ID: 1190655972

View in Genome Browser
Species Human (GRCh38)
Location X:52612403-52612425
Sequence CTGCCTTTTGCTATGTTTCC AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 378
Summary {0: 1, 1: 0, 2: 2, 3: 24, 4: 351}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1190655965_1190655972 13 Left 1190655965 X:52612367-52612389 CCCGCCTCAGCTTAGGGACTACA 0: 1
1: 1
2: 4
3: 38
4: 242
Right 1190655972 X:52612403-52612425 CTGCCTTTTGCTATGTTTCCAGG 0: 1
1: 0
2: 2
3: 24
4: 351
1190655966_1190655972 12 Left 1190655966 X:52612368-52612390 CCGCCTCAGCTTAGGGACTACAG 0: 1
1: 1
2: 3
3: 25
4: 173
Right 1190655972 X:52612403-52612425 CTGCCTTTTGCTATGTTTCCAGG 0: 1
1: 0
2: 2
3: 24
4: 351
1190655968_1190655972 9 Left 1190655968 X:52612371-52612393 CCTCAGCTTAGGGACTACAGGCA 0: 1
1: 1
2: 6
3: 101
4: 1453
Right 1190655972 X:52612403-52612425 CTGCCTTTTGCTATGTTTCCAGG 0: 1
1: 0
2: 2
3: 24
4: 351

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1190655972 Original CRISPR CTGCCTTTTGCTATGTTTCC AGG Intergenic
900101915 1:965611-965633 CTGCCGTGTGCCATCTTTCCTGG + Exonic
902553418 1:17232823-17232845 CTGACTTTGGATATGTTACCCGG + Exonic
902733548 1:18385375-18385397 CTGCCTTTATCTCTGCTTCCAGG - Intergenic
902735879 1:18400392-18400414 CGGGGTCTTGCTATGTTTCCTGG - Intergenic
903583587 1:24391007-24391029 TTGGGTTTTGCTATGTTGCCTGG + Intronic
905013872 1:34764033-34764055 CTGCCTCTGGCTCTGCTTCCAGG - Intronic
906160890 1:43648377-43648399 CTGGATTTTGCTGTATTTCCTGG - Intergenic
906353575 1:45084098-45084120 CAGGGTTTTGCCATGTTTCCCGG + Intronic
907702776 1:56805550-56805572 CACCCATTTGCTATGTGTCCTGG - Intronic
907783800 1:57592219-57592241 CTGCCTTAGGCTATGTCTTCTGG + Intronic
908269677 1:62410849-62410871 CTGCTGGTTGCTATGTTGCCTGG - Intergenic
909342826 1:74550839-74550861 TTGCCTCTTGCTCTGTTCCCTGG + Intergenic
910250160 1:85189013-85189035 GTGCCTTATGTTCTGTTTCCTGG + Intronic
910692442 1:89978526-89978548 CTGGGTTTTACTATGTTGCCTGG + Intergenic
911040029 1:93584005-93584027 CTGCCGATTGGTATGTTTCGGGG - Exonic
911793757 1:102051396-102051418 CAGGATTTTGCCATGTTTCCAGG - Intergenic
912517922 1:110227483-110227505 CTGCCTTTTGCTGGGGTTGCTGG - Intronic
912761340 1:112370249-112370271 CTTCATTTTTCTGTGTTTCCTGG - Intergenic
913341592 1:117763314-117763336 CAGGATCTTGCTATGTTTCCAGG + Intergenic
916776864 1:167975741-167975763 CAGGGTTTTGCTATGTTGCCAGG + Intronic
917282710 1:173394189-173394211 TGGAGTTTTGCTATGTTTCCAGG - Intergenic
918122006 1:181548490-181548512 CTGCCTCCTCCTATGTTTCTGGG + Intronic
918544293 1:185664980-185665002 CTCCCTTGTGCTCTGTGTCCTGG + Intergenic
918613423 1:186517256-186517278 CTGGCTATTGCCATGTTTCTAGG - Intergenic
919355100 1:196512053-196512075 CTGCATTTTGCTATGTGTAGAGG - Intronic
920204134 1:204279253-204279275 CTCCCTTGTGCTATCTTTACAGG - Intronic
920384130 1:205555902-205555924 CTGATTTTTTCTATGTTTCCAGG + Intergenic
920729602 1:208470652-208470674 CTACCTTTTTCTAGATTTCCTGG - Intergenic
921838606 1:219804295-219804317 CTGCCTTTTGCTCAGTTCCTAGG + Intronic
922180844 1:223231587-223231609 CTTCCTTCTGCTTTATTTCCTGG - Intronic
923996401 1:239500005-239500027 TTCCATTTTGATATGTTTCCAGG - Intronic
