:106118445-106118467 TACAGTAAACTTAGGGAGACAGG + Intergenic
1030231875 7:107216076-107216098 AAATGGAAACTGAGAGAGGCAGG + Intronic
1031076889 7:117221691-117221713 CACTCTAAATTGAGGCAGGAGGG - Intronic
1032341696 7:131079834-131079856 GACTGCAAACTGAGTGAGGCAGG - Intergenic
1033944392 7:146697888-146697910 CACTTCAAACTGAAGAAGGCAGG - Intronic
1034275977 7:149824046-149824068 CAGGGTAGACTAAGGGAGGCAGG - Intergenic
1034784358 7:153911570-153911592 CATTGCAAACTGAGAGAGGAAGG - Intronic
1035033513 7:155880332-155880354 CACTGTAAAATTATGGAGACGGG - Intergenic
1039587515 8:38719580-38719602 GACTGTAAAGGGAGGGAGGAGGG - Intergenic
1039913962 8:41846072-41846094 CTCCATAAACTGAGGGATGCTGG + Intronic
1042815517 8:72874306-72874328 CATTGTACACTGAGGGCTGCCGG + Intronic
1044786052 8:95794230-95794252 CACTGTAAACTAAGAGGGGTAGG - Intergenic
1047990107 8:130277174-130277196 CACGGTAACCTGAGTGAGACTGG + Intronic
1049330635 8:142048650-142048672 CACTGTAAACTGGAGGAGTAAGG + Intergenic
1049537852 8:143190219-143190241 CGCTGTAAGAGGAGGGAGGCGGG - Intergenic
1049679173 8:143909799-143909821 AACTGGAAGCTGAGGGACGCAGG - Intergenic
1051514317 9:17911404-17911426 CACTGTAAAACGAAGAAGGCTGG + Intergenic
1052867433 9:33473141-33473163 TAGTGTAAACTGAGGCAGTCAGG - Intronic
1053361279 9:37488390-37488412 CACTGTACAGAGGGGGAGGCTGG - Intronic
1055837033 9:80455775-80455797 TACTGAAAACTCAGTGAGGCTGG + Intergenic
1056363139 9:85878939-85878961 CACAGATCACTGAGGGAGGCAGG + Intergenic
1056793826 9:89642868-89642890 CACAGTCTACTGAGGGAAGCAGG - Intergenic
1057179670 9:93022983-93023005 CAGATTAAACGGAGGGAGGCAGG - Intronic
1059807646 9:117820984-117821006 CACTGGAAGCTGAGGGAGCAAGG + Intergenic
1060147391 9:121264770-121264792 CACTGTAACCTGTGGGTGGAGGG - Intronic
1061028868 9:128067982-128068004 CGATTCAAACTGAGGGAGGCGGG - Intronic
1061049333 9:128185400-128185422 ATCTGTAAAATGAGGGGGGCGGG - Intronic
1061615302 9:131775131-131775153 CACTGCAGACTTAGGGAGCCAGG + Intergenic
1062549887 9:137081088-137081110 CTCAGTGCACTGAGGGAGGCAGG + Intronic
1188819903 X:34762466-34762488 CACTGTCCATTGAAGGAGGCGGG - Intergenic
1189164189 X:38843764-38843786 AACTTTAAAATGAAGGAGGCAGG - Intergenic
1190635194 X:52426193-52426215 CCCTGCAAACTGAGGGAGGCTGG - Intergenic
1190654069 X:52595912-52595934 CACTGTAAACTGAGGGAGGCTGG + Intergenic
1194122372 X:89976616-89976638 CACTGCAAGGTAAGGGAGGCAGG + Intergenic
1196090072 X:111731318-111731340 CACTGTAAACTGGGGAGGGAGGG - Intronic
1200475232 Y:3634055-3634077 CACTGCAAGGTCAGGGAGGCAGG + Intergenic
1201188947 Y:11430229-11430251 CCGTGGAAACTGAGGCAGGCAGG - Intergenic
1201398860 Y:13581010-13581032 AACTGTAAATTGAAGGATGCAGG - Intergenic