ID: 1190654231

View in Genome Browser
Species Human (GRCh38)
Location X:52597146-52597168
Sequence AGGCACTGGGAGCCTGGTGA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 472
Summary {0: 1, 1: 0, 2: 5, 3: 45, 4: 421}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1190654231_1190654236 -10 Left 1190654231 X:52597146-52597168 CCCTCACCAGGCTCCCAGTGCCT 0: 1
1: 0
2: 5
3: 45
4: 421
Right 1190654236 X:52597159-52597181 CCCAGTGCCTTCCTGAAGGCTGG 0: 1
1: 0
2: 2
3: 32
4: 321
1190654231_1190654242 22 Left 1190654231 X:52597146-52597168 CCCTCACCAGGCTCCCAGTGCCT 0: 1
1: 0
2: 5
3: 45
4: 421
Right 1190654242 X:52597191-52597213 CTATAGATCTCTGTATCCTCAGG 0: 1
1: 0
2: 0
3: 22
4: 148
1190654231_1190654243 26 Left 1190654231 X:52597146-52597168 CCCTCACCAGGCTCCCAGTGCCT 0: 1
1: 0
2: 5
3: 45
4: 421
Right 1190654243 X:52597195-52597217 AGATCTCTGTATCCTCAGGATGG 0: 1
1: 2
2: 4
3: 20
4: 164

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1190654231 Original CRISPR AGGCACTGGGAGCCTGGTGA GGG (reversed) Intergenic
900478990 1:2889308-2889330 GGGCCCTGGGAGCCTGGGGGTGG - Intergenic
900533836 1:3167647-3167669 AGGCACTGGGAGGCAGGGGTGGG - Intronic
900533996 1:3168121-3168143 AGGCACTGGGAGGCAGGGGTGGG - Intronic
900534016 1:3168179-3168201 AGGCACTGGGAGGCAGGGGTGGG - Intronic
900534056 1:3168295-3168317 AGGCACTGGGAGGCAGGGGTGGG - Intronic
900596178 1:3481195-3481217 ATGCACAGGGGGCCTGGTGCCGG - Intergenic
900704013 1:4067719-4067741 GGGTGCTGGGAGCCTGGGGAAGG + Intergenic
900934493 1:5756552-5756574 AGGCATTTGGTGTCTGGTGAGGG + Intergenic
901168170 1:7234604-7234626 AGGCCCTGGGAGCCCTGGGAAGG + Intronic
901465185 1:9416888-9416910 AGGCACAGGGAGCATGGGGTGGG - Intergenic
901813112 1:11778916-11778938 GGGCCCTGGGAACCTGGGGAAGG - Exonic
902256625 1:15193263-15193285 AGGCAGTGGCAGCCTGGAGAGGG - Intronic
902334614 1:15747755-15747777 AGGCCCTGGGAGCCCCGAGAAGG + Exonic
902435508 1:16395931-16395953 AGGCTCGGAGAGCCTGGGGAGGG + Exonic
903144547 1:21362558-21362580 AGGGACTGGGGGACTGCTGAGGG + Intergenic
903362019 1:22782893-22782915 AGGGGCTGGCAGCCTGGGGAGGG - Intronic
903687605 1:25143372-25143394 AGGCACTGGCAGGCTAGTGTGGG - Intergenic
904271253 1:29351583-29351605 GGGCACTGGGAGCCTGGGAAGGG - Intergenic
904425094 1:30417829-30417851 GGGCACTGGGAGCCTGGGAAGGG + Intergenic
904440372 1:30525883-30525905 AGGCCCTGGCAGGCTAGTGAGGG + Intergenic
904811772 1:33167920-33167942 AGGCACTGGGATTATGGCGAAGG + Intronic
904965496 1:34369463-34369485 AGTCACTGACAGCCTGGGGAGGG + Intergenic
905006669 1:34715438-34715460 GGGCCCTGGGAGCCTAGAGAAGG + Intronic
905223848 1:36466771-36466793 CAGCACTGTGAGCTTGGTGATGG + Exonic
905521344 1:38602962-38602984 AGGCCCTGGGGGCCTGGAGCAGG + Intergenic
906070568 1:43013471-43013493 AGGCAGGGGGAGCCTGTTGTAGG + Intergenic
906154967 1:43608626-43608648 GAGAACTGGGAGCCGGGTGATGG - Intronic
906455563 1:45994012-45994034 AGGCACTGGAAGCTTTGTGTTGG - Intronic
907077695 1:51593379-51593401 AGGCAGTGGGAAACTAGTGAAGG - Intronic
907833630 1:58088779-58088801 AGGAGCTTGGAGCCTGGTGGAGG + Intronic
907964928 1:59319757-59319779 AGGCAGAGGGAGCCTGTGGAGGG + Intronic
908191480 1:61708158-61708180 AGCCACTGGGAGGCTGGGGTGGG - Intronic
908980339 1:69949166-69949188 TGGGACTGGGAGATTGGTGAGGG - Intronic
910392926 1:86762980-86763002 AGGCACTGGGAGCCCTGTGTGGG - Intergenic
912474121 1:109924855-109924877 AGGCACTGGGGGCCTGGCTTGGG + Intronic
913076888 1:115347733-115347755 AGGAGCTGGGAGCCTGAAGAAGG - Intergenic
913714460 1:121519566-121519588 AGGCGCGGGGATGCTGGTGAGGG + Intergenic
914686447 1:149984158-149984180 AGGCTCAAGGAGCATGGTGAAGG - Intronic
914973332 1:152331938-152331960 AGGAATTGGAAGCTTGGTGAGGG - Intergenic
915362861 1:155296085-155296107 AGGGGCTGGGAGCCAGGTGAGGG + Intronic
916184768 1:162120394-162120416 AAGAATTGGGAACCTGGTGAAGG + Intronic
916548344 1:165827675-165827697 AGCCGCTCGGAGCCCGGTGACGG - Exonic
917971226 1:180209079-180209101 AGGCACTGGGGGGCTGGAGGGGG + Intergenic
918196270 1:182225191-182225213 ACACACTGGGAGCCTGTTGGGGG + Intergenic
919132522 1:193469119-193469141 AGGCACTGGGTACATGGAGAGGG + Intergenic
922323634 1:224509474-224509496 GGGCACTGGGTCTCTGGTGAGGG - Intronic
922565437 1:226598390-226598412 AGGCACTGGGGACCTGAGGAAGG + Intronic