924147106 1:241087756-241087778 CGGGCTTTTGCCATGTTGCCTGG - Intronic
924477479 1:244394767-244394789 CTGACTCTTGCCATTTTTCCAGG - Intergenic
924513922 1:244750733-244750755 CTGCCTTTTTTTTTTTTTCCTGG - Intergenic
924800025 1:247322533-247322555 CTGTCTTTGGCCATGTTTTCTGG - Intronic
1063403993 10:5775261-5775283 CAGCATTTTGCTTTGTTACCCGG - Intronic
1065138004 10:22691652-22691674 GCGTCATTTGCTATGTTTCCAGG + Intronic
1066174762 10:32891848-32891870 CAGCCTTTTGCAATGCCTCCTGG - Intergenic
1068158258 10:53229223-53229245 CTGCTTTTGGCCATTTTTCCTGG + Intergenic
1068603893 10:58984222-58984244 TGGGATTTTGCTATGTTTCCCGG + Intergenic
1069096024 10:64261106-64261128 CTGGCTATTGGTATGATTCCTGG + Intergenic
1069948503 10:72003365-72003387 CTGCCTCTTCCTAATTTTCCTGG - Intronic
1070737207 10:78871405-78871427 GTTCTTTTTGCCATGTTTCCAGG + Intergenic
1071255696 10:83869918-83869940 TTGCCCTTTGCAATGTTTCAGGG + Intergenic
1072162857 10:92784512-92784534 CAGGGTTTTGCTATGTTGCCCGG + Intergenic
1072468489 10:95690172-95690194 CTGGGTCTTGCTATGTTGCCAGG + Intronic
1073092987 10:100959444-100959466 CTGCCATTTTCCATGTATCCTGG - Exonic
1073814347 10:107189522-107189544 CAGCCTTTTCCTATATTTTCTGG + Intergenic
1074144490 10:110704594-110704616 CTGGCTTTTACAATGTATCCAGG + Intronic
1074167979 10:110902917-110902939 CTGCCTTTTTTTTTTTTTCCAGG + Intronic
1074275627 10:111999292-111999314 CTGCCTTTCGTTTTCTTTCCTGG - Intergenic
1075031215 10:119025860-119025882 CTGCCTTTTGCTCACTTTCCAGG - Intergenic
1075171136 10:120115884-120115906 CTGCTTTTTGCTATGGTCTCAGG - Intergenic
1075231474 10:120683498-120683520 TTGCCTTTTCCTATGCTTTCTGG + Intergenic
1076405134 10:130206637-130206659 CTGCCTTGTGCTGTGTGGCCTGG + Intergenic
1077626457 11:3776313-3776335 CTGCCTTTTGCCATGTTGCTCGG + Intronic
1078015808 11:7613499-7613521 CAGCCTTTTGCAATGATTCAGGG + Intronic
1078707242 11:13756298-13756320 CTTCTTTTTGCTTTGTTTCCTGG - Intergenic
1079489281 11:20969468-20969490 CTTTCTTTTGCTATGTTGCTTGG - Intronic
1079535004 11:21503470-21503492 CTCACTTTTGCTATTTTTCTTGG + Intronic
1079574880 11:21990990-21991012 CTGCCTTAAGCTAAGGTTCCAGG + Intergenic
1080237939 11:30093128-30093150 CGGGGTCTTGCTATGTTTCCTGG + Intergenic
1080407555 11:31993176-31993198 CTGCATTTTCCTATGTCTCTAGG - Intronic
1081666202 11:44918512-44918534 CTCCCTTTGGCTATGGTGCCTGG - Intronic
1082582499 11:54890023-54890045 CTTCCTTCTGCTTTTTTTCCTGG - Intergenic
1084685077 11:70688521-70688543 CTGACACTTGCTATGTTTCCTGG - Intronic
1087421843 11:97938041-97938063 ATGGCTTTTTCTTTGTTTCCAGG - Intergenic
1088085955 11:105980534-105980556 CTTCCTTTTGCTTTTCTTCCTGG - Exonic
1088248896 11:107845385-107845407 CTGGGTTTTGCCATGTTGCCCGG - Intronic
1089353052 11:117832225-117832247 CTGCCTCCTGCTATGGTTGCAGG + Intronic
1089640661 11:119845327-119845349 CTGCCTCTTGCCTTCTTTCCTGG - Intergenic
1090091628 11:123703221-123703243 CGGGATCTTGCTATGTTTCCTGG + Intergenic
1090510666 11:127371333-127371355 CTGGCTTTTGGAATATTTCCAGG - Intergenic
1091235428 11:134019146-134019168 CTGCCTTTTCCTCTGTTTGCTGG - Intergenic
1093488068 12:19674317-19674339 GTGCCTTTAGATATGTTTACTGG + Intronic
1093997204 12:25655180-25655202 TGGGGTTTTGCTATGTTTCCAGG + Intergenic
1094802302 12:34050388-34050410 TTCTCTTTTGATATGTTTCCAGG - Intergenic
1095599996 12:44002938-44002960 CTGCCATTTACTATTTTTCAAGG + Intronic
1095841054 12:46693443-46693465 CTGGATTTTGTTTTGTTTCCTGG + Intergenic
1096627686 12:52905267-52905289 CTGCCTTTTCCTGGGTTTCTGGG - Intronic
1096930174 12:55199314-55199336 CAGCCTTTCGAGATGTTTCCAGG - Intergenic
1098176326 12:67795317-67795339 CTGGCTTCTTCTATGTTTCCTGG - Intergenic
1098349777 12:69546446-69546468 CAGGGTTTTGCTATGTTACCTGG + Intronic
1098571583 12:71993544-71993566 CTGTCTTTTGCTCACTTTCCTGG + Intronic
1098796841 12:74899482-74899504 CTGCCTTTTGCCATTTCTCCAGG - Intergenic
1099472867 12:83073106-83073128 CTGTGTTTTGATGTGTTTCCAGG + Intronic
1101755088 12:107615121-107615143 CTGACTTTTGCTGTGTTGCATGG + Exonic
1101803969 12:108047451-108047473 CTACATTATGCAATGTTTCCTGG - Intergenic
1102237747 12:111304846-111304868 CTGCCTGTTGATATGTTGGCTGG - Intronic
1102544909 12:113647506-113647528 ATGCCTTTTGCTGTGTGACCAGG - Intergenic
1103282994 12:119775854-119775876 TTGCCTTTTGCTTTATTTCCTGG - Intronic
1103680811 12:122692180-122692202 CGGGGTTTTGCCATGTTTCCAGG + Intergenic
1104012816 12:124944024-124944046 CTGCCTTTTTCTTGCTTTCCTGG - Intergenic
1105341342 13:19528926-19528948 CAGGGTTTTGCCATGTTTCCAGG - Intronic
1106350423 13:28924254-28924276 CTAACTTTTGCTTTATTTCCAGG + Intronic
1107797614 13:44069228-44069250 CTGCATTTTACTATTTGTCCAGG - Intergenic
1108125514 13:47238664-47238686 CTGGCTGTTGCTCTGTTTCTGGG + Intergenic
1109029845 13:57178072-57178094 ATGCCTGTTCCTATGTTTCTTGG + Intergenic
1109298016 13:60558466-60558488 ATGCCTATTGATATGTTTTCAGG - Intronic
1109794449 13:67291521-67291543 ATGGCTTTTACTATGCTTCCTGG - Intergenic
1110167677 13:72462946-72462968 ATGCCTTTTGAAGTGTTTCCAGG + Intergenic
1110535129 13:76642424-76642446 CTGACTCTGGCTATGTTTACTGG + Intergenic
1110784004 13:79501707-79501729 TTGGCATTTGCTATGCTTCCTGG + Intronic
1112053419 13:95667900-95667922 CTGCCATTTTATTTGTTTCCTGG + Intergenic
1113338503 13:109399751-109399773 CAGCGTTTTGCCATGTTCCCAGG - Intergenic
1113618351 13:111696587-111696609 CTGCATTATGAGATGTTTCCAGG - Intergenic
1113623882 13:111781848-111781870 CTGCATTATGAGATGTTTCCAGG - Intergenic
1115077637 14:29411146-29411168 CTGCCTTTTGCAATTTTTCTTGG - Intergenic
1115862143 14:37699488-37699510 CTTCCTTTCTCTATGTTTCAAGG - Intronic
1116453409 14:45089601-45089623 ATGGTTTTTGCTATGTTGCCTGG + Intronic
1118723779 14:68612414-68612436 CTTCCTCTTGCTATCCTTCCCGG + Intronic
1120224731 14:81777965-81777987 TTGGGTCTTGCTATGTTTCCTGG + Intergenic
1121102134 14:91256968-91256990 CTGGATTTTGCTATGTTTCTTGG + Intergenic
1121585728 14:95061759-95061781 CTGCCCTTTGGTTTGTTTTCGGG - Intergenic
1122999636 14:105286376-105286398 CTGTCTTTTTTTGTGTTTCCAGG - Exonic
1124030792 15:26009383-26009405 TGGGCTTTTGCTATGTTGCCCGG + Intergenic
1124220990 15:27849439-27849461 CTGCCTTTGCCTGAGTTTCCTGG - Intronic
1124828868 15:33128192-33128214 CTGCTTTTTGCTTTTTTTCCCGG - Intronic
1125025273 15:35023432-35023454 CAGGGTTTTGCTATGTTGCCAGG + Intergenic
1126836641 15:52673631-52673653 CGGCCTTTTGCTAAATTCCCAGG - Intronic
1127668935 15:61175690-61175712 CTGGGTTTTGCTCTGTGTCCCGG - Intronic