922607530 1:226899695-226899717 AGGCACAGGCAGCTTGGAGAGGG + Intronic
922720239 1:227896552-227896574 AGGGAAGGGGAGCCAGGTGAGGG + Intergenic
923033395 1:230267469-230267491 AGGCCCTGGGAGCCTGGGAATGG - Intronic
1064417223 10:15160356-15160378 AGGCACAAGGAGCCCGGTGATGG + Intronic
1065104837 10:22372479-22372501 AGCCACTGGGAGGTGGGTGAGGG + Intronic
1065154212 10:22853036-22853058 AGGCACTGAGAGACTGAGGATGG + Intergenic
1065278045 10:24106012-24106034 AAGCACCGGGAACCTTGTGATGG + Intronic
1066700656 10:38124323-38124345 AGGCAGTGAGGGCATGGTGAGGG + Exonic
1067217296 10:44313772-44313794 AGCCACTGGCTGCCTAGTGAAGG - Intergenic
1067410515 10:46060425-46060447 AGGAACTGGGGGCCTGGTTCTGG - Intergenic
1070620027 10:78002257-78002279 AGGCACTGCCAGCGTGGTCACGG + Exonic
1073471142 10:103723139-103723161 AGGCAGGGGGAACCTGGTGATGG - Intronic
1075087672 10:119424287-119424309 AGGCACTTGGAGCCTGGGGAAGG - Intronic
1075189684 10:120295398-120295420 AGGCATTGGGAGCCAGCAGATGG - Intergenic
1075401154 10:122162743-122162765 GGGCACTGGGAGCTTGGTGATGG + Intronic
1075417079 10:122272039-122272061 GGGCAGTGGGAAGCTGGTGAAGG + Intronic
1075573598 10:123562687-123562709 GGGGATGGGGAGCCTGGTGAAGG - Intergenic
1075996651 10:126882205-126882227 AGACCCTCGGAGCCAGGTGAGGG - Intergenic
1076290250 10:129340462-129340484 AGGGAGTGGGAGCCTGGAAAGGG + Intergenic
1076315856 10:129540988-129541010 AGGCACTCGGAGAAGGGTGAGGG - Intronic
1076599924 10:131650820-131650842 AGGCACTTGGCTCCTGGAGAAGG - Intergenic
1076667994 10:132103680-132103702 AGGCACTAGGGACCTGGTGTAGG - Intergenic
1076692476 10:132230823-132230845 GGGCAGAGGGAGCCTGGAGAGGG - Intronic
1076715915 10:132363611-132363633 AGCCACAGCGAGCCTGGTGCAGG - Intronic
1076746227 10:132516043-132516065 AGCCACTGGGAAAGTGGTGAGGG + Intergenic
1076882212 10:133245107-133245129 AGCCACTGAGACCCTGCTGAGGG - Intergenic
1076883076 10:133248817-133248839 AGGCAAGTGGAGGCTGGTGAAGG + Intergenic
1077061963 11:621443-621465 AGTCACTGGCACCCTGGGGAGGG + Exonic
1077166662 11:1144143-1144165 TGACACTGGGAGCACGGTGAGGG + Intergenic
1077433328 11:2526657-2526679 GGGCTCTGGGGGCCTGGGGAGGG + Intronic
1077435103 11:2535164-2535186 AGGCTCTCGGAGCCTGTTCAGGG + Intronic
1077439564 11:2561745-2561767 TGGCACTGGGAGTATGGTGGGGG - Intronic
1077537020 11:3129300-3129322 GGGCCCTGGGAGCCTGGTGGTGG + Intronic
1079574086 11:21981574-21981596 AGGAACAGGAATCCTGGTGATGG - Intergenic
1081493189 11:43582432-43582454 GGGCGCGGGGAGCGTGGTGAAGG - Intronic
1081667494 11:44925087-44925109 TGGCACTGGGAGCCCAGTTAAGG - Intronic
1081688518 11:45059205-45059227 AGGCACACGCAGCCTCGTGAAGG + Intergenic
1083473942 11:62903595-62903617 TGGCACTGGGAGTGAGGTGATGG + Intergenic
1084166321 11:67376319-67376341 GGGCACTGGCAGCTTGGAGATGG - Intronic
1084298818 11:68231804-68231826 AGGCACTGGCAGCACGGTAAAGG + Intergenic
1084383528 11:68828431-68828453 AGACGCAGTGAGCCTGGTGAGGG - Intronic
1084710446 11:70840699-70840721 AGGAAGTGGGAGCCTGGGGAGGG + Intronic
1084936964 11:72592066-72592088 TGGCACAGGGAGCTTGGAGAGGG - Intronic
1086038110 11:82441513-82441535 AGCCACTGGGGGCTTGGTGGAGG + Intergenic
1088984723 11:114895550-114895572 AGGAACTTAGAGTCTGGTGAAGG - Intergenic
1089505319 11:118958389-118958411 AGGCACTGGGGGCAAGGAGAGGG - Exonic
1089678649 11:120107369-120107391 AAGGACAGGGAGCCAGGTGAGGG - Intergenic
1089685291 11:120142832-120142854 AGGCACTGGGAGGCTGAGGTGGG - Intronic
1089713777 11:120336661-120336683 CAGCACCGGGAGCCTGGTGAGGG + Intergenic
1089755438 11:120682749-120682771 AGGCAGTGTGAGCATGGGGAAGG - Intronic
1090003213 11:122979529-122979551 AGGCACTGGGGGCTAGGGGAGGG - Intronic
1091132800 11:133160693-133160715 GTGGACTGAGAGCCTGGTGAGGG + Intronic
1091274625 11:134342109-134342131 AGTCACTGGGACCCGGCTGAGGG + Intronic
1091588128 12:1827615-1827637 AGGAACCGGGACCCAGGTGAGGG + Exonic
1091750872 12:3020595-3020617 AGGCACATGGAACCTGGTCACGG - Intronic
1092409722 12:8243658-8243680 AGGGACTGGGAGGCTGGTCGGGG + Intergenic
1092926262 12:13275242-13275264 AGGCACTGGGAATATGCTGAGGG - Intergenic
1093791455 12:23255183-23255205 TGGCACGGGGACCCTGATGAGGG - Intergenic
1093797242 12:23327160-23327182 AAGCCCTTGGAGGCTGGTGAAGG - Intergenic
1095502854 12:42859774-42859796 AGGCACAGAGAGCCTTGCGATGG + Intergenic