1129155983 15:73718323-73718345 CGGGATCTTGCTATGTTTCCTGG + Intergenic
1129407915 15:75331300-75331322 CTGGGTCTTGCTATGTTGCCTGG - Intergenic
1129579443 15:76791688-76791710 CTGCTTTCTGCTAGGTTTCTTGG - Intronic
1130386474 15:83416524-83416546 CTGCCAGTGGCCATGTTTCCAGG + Intergenic
1132487184 16:200095-200117 CAGGGTTTTGCTATGTTGCCAGG - Intronic
1137637004 16:49995666-49995688 TTGCCTTTTGCATTGCTTCCAGG - Intergenic
1138032061 16:53567365-53567387 CTTCCTTTTTCTGTGTTTTCTGG - Intergenic
1138117403 16:54371371-54371393 CTGGGTCTTGCTATGTTCCCCGG - Intergenic
1138485688 16:57341630-57341652 CTGCCATTTGATATGTTTTGTGG - Intergenic
1138605857 16:58088344-58088366 CTGCCTTTTCCTGCCTTTCCTGG + Intergenic
1140888917 16:79268695-79268717 CTTCCTGTTGCAATGTTTCTTGG - Intergenic
1140929064 16:79610272-79610294 CTGCCCTCTGCTTTATTTCCTGG + Intergenic
1141492314 16:84382474-84382496 CTGCCTTTTGCCATCTCTCAGGG + Intronic
1143373891 17:6456213-6456235 CAGCGTCTTGCTATGTTGCCAGG + Intronic
1143828538 17:9632283-9632305 CTGGGTCTTGCCATGTTTCCAGG + Intronic
1144059792 17:11572964-11572986 CCCCCTTTTTCTTTGTTTCCAGG + Intergenic
1144209241 17:13000707-13000729 CTGCGTTTTGCCAAGGTTCCTGG - Intronic
1149426078 17:56556258-56556280 CTGCCTTTTCCCATGTTCCCCGG + Intergenic
1149909978 17:60558179-60558201 CAGGCTGTTGCTATGTTCCCTGG - Intergenic
1150196832 17:63307378-63307400 CTGCCCTTTCCTATGTTAGCAGG + Intronic
1151040172 17:70850411-70850433 CTGACTCTTGCTCTGTCTCCAGG + Intergenic
1151867876 17:76816369-76816391 CAGCGTTTTGCTCTGTTGCCCGG - Intergenic
1153196544 18:2604489-2604511 CTGGGTTTTGCCATGTTGCCTGG - Intronic
1154338859 18:13487204-13487226 GTGCCTTTTGCTACACTTCCTGG - Intronic
1154961768 18:21316590-21316612 TTGCCTTTTCCCATGTTACCTGG + Intronic
1155887568 18:31226514-31226536 CAGGGTTTTGCTATGTTGCCAGG - Intergenic
1155964270 18:32020882-32020904 CTGAGTTTTGCTCTGTTGCCCGG - Intronic
1156142263 18:34128771-34128793 CTATTTTTTGCTATATTTCCAGG - Intronic
1156357379 18:36353908-36353930 CTGCTTTTTTCTAGGTTTCAAGG + Intronic
1158258780 18:55586053-55586075 CTGCCTAGGGCTACGTTTCCTGG + Intronic
1158325898 18:56313790-56313812 CTGCCTTTTGGGATGATTGCAGG - Intergenic
1158575781 18:58636659-58636681 CAGGATTTTGCTATGTTGCCCGG - Intergenic
1158865786 18:61636519-61636541 TTGCCTTTTAATCTGTTTCCTGG - Intergenic
1159463379 18:68748634-68748656 CGGCTTTAGGCTATGTTTCCAGG - Intronic
1160043517 18:75366860-75366882 CTGCCTGTCGCTTTGTTTTCCGG + Intergenic
1160127259 18:76187310-76187332 CTGCCTTTTTATGTCTTTCCAGG - Intergenic
1160249677 18:77190699-77190721 TTGTCTATTGCTTTGTTTCCAGG + Intergenic
1161355249 19:3815607-3815629 CTGAGTTTTGCTCTGTTGCCCGG + Intronic
1162205166 19:9050319-9050341 CAGGGTTTTGCCATGTTTCCCGG + Intergenic
1162957078 19:14104986-14105008 CTGCTTTTTCTTATCTTTCCAGG + Intronic
1163236948 19:16035449-16035471 CTTCCTCTTGCCCTGTTTCCAGG + Intergenic
1163862931 19:19751679-19751701 CTTCCTCTTGCCTTGTTTCCAGG - Intergenic
1165895124 19:39136698-39136720 CTGCCCCTTGCTATGTTCTCAGG + Intronic
1167139814 19:47642507-47642529 CTGGGTTTTGCCATGTTCCCAGG - Intronic
926460940 2:13129191-13129213 CTATCTGTGGCTATGTTTCCAGG - Intergenic
926549150 2:14280032-14280054 CTACCTTCTGCTAGGTTTCCAGG - Intergenic
926637378 2:15196768-15196790 CTGCCTTTTGGTACTTTTCTTGG + Intronic
928329135 2:30344229-30344251 CTGCCTTCTTTTAGGTTTCCAGG - Intergenic
928704982 2:33939948-33939970 CTGCTTTTTGTTATTTTTCTGGG + Intergenic
929998570 2:46845789-46845811 CTGCCTGTTCCTCTGTCTCCCGG + Intronic
930203702 2:48567783-48567805 CTGACTTTGGCTTTGTTTCCAGG + Intronic
930545620 2:52763406-52763428 TTCCCAATTGCTATGTTTCCAGG + Intergenic
931562863 2:63581814-63581836 CAGGGTTTTGCCATGTTTCCAGG - Intronic
935960313 2:108419190-108419212 CTGCCTTTTAGGATGTTTACTGG - Intergenic
935994309 2:108751872-108751894 CTCAATTTTGCTACGTTTCCAGG - Exonic
936555085 2:113489368-113489390 TTCTGTTTTGCTATGTTTCCAGG - Intronic
936976823 2:118229179-118229201 CTGGCCTTTGATTTGTTTCCTGG + Intergenic
937575969 2:123422289-123422311 CTGCGTCTTGCTCTGTTACCCGG - Intergenic
938389210 2:130892032-130892054 CAGGGTTTTGCTGTGTTTCCTGG + Intronic
940490921 2:154359436-154359458 CTGCCTGTAGCGATGGTTCCTGG + Intronic
940762532 2:157752817-157752839 TTCCGTTTTGATATGTTTCCAGG - Intronic
940938029 2:159522546-159522568 CTGCCTTTGGTTATTTTTGCAGG - Intronic
941082926 2:161082694-161082716 CTGATTTTTGATAGGTTTCCTGG - Intergenic
942275760 2:174322100-174322122 CGGCCTTTTGCTAAGTTTTTAGG + Intergenic
944320761 2:198339342-198339364 CTGGCACTTGCTCTGTTTCCTGG - Intronic
944723311 2:202445648-202445670 CTGTCTTTTGCCATGTTGCCAGG + Intronic
945452567 2:210010452-210010474 CTGAGTTTCGCCATGTTTCCCGG + Intronic
946010652 2:216561068-216561090 CAGGATTTTGCTATGTTGCCTGG + Intronic
946626323 2:221615380-221615402 CAGGATTTTGCTATGTTGCCAGG + Intergenic
947564365 2:231184680-231184702 CTGCATTTTTCTATGCTTTCTGG + Intergenic
948095920 2:235334118-235334140 TTGCATTTTGCCACGTTTCCTGG - Intergenic
948312123 2:236995336-236995358 CTACCTTTTGCCATATTGCCAGG + Intergenic
948472141 2:238189972-238189994 CTGGCTTTTACTTTATTTCCAGG - Exonic
948747889 2:240109192-240109214 CTGCTCTTTGCTGTGTTCCCAGG + Intergenic
949001027 2:241613561-241613583 CAGTGTTTTGCTATGTTGCCTGG - Intronic
1169683708 20:8246571-8246593 TTGCCTTCTGCTATGTGTCCTGG - Intronic
1169848289 20:10020941-10020963 CTGCCTTGTGCTCTATTTCTAGG - Intronic
1170426892 20:16244142-16244164 GGAGCTTTTGCTATGTTTCCAGG - Intergenic
1170844517 20:19951082-19951104 CTGGGTTTTGCCATGTTGCCCGG + Intronic
1172301009 20:33850363-33850385 CTGCACTCTGCTAGGTTTCCAGG - Intronic
1174684797 20:52444000-52444022 CTGCCTTTTAATAGATTTCCTGG - Intergenic
1175091137 20:56505293-56505315 CGGGGTCTTGCTATGTTTCCAGG - Intronic
1175393945 20:58645838-58645860 CTGCATTTTACTTTTTTTCCAGG - Intergenic
1177771849 21:25525801-25525823 CTACCTTTTTCTCTTTTTCCAGG + Intergenic
1179276116 21:39893188-39893210 CTGCCTCATGCTCTGTTTTCTGG + Intronic
1179421244 21:41238428-41238450 CTGCCTTTGGCAATGCCTCCAGG - Intronic
1181572418 22:23774812-23774834 CAGCCTTTCGCAGTGTTTCCTGG + Intronic
1181873617 22:25922737-25922759 CTGCCTTTTGCTGTCTTCCTGGG - Intronic
1183245687 22:36691645-36691667 CTGCCATTTGCTGTGTGACCTGG + Intronic
1183794654 22:40106034-40106056 ATGCCTTTTCCTATGTTTATTGG + Intronic