1096619801 12:52857141-52857163 AGGAACTTGCAGTCTGGTGAGGG + Intergenic
1096649141 12:53053370-53053392 AGGAACTGAGCTCCTGGTGAAGG - Intronic
1097186032 12:57196955-57196977 AGGCACAGGGAGCCTTGGGCTGG - Intronic
1097277721 12:57824501-57824523 ATCCATTGGAAGCCTGGTGAGGG - Intronic
1098897964 12:76084462-76084484 AGGGACTGGGAGCCGGGAGTCGG - Intronic
1101842763 12:108339928-108339950 AGGCACTTAGCGCCTGGTTAGGG - Intergenic
1102656484 12:114486203-114486225 AGGCTCTGGGGGCTTGGTGGTGG - Intergenic
1102878794 12:116468236-116468258 AGGCAATGGGAAACTGGTGTTGG + Intergenic
1103059731 12:117848730-117848752 AGGCTGGAGGAGCCTGGTGATGG + Intronic
1104348837 12:128027286-128027308 AGGCACAGGGAGTCCAGTGATGG + Intergenic
1105768816 13:23587903-23587925 AGGACCTGGGAGCCTGCAGAAGG - Intronic
1105986189 13:25570221-25570243 GGGGAATGGGAGCCTGGAGATGG + Intronic
1106006849 13:25778697-25778719 AGGCACAGGGAGCCTGGGAAGGG - Intronic
1106271207 13:28155475-28155497 AGCCACTGGGAGGCTGAGGAAGG + Intronic
1106483673 13:30155103-30155125 GGGCGGGGGGAGCCTGGTGAGGG - Intergenic
1111114591 13:83758706-83758728 AGGCAATGGTAGCTTGATGATGG - Intergenic
1113594738 13:111522985-111523007 TGGCTTTGGGAGCCTGGGGATGG + Intergenic
1113985303 13:114310194-114310216 GGCAACTGGGAGCCTGGTGCTGG - Intergenic
1114531483 14:23399274-23399296 AGGCACTGTGGGCCTTGTGGGGG - Intronic
1116767782 14:49092909-49092931 TGGCACTGGAGGCCTGATGAAGG + Intergenic
1117788743 14:59315657-59315679 AGTCACTCGGAGCTTGGTTATGG + Intronic
1118987780 14:70771598-70771620 GGGAAATGGGGGCCTGGTGAAGG - Intronic
1119391221 14:74292403-74292425 AGGGTCTGGGAGCCAGGTGAAGG + Intronic
1121109088 14:91300235-91300257 AGCCACTGGGAGCCATGTCAAGG + Intronic
1122205893 14:100147763-100147785 AGGCTCTGGGTGCCTGGTGCTGG - Intronic
1122365475 14:101192582-101192604 AGGCCCTGGGGGCCTGGAGAAGG + Intergenic
1122407288 14:101508142-101508164 AGGGACTGTGAGGCTGGTGAAGG - Intergenic
1122693586 14:103542563-103542585 GGGCAGTGTGACCCTGGTGATGG - Intergenic
1122854552 14:104553950-104553972 CGGCACTGGGAGGCTGGCGGAGG + Intronic
1123008527 14:105335956-105335978 AGGCACCTGGAGCCTGGGGATGG + Intronic
1123427208 15:20182644-20182666 AGCAACTTGAAGCCTGGTGAGGG - Intergenic
1123536440 15:21189169-21189191 AGCAACTTGAAGCCTGGTGAGGG - Intergenic
1123943378 15:25227360-25227382 GGGCTCTGGGTCCCTGGTGACGG + Intergenic
1125390818 15:39190981-39191003 ACTCACTGGCAGCCTGGGGAAGG - Intergenic
1125512830 15:40302099-40302121 AGCCCCTGGAAGCCTGGGGAGGG + Intronic
1125519990 15:40343225-40343247 AGGCTCTAGGAGCCTGGGCAGGG - Intergenic
1125828641 15:42695613-42695635 AGGCCCTGGGAGGTGGGTGAAGG + Intronic
1128347035 15:66860859-66860881 TGGCACTGGCAGCCTGGGGAAGG + Intergenic
1128755813 15:70182980-70183002 AGAAGCTGGGAGCCTGGGGATGG - Intergenic
1128956139 15:71947698-71947720 AGGCACTGTCAGCATGGTGAGGG + Intronic
1129323488 15:74787516-74787538 AGTCCCTGGGGGCCTGCTGAGGG - Intronic
1129614179 15:77084741-77084763 AGGCAGTAGGACCCTGGTGGAGG + Intergenic
1130353315 15:83109390-83109412 AGCCACTGGGAAGATGGTGATGG + Intronic
1131381173 15:91965231-91965253 AAGCACTGGGATGCTGGTGGTGG - Intronic
1131551218 15:93358693-93358715 GGACACTGTGAGCCGGGTGAGGG + Intergenic
1131680933 15:94722403-94722425 AGGCACTGGAAGCCAGTTCATGG + Intergenic
1131761064 15:95623160-95623182 AGAGACTGGGAGCCAGGTGTGGG + Intergenic
1132344746 15:101101374-101101396 AAGCTCTGAGAGCCTGGTGCGGG + Intergenic
1132611895 16:821242-821264 AGGCCCTGGGAGGCAGGGGAGGG + Intergenic
1132710423 16:1263841-1263863 AGGCACTTGGAGCCTGGGCCAGG + Intergenic
1132774487 16:1584977-1584999 AGCCACTGGAAACGTGGTGAAGG + Intronic
1132781629 16:1629681-1629703 AGGCCCAGGGAGCGTGGGGAGGG + Intronic
1133440321 16:5815863-5815885 AGGGGCTGGGAGCCTGGGGCTGG + Intergenic
1133819635 16:9225195-9225217 AGGCACTGAGGGCCTGGGGAAGG + Intergenic
1134002818 16:10795840-10795862 AGGCGCTGGGAGCCTCCTGATGG + Intronic
1134102307 16:11460938-11460960 AGGCACTGCGTGCCTGGTTGCGG - Intronic
1135196296 16:20397819-20397841 AGCCTCTGGGAACCTGGTGCTGG + Intronic
1136526374 16:30834110-30834132 AGGAAGTGAGAGCTTGGTGAAGG + Exonic
1136857088 16:33667193-33667215 AGCAACTTGAAGCCTGGTGAGGG + Intergenic
1137605449 16:49783713-49783735 AGGCACTGGGAGCCTTTGGAAGG + Intronic