1184524665 22:45014810-45014832 CTGCCTTCTGCTAAGCTGCCTGG + Intergenic
1184763080 22:46556337-46556359 CTTCCTTTTTCTTTTTTTCCTGG - Intergenic
949552751 3:5124666-5124688 CGGGCTCTTGCTATGTTGCCAGG + Intronic
949641387 3:6038828-6038850 CTGCCTTTTGCAATATTTCCAGG - Intergenic
950230247 3:11269974-11269996 CTGGGTCTTGCTATGTTGCCAGG - Intergenic
950320134 3:12043964-12043986 CTGCCTTGTGCCATTTGTCCAGG + Intronic
951212438 3:19990334-19990356 CAGGCTTTCGCTATGTTGCCCGG + Intronic
951516895 3:23569947-23569969 CTGCCTTAGGCTATGTTTTGTGG + Intronic
951748919 3:26012190-26012212 ATCCCTTTATCTATGTTTCCAGG + Intergenic
954726037 3:52611610-52611632 CAGGGTTTTGCTATGTTGCCAGG - Intronic
958993390 3:100873600-100873622 CAGCCTATTGTTATGTTTCACGG + Intronic
959142409 3:102502479-102502501 AGGCCTTTTTCAATGTTTCCTGG - Intergenic
959327875 3:104960745-104960767 CTGCCTTTTTCTAATTATCCTGG + Intergenic
959463970 3:106662674-106662696 CAGAGTTTTTCTATGTTTCCTGG - Intergenic
961115328 3:124324177-124324199 CTCCCTTTCACTATGCTTCCTGG + Intronic
962378966 3:134881395-134881417 CTGCATTTTGCTCTGCTTCTCGG - Intronic
962406588 3:135105801-135105823 TTGCATTTTGATATGCTTCCGGG - Intronic
962433013 3:135337983-135338005 TTGTCTCTTGCTCTGTTTCCAGG - Intergenic
964041844 3:152269657-152269679 TTGCCTTTTGCCAAGTTTACAGG + Intronic
964093570 3:152904627-152904649 CTGTTTAGTGCTATGTTTCCTGG - Intergenic
964200920 3:154118471-154118493 CTGCCTTCAACTATGTTTCTTGG - Intergenic
965590928 3:170358780-170358802 CTGCCTTGTGCTTTTTGTCCCGG + Intronic
969779112 4:9382464-9382486 CTGCCTTATTCTCTGATTCCAGG + Intergenic
969989530 4:11247571-11247593 CTGGGTCTTGCTATGTTGCCCGG + Intergenic
971214775 4:24652777-24652799 CTGCCAGCAGCTATGTTTCCAGG - Intergenic
972048993 4:34704149-34704171 TTGTCTTTTGGTGTGTTTCCAGG - Intergenic
973684823 4:53358774-53358796 CTGGCTTCTGATTTGTTTCCAGG - Intronic
974102805 4:57436419-57436441 CAGCGTATTTCTATGTTTCCTGG - Intergenic
974497832 4:62656227-62656249 CTGTTCTTTGCTATTTTTCCTGG - Intergenic
974853572 4:67432504-67432526 CTGCCTGTTGGTCTGTTCCCAGG - Intergenic
976071406 4:81244093-81244115 CTGCCATTTCCTATGTTTTCAGG + Intergenic
976799216 4:88969639-88969661 TTACCTTTTGTTTTGTTTCCAGG - Intronic
977366923 4:96081944-96081966 TTGCCTCTTGCATTGTTTCCAGG - Intergenic
979317493 4:119281600-119281622 CTGACTTTTGCTATGATTTCTGG - Intronic
980270738 4:130580969-130580991 CTTCCTTTTTCTTTCTTTCCTGG - Intergenic
980516990 4:133877060-133877082 TTGCCTTTTGCCAGTTTTCCAGG + Intergenic
982405710 4:155017704-155017726 CAGCCTTTTGCTATGTTCCTTGG - Intergenic
982978057 4:162092220-162092242 CTGCATGTTTATATGTTTCCAGG + Intronic
983724868 4:170908652-170908674 CTGCCTCTTGCACTGTTTCCAGG - Intergenic
983967664 4:173832681-173832703 GTGCCTTTTGCTAGATTTTCAGG - Intergenic
984616705 4:181906735-181906757 ATGGGTCTTGCTATGTTTCCCGG + Intergenic
984863841 4:184263816-184263838 CTGGCTTCTGCCATTTTTCCTGG - Intergenic
985677380 5:1239006-1239028 CTGTCTTTTGCTAGGACTCCGGG - Intronic
986623779 5:9704486-9704508 CTGCCTTTTGCTGTGCTTTGAGG - Intronic
989119612 5:37991246-37991268 CTGCCTTTTCTCATATTTCCTGG - Intergenic
989543585 5:42646467-42646489 CTGCCTTTTGCTTATTTACCTGG - Intronic