1137645496 16:50069786-50069808 AGGTACAGGGAGGCTGCTGAAGG - Intronic
1137764515 16:50967626-50967648 AGGCCCTGAGATCCTGGTGGAGG + Intergenic
1138071413 16:53996529-53996551 AGGAACTTGGAGCCTAGTAAGGG + Intronic
1138334333 16:56240718-56240740 AGGCACCCTGAGCCTGGAGAGGG - Intronic
1138346957 16:56326039-56326061 AGGCCCTGGGAACCAGGTGTGGG - Intronic
1140192565 16:72830316-72830338 AGGCACTGTGAGCCCTGTGAGGG - Intronic
1140723190 16:77789036-77789058 AGGCTCTGAGACCCGGGTGAGGG - Intronic
1141185337 16:81783033-81783055 AGTAACTGGGACCCTGGGGAAGG + Intronic
1141490642 16:84370317-84370339 AGGCCCTGGGTGCGTGATGATGG + Intronic
1142023878 16:87801945-87801967 AGGAACTGGCTCCCTGGTGAGGG - Intergenic
1143026970 17:3946758-3946780 AGGCACTGGGGACCTGGGAAGGG + Intronic
1143498356 17:7325111-7325133 AGGCAGAGGGAGCCTGGCGGGGG - Intronic
1143875357 17:9986850-9986872 AGACACTGTGAGCCTGGGGCAGG + Intronic
1144586881 17:16492347-16492369 AGGCAGGGGGCGCCTGGTGGTGG - Intergenic
1146341014 17:32020161-32020183 AGGCACGGGGTGCATAGTGATGG - Intronic
1148083752 17:44981860-44981882 AGTCAATGGTACCCTGGTGATGG - Intergenic
1148127191 17:45242936-45242958 AAGCACAGGGAGCCTGGAGGAGG - Intronic
1148583396 17:48759370-48759392 AGGCAGTGGGAAACTGCTGAAGG - Intergenic
1148836376 17:50467931-50467953 AGGGACAGGGAACCTGGGGACGG + Intronic
1148962246 17:51402975-51402997 AGGCCCTGGGACCCTGCTGATGG + Intergenic
1150444598 17:65218988-65219010 AAGGACTGCTAGCCTGGTGAAGG + Intronic
1150640862 17:66948521-66948543 CGGCACTGAGGGCCTGGTGAGGG + Intergenic
1152184871 17:78849244-78849266 AGGGACATGGAGCCTGGTGGTGG - Intergenic
1152565352 17:81097863-81097885 AGGCTGTGGGTGGCTGGTGAGGG - Intronic
1152728251 17:81958140-81958162 AGGCAGTGGGAGCATGGGGCAGG + Intronic
1153008622 18:518154-518176 AGTCACTTGGAGCTTAGTGAAGG - Intergenic
1153119765 18:1707575-1707597 AGGCACTGAGAGCCCAGTGTGGG - Intergenic
1153769219 18:8401760-8401782 AGCCACTGCTAGCTTGGTGAGGG - Intronic
1154007162 18:10541681-10541703 AGGCACTGGGAGTCTTGTCGGGG - Intronic
1154157548 18:11955828-11955850 AGGATCTGGGGGCCTGGGGAGGG + Intergenic
1155325162 18:24657571-24657593 AGGCCATGGGGGCCTGGTGGAGG - Intergenic
1155450099 18:25954173-25954195 AGGCTCTGGGACCCTGGACAGGG - Intergenic
1155492860 18:26417224-26417246 AGGCATTCGGAGCCGTGTGAGGG + Intergenic
1156343710 18:36236671-36236693 AGGCATTGGTAGCCTGATGGGGG + Intronic
1157815208 18:50725128-50725150 GGGCAGTGGGAACCTGGGGAAGG - Intronic
1158595267 18:58810392-58810414 CGGCACTAGGGGCCTGTTGAAGG + Intergenic
1158888232 18:61849001-61849023 AGGGAAGGGGAGCCTGGAGAGGG + Intronic
1159497655 18:69226467-69226489 AGCCACTGGAAGATTGGTGATGG + Intergenic
1160330124 18:77983555-77983577 GGGCACGGGGAGCCTTCTGAGGG - Intergenic
1160415490 18:78706960-78706982 CGGCTCAGGGATCCTGGTGAAGG - Intergenic
1160728041 19:626746-626768 AGCTACTGGGAGCCTGGGGCAGG + Intronic
1160766599 19:811346-811368 AGGCCCTGGGGGCGGGGTGAAGG - Exonic
1160933255 19:1580729-1580751 TGGCTCTGGGTGCCTGCTGAGGG - Intronic
1161212378 19:3074126-3074148 CGGCCTTGGGAGCCTGGTGTTGG + Intergenic
1161316895 19:3621419-3621441 GGGCACCGGGAGCCTGAGGAAGG - Intronic
1161332332 19:3694319-3694341 AGGCTCCGGGAGCCTGGGCAGGG - Intronic
1161651384 19:5487645-5487667 AGGAACTGGAAGCATGGGGATGG - Intergenic
1161768052 19:6217559-6217581 AGGCACTGGCTGCCTGTGGACGG - Intronic
1161786632 19:6330599-6330621 AGGCACTGAGAGGCTGGGTATGG - Intronic
1162490276 19:10987430-10987452 AGGCCTTGGGAGCCTGGGGCTGG + Intronic
1162967184 19:14161502-14161524 ACCCACTGGGTGCGTGGTGAGGG + Exonic
1163527823 19:17831786-17831808 AGGCTCTGGCGGCCTGGAGAAGG + Exonic
1163584024 19:18154340-18154362 AGGGACAGGGAGCCAGGAGAAGG - Intronic
1163827207 19:19530345-19530367 TGGGAATTGGAGCCTGGTGAAGG - Intronic
1165828526 19:38719186-38719208 AGGCACTGGCAGCTTTCTGAAGG - Intronic
1165958111 19:39514831-39514853 CTGGACAGGGAGCCTGGTGAGGG + Intergenic
1167097020 19:47379990-47380012 AGGCACGGGCACCCTGGTGGAGG - Intronic
1167134668 19:47609501-47609523 AGGCACTGGGCGCCGGGTCTGGG - Intronic
1167491002 19:49792590-49792612 AGGGACTGGGTGGTTGGTGAGGG - Intronic
1168078191 19:53991808-53991830 AGGCCCTGGGAGCCCGGGGGAGG + Intergenic
1168161782 19:54515229-54515251 AGGTACAGGGACCATGGTGATGG + Intergenic
1168612294 19:57811081-57811103 AGGAACTCGGAGACTGGTGGCGG + Intronic
925023640 2:590712-590734 AGAAACTGGGAGCCTGGAAAAGG + Intergenic
925736520 2:6968760-6968782 AGGCACTGTGAACTTGGCGAGGG + Intronic
926156361 2:10456207-10456229 AGTCACTGGGAGCTCGGGGAAGG + Intergenic
926297500 2:11579240-11579262 AGGCACTGGGGGCCTGGGCATGG - Intronic
927277138 2:21271869-21271891 AGGAACTTGGAGGATGGTGAGGG - Intergenic
928108212 2:28486483-28486505 GGGCAGTGGGAAGCTGGTGAGGG + Intronic
928173293 2:29017303-29017325 AGGTACTGGGTGCCTGGTGTGGG + Exonic
928401651 2:30983205-30983227 AGGTACTAGGGGCCTGGGGAGGG + Intronic
929899185 2:45986665-45986687 AGGCACGAGGAGGGTGGTGAGGG + Intronic
930444771 2:51456111-51456133 AGGCACTGGGAGGCTGGGACAGG + Intergenic
931579661 2:63759361-63759383 AGGCACTGGGAGTCAGGTAGAGG + Intronic
931799496 2:65745070-65745092 AGGCATTGTGAGCCTCATGAAGG + Intergenic
931861660 2:66361256-66361278 AGGGACTGGGAGCGAGGTGAGGG + Intergenic
932570192 2:72934435-72934457 AGGGCCTGGGAGCCTGGGGTGGG + Exonic
932596892 2:73099553-73099575 GGGAACAGGGGGCCTGGTGAAGG + Intronic
932614844 2:73225467-73225489 AGGCACTGGGAACTGGATGAGGG + Intronic
932704311 2:74011360-74011382 AGGCAATGGGAACGGGGTGAAGG - Intronic
933940464 2:87240649-87240671 AGTGCCTGGGAGTCTGGTGAAGG - Intergenic
933991234 2:87635171-87635193 AGGCGCTGGGAGCCTGGGGCTGG - Intergenic
934689322 2:96346251-96346273 AGGCACTGGGGGCGTGAGGAGGG + Intronic
934725347 2:96613510-96613532 AGGCCCTGGGACCCTGCTGTGGG - Exonic
934747242 2:96767464-96767486 AGGGTCTGGGAGAGTGGTGAAGG - Intronic
936302608 2:111315651-111315673 AGGCACTGGGAGCCTGGGGCTGG + Intergenic
936352673 2:111725127-111725149 AGTGCCTGGGAGTCTGGTGAAGG + Intergenic
937035886 2:118781517-118781539 AGGCACAGGAAGTCGGGTGAAGG - Intergenic
937089567 2:119196842-119196864 AGGCAGTGGGAGGCTGGAGGAGG + Intergenic
937297760 2:120820022-120820044 AGGCCATGGGAACCTGGGGAAGG + Intronic
938065231 2:128278417-128278439 AGGAGATTGGAGCCTGGTGAGGG + Intronic
938373773 2:130790807-130790829 AGGCCCTTGGAGCCTGGAGCAGG + Intergenic
938812190 2:134863653-134863675 AGGCACTGGGCGGCTGGCGTTGG - Intronic
940449448 2:153818858-153818880 AGGTAGTGGGAGCCTCCTGAGGG - Intergenic
940895665 2:159080180-159080202 AGGCTCGGAGAGCCTGGGGAGGG + Intronic
942331634 2:174830742-174830764 AGGCACTAGGCGGCTGGGGAAGG + Intronic
943266375 2:185738308-185738330 AGGCAGTGGGAGAGTGGTAAAGG + Intergenic
943266403 2:185738435-185738457 AAGCTGTGGGAGCCTGGGGATGG + Intergenic
945041776 2:205748713-205748735 AGGCACTGGCATCCTGTTGGAGG + Intronic
945112037 2:206369182-206369204 AGAAACTGAGAGCCTGGTGCAGG + Intergenic
945305435 2:208255019-208255041 AGGCACTGGGAGTCCGGTTTGGG - Intronic
946412932 2:219524213-219524235 AGGCACTGTGTGCTTGGTGCTGG - Intronic
946614736 2:221497277-221497299 AGGAAATTGGGGCCTGGTGAGGG + Intronic
947247064 2:228060744-228060766 AGCCACAGAGAGCCTGATGAGGG + Intronic
1168896921 20:1330178-1330200 TCGCACTGGGTGCCTGGGGAGGG + Intronic
1169289004 20:4332777-4332799 AGGGCCTAGGAGCCTGGTGTTGG + Intergenic
1169880428 20:10341321-10341343 AGGTGCTGGGAGCCAGGAGAAGG - Intergenic
1170533396 20:17316143-17316165 AGGCACTGGGCACCTGGTGTGGG + Intronic
1171108272 20:22456696-22456718 AGGCATTGGGTCCCTAGTGATGG - Intergenic
1171570680 20:26247999-26248021 TGGCAGTGTGAGCCTGGGGATGG + Intergenic
1171824674 20:29884160-29884182 GGGAACTGAGAGACTGGTGACGG - Intergenic
1174056599 20:47802499-47802521 AGGAACTGGGTGTCTGGAGACGG + Intergenic
1175410612 20:58765477-58765499 AAGCACTGGGGGTCTGGAGATGG + Intergenic
1176237880 20:64062760-64062782 GGGCTCTGGGAGGCTGGGGACGG + Intronic
1178417080 21:32412710-32412732 AGGCTCTGGCAGCCTGGGCAGGG + Exonic
1178525446 21:33324812-33324834 GGGCAATGGGAGCTTGGAGAAGG + Intronic
1178795906 21:35744183-35744205 AGGCACTGGGAAGCTATTGAAGG - Intronic
1179375843 21:40849094-40849116 TGGCACTGCCAGCCTGCTGAGGG + Intergenic
1179481657 21:41682327-41682349 AGGGGCTCGGAGTCTGGTGAGGG - Intergenic
1179521719 21:41949987-41950009 AGGGACTGGGCGGCTGGGGAAGG + Intronic
1179613091 21:42564961-42564983 TGGCAGAGGGAGCCTGGTGGAGG - Intronic
1179778973 21:43687477-43687499 TGGCACTGGGTGCTTGTTGATGG + Intronic
1179892669 21:44344819-44344841 CGGCCCTGTGTGCCTGGTGATGG - Intergenic
1180342522 22:11629415-11629437 GGGCGGTGGGAGCCGGGTGATGG - Intergenic