990683619 5:58274578-58274600 CTGCCTTTTTAAATGTTTTCTGG - Intergenic
992588994 5:78273650-78273672 CTGTTTTTTGTTGTGTTTCCTGG - Intronic
993851786 5:93019259-93019281 CTCCCTGATGCTGTGTTTCCCGG - Intergenic
994915696 5:105975823-105975845 CATCCTTATGGTATGTTTCCTGG + Intergenic
997181804 5:131836964-131836986 TTGCCTGTTCCTATGTCTCCAGG + Intronic
997911024 5:137873457-137873479 CTGCCTCTCTCTATGTCTCCCGG - Intronic
998888656 5:146722474-146722496 CTGACTTTTAGTTTGTTTCCTGG - Intronic
999185964 5:149709214-149709236 ATGCTTTTTGGTATGTTACCTGG - Intergenic
1000953663 5:167516056-167516078 TAGCATTTTGCTATGTTTTCTGG - Intronic
1001362945 5:171105504-171105526 CAGGTTTTTGCTATGTTCCCTGG - Intronic
1001964949 5:175903520-175903542 CTGCTTTTTCCCATGTTTCTAGG - Intergenic
1002169195 5:177366057-177366079 CTGCCACCTGCTATCTTTCCAGG + Intronic
1002252007 5:177935668-177935690 CTGCTTTTTCCCATGTTTCTAGG + Intergenic
1003128715 6:3377160-3377182 CTGCCTTATGCTATGGTGACAGG + Intronic
1005966019 6:30727006-30727028 ATTCCTTTTGCCATGTTTTCAGG + Intergenic
1007890005 6:45280361-45280383 CAGGCATGTGCTATGTTTCCTGG - Intronic
1008119477 6:47595584-47595606 CTGCTTTTTATTATGTTCCCAGG - Intronic
1008417898 6:51264778-51264800 CTGCCTTTCGTTAGGTGTCCAGG + Intergenic
1009488377 6:64254615-64254637 CTTCCTCTTGCTTTGTTCCCTGG + Intronic
1011735239 6:90303566-90303588 CTGCCTTTCTCCATCTTTCCAGG - Intergenic
1012607872 6:101181028-101181050 CTGCCTCGGGCTATGTTTTCTGG - Intergenic
1012662704 6:101922386-101922408 CTATCTTTAGCTATGTTTCTAGG + Intronic
1013221574 6:108082326-108082348 CTCACTTTTGCTATGCTTCATGG + Intronic
1013235316 6:108193487-108193509 CTGACTCTTGCTCAGTTTCCTGG - Intergenic
1013269522 6:108533030-108533052 ATGCCTTTTACTACATTTCCTGG - Intergenic
1014171197 6:118280843-118280865 CAGACTCTTGCTCTGTTTCCAGG - Intronic
1014575730 6:123069663-123069685 CTGGCTTTTTCTTTGTTTTCTGG - Exonic
1014987886 6:128034228-128034250 CTGCCTTTTTCTATGGTGACAGG - Intronic
1015702363 6:136050558-136050580 CTGCCTTCTGCATTGTTGCCTGG + Intronic
1015946248 6:138504280-138504302 CTGCCTTGTGTTAGGTGTCCAGG + Intronic
1016312421 6:142748087-142748109 CAGCATCTTGCTCTGTTTCCTGG - Intergenic
1016881610 6:148917202-148917224 CAGCCATTTGCTCTGTTTTCTGG + Intronic
1017466450 6:154698014-154698036 CTGCCTTGGGCTGAGTTTCCTGG + Intergenic
1017813075 6:157998118-157998140 CTGCCTGCTGCTCTGCTTCCAGG + Intronic
1018180661 6:161220676-161220698 CTGCCTTTCTCTATGTTTGAAGG + Intronic
1018372003 6:163177054-163177076 CTGCCTCTTGCTCTTTGTCCCGG - Intronic
1019583597 7:1782714-1782736 CTCCCTTTGGCTGTCTTTCCTGG + Intergenic
1020289346 7:6710878-6710900 CTCCCTTTTGCTAAGATTACAGG - Intergenic
1020653687 7:10905307-10905329 CTGCCTGTTTCCATGTTTCAGGG + Intergenic
1020772672 7:12414910-12414932 CAGGCTTTTGCTTTGTTGCCTGG - Intergenic
1021299295 7:18952368-18952390 CTGCCTATAGCTTTCTTTCCAGG + Intronic
1021928599 7:25556977-25556999 CTGCCTTTAAATATTTTTCCAGG - Intergenic
1022165115 7:27751841-27751863 CTGGGTTTTGCCATGTTGCCCGG + Intronic
1022170796 7:27827799-27827821 CAGGCTTTTGCTTTGATTCCAGG + Exonic
1024432760 7:49309313-49309335 TTGCCTCTTGCTTTATTTCCAGG + Intergenic
1026685470 7:72505649-72505671 CTGTCTTTTGCTAAGAATCCTGG - Intergenic