1181639150 22:24187761-24187783 AGCCACTGGGAGCCTGAGCACGG + Exonic
1181722496 22:24786572-24786594 AGGCCCTGGGGGCCAGTTGAAGG - Intergenic
1182639355 22:31754092-31754114 AGGCGCAGGGAACCTGGAGAGGG + Intronic
1183346931 22:37313145-37313167 CGCCAGTGGGAGCCTGGAGAGGG + Intronic
1183594483 22:38802391-38802413 AGGCAATGGGAGCATGGTGCAGG - Intergenic
1183725975 22:39589969-39589991 GGGCTCTGGGAGGCTGGTGGGGG - Intronic
1183745991 22:39691921-39691943 TCTCACTGGGAGCCTGGTGAAGG + Intergenic
1184954311 22:47873488-47873510 AGCCAGTGGGAGCCTGGAGTCGG - Intergenic
1185409986 22:50676810-50676832 AGGCTCTGGGCCCCTGATGATGG - Intergenic
949377326 3:3405078-3405100 AGGCGCTTGGAGCCTGGGGCAGG + Intergenic
950096673 3:10334724-10334746 GGCCACAGGGAGCCTGTTGATGG - Intronic
952263702 3:31765377-31765399 TGGCACCGAGAGCCTGGTAAGGG - Intronic
952821229 3:37487675-37487697 AGGCCCAGGGAGCTTGATGAAGG + Intronic
953914181 3:46907347-46907369 AGGCAATGGAGGCCAGGTGAGGG + Intergenic
954389832 3:50262886-50262908 AGGCACAGGGAGGCGGGAGATGG - Intergenic
954797491 3:53168910-53168932 AGGCACTGGGGGCTTGGGCAGGG + Intronic
958981243 3:100722524-100722546 AGGCACGGGGAGCCTTGAGCAGG + Intronic
960295082 3:115933171-115933193 AGGCATTGGGAGCCCATTGAAGG + Intronic
961006894 3:123411540-123411562 AGGCACTGGGATCCTGGGCCAGG - Intronic
961340570 3:126214244-126214266 AGGCATTGGAAGCCTGGGAAGGG - Intergenic
961438083 3:126932979-126933001 AGGCTCTGGGTGACTGCTGAGGG + Intronic
961521721 3:127470960-127470982 AGGCATTGAGAGGCTGGGGATGG - Intergenic
961566753 3:127769547-127769569 AGGCCCAGGGAGGCTGGTGAGGG + Intronic
961571024 3:127798848-127798870 AGTCACTGGGGCCCTGGTCAGGG + Intronic
964319398 3:155479363-155479385 AGGCACTGGGAGTCTGGTTGGGG - Intronic
964526671 3:157622224-157622246 TGGCTCTGGGACCCTGGGGATGG - Intronic
964675125 3:159269534-159269556 AGGGAGTGGGAGCCTGGAGGGGG + Intronic
966228219 3:177621007-177621029 AGAAACTAGGAACCTGGTGAAGG - Intergenic
967884106 3:194321813-194321835 AGTGACTGGTAGCCTGGTAATGG + Intergenic
969278183 4:6151051-6151073 AGACAGTGGGAGACTGGGGAAGG - Intronic
969521046 4:7677934-7677956 AGGCAGTGGGTGGGTGGTGATGG + Intronic
969831465 4:9801029-9801051 AGGCACTTGCAGACTGGTGTTGG + Intronic
969834186 4:9825921-9825943 AGGCACTGGGATCCAGGTTGAGG + Intronic
969842019 4:9889624-9889646 AGGCACTGTTAGCATGGTGGTGG - Intronic
970400361 4:15711633-15711655 ATCCACAAGGAGCCTGGTGAGGG - Intronic
970849112 4:20580797-20580819 AAGCACGGGGAGCCTTGTCATGG + Intronic
971206731 4:24577761-24577783 AGCCTCTGGGAGACTGGTGGTGG + Intronic
972236238 4:37137202-37137224 TGGCATTGGGTGCCTGATGAGGG - Intergenic
975465447 4:74704238-74704260 AGGCTCTGGGTGCCTGGGAAAGG - Intergenic
975486841 4:74943158-74943180 AGGCACTGGGAATATGGTGTTGG - Intronic
978621786 4:110640106-110640128 CTGGACTGGGAGCCTGGGGAAGG + Intronic
980104124 4:128570820-128570842 AGACAGTGGGAGCCCGCTGAAGG - Intergenic
980152105 4:129060790-129060812 TGGCACTGGGTTCCTGGTGCAGG + Intronic
981423446 4:144577581-144577603 AGTTACTGGGTGGCTGGTGAGGG - Intergenic
981615019 4:146637327-146637349 AGGCACTGGGCGCCTGGGGAAGG - Intergenic
982026507 4:151257668-151257690 ATGCTTTGGGAGCCTGGGGAGGG + Intronic
982266560 4:153543518-153543540 AGGCAGTGAGAGCCTGGGGAAGG + Intronic
982274980 4:153629288-153629310 GGGCAGTGGGAGCTTGCTGAAGG - Intronic
983940493 4:173530675-173530697 GGGCGCCGGGAGCCTCGTGACGG + Intergenic
984645024 4:182210013-182210035 CGGCACAGGGAGGCTGGGGAGGG - Intronic
985790485 5:1924349-1924371 AGGCACTGGGCTCCTGGTCTGGG - Intergenic
986333363 5:6734416-6734438 AGGCAGTGTGAGACTGGTGGCGG - Intronic
989418247 5:41205652-41205674 AGGCACAGGGAGGCTGGCGGAGG + Intronic
991141664 5:63251423-63251445 AGGAACTGTGAGGCTAGTGAAGG - Intergenic
992944731 5:81798832-81798854 AGGCATTTGGAGGCTGATGAAGG + Intergenic
993371963 5:87103589-87103611 AGGCACTGGGATGGGGGTGAGGG - Intergenic
996168055 5:120250719-120250741 AGGCACTGGTAGCATGGGGTTGG + Intergenic
996672374 5:126133670-126133692 AGGCACTAGGACCATGGGGAAGG + Intergenic
996916699 5:128720815-128720837 AGACAAAGGGAGCCTGGAGAAGG - Intronic
997303495 5:132823145-132823167 AGGCGCCGTGAGCCGGGTGAGGG + Intronic
997339245 5:133129869-133129891 AGGCCCTAGAAGCCTTGTGAGGG + Intergenic
998215118 5:140232126-140232148 TGGAACTGGGTGCCTGGTGGTGG + Intronic
999309977 5:150545606-150545628 AGGCGCCTGGAGCGTGGTGATGG + Intronic
999401417 5:151267249-151267271 AGTCAGTGGGAGCCTACTGATGG - Intronic
1000797814 5:165687590-165687612 ACACACTGGGAGCCTGTTGGGGG - Intergenic
1001218958 5:169882943-169882965 TGGCTGTGGGAGCCTTGTGAGGG + Exonic
1001263522 5:170254551-170254573 AGGCACTGGGAACTTGGAGAAGG - Intronic
1002057502 5:176606977-176606999 AGGGACAGAGAGCCTGGTCAGGG + Intronic
1002327015 5:178416337-178416359 AGGCCCGGGGAGCCTCCTGAGGG - Intronic
1002493924 5:179599226-179599248 GGGCCCTGGGAGCCAGGGGAAGG + Intronic
1002882799 6:1267760-1267782 AGGCACTGAGACCCTGGAGGTGG + Intergenic
1005015399 6:21370722-21370744 AGGCAGTGGGAGACTGGGGGAGG - Intergenic
1006274683 6:32993761-32993783 AGACACTGGGACCTTTGTGAAGG + Intergenic
1006914557 6:37585905-37585927 GGACTCTGGGAGCCTGGGGATGG - Intergenic
1007369670 6:41418065-41418087 AGGGACTGGCAGCCTGGAGAGGG - Intergenic
1007549956 6:42721658-42721680 AGGCACTGGGTGCGGGGAGAGGG + Intronic
1007717104 6:43863679-43863701 AAGGACTGGGAGTCTGGTGGGGG + Intergenic
1007720800 6:43884508-43884530 AGGCACTTGGAGCCTGAGGCAGG + Intergenic
1007769125 6:44179474-44179496 GGGCACTGGGATACTGGTGGTGG - Intronic
1010728656 6:79364433-79364455 AGTCACTGGTAGCTTGATGAGGG + Intergenic
1012750183 6:103151873-103151895 AGGAACTGGGAACGTGGTGGTGG + Intergenic
1012753030 6:103186944-103186966 AAGCACTGGGACCTTGGTGCAGG + Intergenic
1013586307 6:111582115-111582137 AGGCACTGGGAACCTGGAGGAGG - Intronic
1013636905 6:112037870-112037892 AGGCACAGGAAGCCAGCTGAAGG + Intergenic
1014540857 6:122674371-122674393 AGGCAGTGAGAGTGTGGTGAAGG + Intronic
1018733189 6:166668681-166668703 AGGCACAGGGAGGCTGGTTCTGG + Intronic
1019442177 7:1052981-1053003 AGGAACGGGGAGCCAGGTGATGG - Intronic
1022107201 7:27205110-27205132 AAGCAGAGGGAGCTTGGTGAAGG + Intergenic
1022480411 7:30739888-30739910 AGGCAGTAGGGGCCTGGTGGGGG - Intronic
1022606688 7:31822258-31822280 TGGCTCTGGGAGCCCAGTGAGGG - Intronic
1022983469 7:35626531-35626553 AGGGATTGGGAGCATGGTGTTGG - Intergenic
1023864510 7:44232433-44232455 AAGCACTGGGGGCCACGTGAGGG + Intronic
1024259062 7:47560319-47560341 AGGCCCTCGGTGTCTGGTGAGGG - Intronic
1024396016 7:48867672-48867694 GGGCACTTGGAGGCTGGTGGAGG - Intergenic
1025236403 7:57237683-57237705 AGGAACTGGGTGTCTGGAGACGG - Intergenic
1026239817 7:68563328-68563350 AGGGACTGGGGACTTGGTGAAGG + Intergenic
1026869149 7:73840315-73840337 AGGGACTGGGAGCTTAGTGTGGG + Intronic
1028104273 7:86858554-86858576 TGGCACTGGGCGTCTGGTGAGGG - Intronic
1028485948 7:91357356-91357378 AGGCATTGGGTGTCTGGCGAGGG - Intergenic
1028605584 7:92651827-92651849 AGGCCCTGGGATCTTGGAGAGGG + Intronic
1029249711 7:99227007-99227029 AGGCCCTGGCTGCCAGGTGACGG + Intergenic
1029515707 7:101021789-101021811 AGGCTCTGGGTCCCTGGAGAAGG - Intronic
1029737009 7:102470550-102470572 CCTCCCTGGGAGCCTGGTGAGGG + Intronic
1029999595 7:105044948-105044970 TGATACTGGGAGCCTGGAGAAGG - Intronic
1031195650 7:118609861-118609883 ATGGGCTGGGAGCCTGGAGAGGG - Intergenic
1031547600 7:123068922-123068944 AGTCACTGGGAGCCAGGAGCAGG + Intergenic
1032285632 7:130536754-130536776 AGGCACCGGGACCATGGTGGTGG + Intronic
1033236863 7:139645106-139645128 AGGCACTGGGAACCTTGGAAAGG - Intronic
1034150903 7:148914696-148914718 AGGAACTGGGAGAGGGGTGAAGG - Intergenic
1034885486 7:154795255-154795277 AGGCGCTGTGGGCCTGGTGCTGG - Intronic
1034914184 7:155023260-155023282 AGGCAGTGAGAGCCTGATGAGGG + Intergenic
1035311841 7:157974618-157974640 TGGCAGTGGGAGCCTGGGCAGGG + Intronic
1035783491 8:2246519-2246541 TGGCACTGGGAGGCTCTTGAGGG + Intergenic
1035808632 8:2473067-2473089 TGGCACTGGGAGGCTCTTGAGGG - Intergenic
1036086654 8:5619794-5619816 AGGGGATGGGAGCCTGGTGATGG + Intergenic
1036586178 8:10125865-10125887 AGGCACTAGGAGCCTAATAAAGG - Intronic
1036864439 8:12382300-12382322 AGGCACAGGAAGCCTTCTGATGG - Intergenic
1038322124 8:26536882-26536904 AGGCAGTGAGAGAATGGTGAGGG + Intronic
1038611158 8:29061306-29061328 AAGCACTGGGAGCTTGGGCAGGG + Intronic
1038824856 8:30989233-30989255 AGGCAGTGGGAGCCAGAGGAGGG + Intergenic
1039116435 8:34096266-34096288 ATGTACTGAGAGCTTGGTGATGG + Intergenic
1039824028 8:41157728-41157750 AGGATCTGGTATCCTGGTGATGG - Intergenic
1039863454 8:41479566-41479588 AGGCACAGGGTGCCTGGGAAAGG - Intergenic
1039977051 8:42375817-42375839 AGGCACTGTGAGCCCTGTGGAGG + Exonic
1044869393 8:96603674-96603696 AGGCACTGGGAGGATGGAGGAGG - Intronic
1045016581 8:98006003-98006025 AGACACTGGAGGCCTGGTGCAGG - Intronic
1045314973 8:101035688-101035710 GGGCACTGTGTGGCTGGTGATGG + Intergenic
1048470623 8:134700945-134700967 AGGCACCGGAAGCTTGGTGTGGG - Intronic
1049049759 8:140185386-140185408 AGGCACTGGCATTTTGGTGATGG - Intronic
1049239733 8:141531047-141531069 GGGCACAGGGAGCCTGGGGGAGG + Intergenic
1049324697 8:142015902-142015924 ATGCACTGGGTGCCTGAGGATGG - Intergenic
1049450397 8:142658323-142658345 AGGCACTGGCAGTCTGGTGTCGG + Intronic
1050108529 9:2190976-2190998 AGCCATTGGGAGACAGGTGAAGG + Intronic
1052475303 9:28951697-28951719 GGGCACTGGGAGCTTGGAAAAGG - Intergenic
1052736678 9:32349639-32349661 AGACAGTGGGAGCCTGGTTTGGG + Intergenic
1053008562 9:34620658-34620680 AGGCACTGGAAGCCAGGGGAGGG - Intergenic
1053107412 9:35423453-35423475 AGGGGCTGGGAGGCTGATGAGGG - Intergenic
1055150007 9:72985446-72985468 AGACAGTGGGAGCCAGGGGAGGG + Intronic
1055650272 9:78400111-78400133 AGGCACTAGCACTCTGGTGAGGG + Intergenic
1055711423 9:79066156-79066178 AGGCACTGGGAAACTATTGAAGG + Intergenic
1056105804 9:83345181-83345203 GGGCACTGGGGGCATGGTGGAGG + Intronic
1056269217 9:84930336-84930358 AGGCACTGGTAGGGTGGAGAGGG + Intronic
1056402545 9:86242046-86242068 AGGGATTGGGAGTGTGGTGATGG + Intronic
1056733498 9:89185166-89185188 AGGTCCAGGGAGCTTGGTGATGG + Intergenic
1057224945 9:93288143-93288165 AGTCCCTGTGAGCCTGGTGGAGG + Intronic
1057293318 9:93820691-93820713 TGGGACTGGGACCCTGGGGAGGG - Intergenic
1057702249 9:97371734-97371756 TGGCCCTGGGGGGCTGGTGAGGG + Intronic
1058906183 9:109484381-109484403 AGGGAGTGGGGGCCCGGTGATGG + Intronic
1059804061 9:117779668-117779690 AGGCACTGTGGGACTGGTAAGGG - Intergenic
1059977918 9:119737451-119737473 AGCCACTGGGGGCCATGTGATGG - Intergenic
1059983334 9:119797340-119797362 AGTCACTGGGACCCAGGTTAGGG - Intergenic
1060002154 9:119968640-119968662 AGGCAATGGGAAGCTGCTGAAGG + Intergenic
1060823072 9:126672571-126672593 AGGCACTGTGAGCCTGGAAGGGG + Intronic
1061122427 9:128652011-128652033 AGGCACTGGAAGCCTGATCCAGG + Intronic
1061453964 9:130683885-130683907 AGGCATTGGGAGCCTAATGGTGG - Intergenic
1061516829 9:131094974-131094996 AGGCTGTTGGAGCCTGGAGAGGG + Intergenic
1061556734 9:131374906-131374928 AGGCAGTGGTACCCTGGGGAGGG - Intergenic
1061614922 9:131773324-131773346 AGGCAGAGGGAGCCAGGGGAAGG - Intergenic
1185752810 X:2627638-2627660 GGGATCTGGGAGCCTGATGAGGG - Intergenic
1185754767 X:2644576-2644598 GGGATCTGGGAGCCTGATGAGGG + Intergenic
1187412539 X:19063588-19063610 GGGCACTGAGAGCCTGCTCAGGG - Intronic
1189552547 X:42108364-42108386 AAGTTCTGGGAGCCTGGTCAGGG + Intergenic
1189556345 X:42149372-42149394 ATGCACTGGGATCCTGATGCTGG - Intergenic
1189578925 X:42385065-42385087 AGGAAATGAAAGCCTGGTGAAGG + Intergenic
1190632355 X:52400284-52400306 AAGACCTGGGAGCCTAGTGAGGG - Intergenic
1190635038 X:52424986-52425008 AGGAGCCAGGAGCCTGGTGAGGG + Intergenic
1190639117 X:52465868-52465890 AGGACTTTGGAGCCTGGTGAGGG + Intergenic
1190653665 X:52592165-52592187 AGGACCTGGGAGCCTGGTGAGGG + Intergenic
1190654231 X:52597146-52597168 AGGCACTGGGAGCCTGGTGAGGG - Intergenic
1191005641 X:55708426-55708448 AGGCATGGGGAGCCAGGGGAGGG + Intergenic
1195129894 X:101841355-101841377 AGGCTCTGGGGCTCTGGTGATGG + Intronic
1195176342 X:102318468-102318490 AGGCTCTGGGGCTCTGGTGATGG - Intronic
1195182522 X:102368625-102368647 AGGCTCTGGGGCTCTGGTGATGG + Intronic
1196815916 X:119665531-119665553 AGGCTGTGGCAGACTGGTGAAGG + Intronic
1197385464 X:125796136-125796158 GGGCAGTGGGACCCTGGTTATGG - Intergenic
1197808172 X:130416882-130416904 AGGCACTGGTTGCCTAGTGTGGG + Intergenic
1198016108 X:132612955-132612977 TGGCACTGAAATCCTGGTGAAGG - Intergenic
1198807963 X:140508036-140508058 GGGCACTTGGAGGCTGGAGAGGG - Intergenic
1200148465 X:153939732-153939754 AGGGACTGGGAGTCTGGGCAGGG - Intronic
1200216846 X:154371797-154371819 AGGCCCTGGGGGCCCGGGGAAGG - Intronic
1200223849 X:154405694-154405716 GGTCACTGGGAGGCTGGTGCTGG - Intronic
1200411740 Y:2868198-2868220 AGGCTCTGGGAGCCAGGAGAGGG + Intronic