1026760598 7:73123064-73123086 CTGCCTTTTGCTCTGCTATCGGG + Intergenic
1026844634 7:73691622-73691644 CAGACTTTTGCTTTGTTGCCTGG + Intronic
1026890068 7:73976756-73976778 CTGCCTTTGACTTTGTTTCCTGG - Intergenic
1027036941 7:74931885-74931907 CTGCCTTTTGCTCTGCTATCGGG + Intergenic
1027086623 7:75269574-75269596 CTGCCTTTTGCTCTGCTATCGGG - Intergenic
1027455577 7:78387343-78387365 CTGCTGTTTGCTATCTTTCCTGG - Intronic
1028235753 7:88359856-88359878 CTGCTTTTTGCTATGCTCCAGGG + Intergenic
1029648868 7:101876667-101876689 CGGAGTTTTGCTATGTTGCCAGG - Intronic
1030274607 7:107706975-107706997 CGGCGTTTTGCCATGTTGCCAGG - Intronic
1030378684 7:108785661-108785683 ATTCCCTTTGCTATGTCTCCTGG + Intergenic
1031357520 7:120805428-120805450 CTGCATTTTGATATATTTCAAGG - Intronic
1031606005 7:123768842-123768864 CTTTTTTTTGCTATGATTCCAGG + Intergenic
1032789331 7:135231106-135231128 CTGCCTTTTTCATTCTTTCCTGG + Intergenic
1033987148 7:147240123-147240145 CGGCATCTTGCTATGTTGCCAGG - Intronic
1035637403 8:1156785-1156807 CTCCTTTTTGCTTTGTTCCCAGG + Intergenic
1036071992 8:5451017-5451039 TTGCATTTTCCTAAGTTTCCAGG - Intergenic
1036393770 8:8349005-8349027 CTGCCTTTTGCAAGTTTTGCTGG - Intronic
1036512120 8:9410204-9410226 CTGGGTTTCGCTATGTTGCCCGG - Intergenic
1037713424 8:21374987-21375009 CTGTATTTTGATGTGTTTCCAGG + Intergenic
1037862464 8:22415609-22415631 ATAGCTTTTGCTATGTTTCTGGG + Intronic
1039290832 8:36092835-36092857 CAGGCTTTCTCTATGTTTCCTGG + Intergenic
1041150213 8:54924686-54924708 TTGAGTTTTGCTATGTTTCTAGG + Intergenic
1042382679 8:68136493-68136515 CTGGCTTTGGCAATGTTTGCTGG + Intronic
1044255584 8:90056747-90056769 CAGCCTTTCGCCATGTTGCCAGG + Intergenic
1044310067 8:90683303-90683325 CTTCCTTTTTGTATGTTTTCAGG - Intronic
1044387250 8:91603492-91603514 CTGCATCTTGCTCTGTTGCCGGG - Intergenic
1045122129 8:99049280-99049302 CTCTGTTTTGATATGTTTCCAGG + Intronic
1045884632 8:107080744-107080766 TTGCCTTTGGGTATGTGTCCAGG + Intergenic
1047135401 8:122072199-122072221 CTGCCTTTTCCTATATTATCAGG + Intergenic
1049152845 8:141046663-141046685 TTTCATTTTGCAATGTTTCCAGG - Intergenic
1049623148 8:143608126-143608148 CTTCCTTTTCCTTTCTTTCCAGG - Exonic
1050714740 9:8510091-8510113 CAGGGTTTTGCTATGTTGCCTGG - Intronic
1051742268 9:20263437-20263459 CTGGGTCTTACTATGTTTCCAGG + Intergenic
1052382353 9:27785162-27785184 CTGGCTTCAGCTCTGTTTCCAGG + Intergenic
1054818975 9:69503145-69503167 TTGCCTTTCTCTGTGTTTCCAGG + Intronic
1058603059 9:106691936-106691958 CTGGCATTTGCTAAGATTCCTGG + Intergenic
1059512846 9:114865391-114865413 TTGCCTTAGGCTTTGTTTCCAGG - Intergenic
1059632095 9:116135705-116135727 CTGCCTCTTGATATGATGCCAGG - Intergenic
1060092738 9:120758486-120758508 CTGTCTTATGCTTTGCTTCCAGG - Exonic
1061492020 9:130950503-130950525 CAGGGTTTTGCTATGTTGCCAGG + Intergenic
1061998071 9:134198333-134198355 CAGGGTCTTGCTATGTTTCCAGG - Intergenic
1185714606 X:2330990-2331012 CTCCCTTCTGCTAAGTTTGCGGG - Intronic
1187388913 X:18873096-18873118 CTGGCGTTTGCTCTTTTTCCTGG + Intergenic
1187553676 X:20331036-20331058 CTACCTTGTTCTATATTTCCAGG + Intergenic
1188132598 X:26455653-26455675 CTGCCTTATTCTATCTCTCCTGG + Intergenic
1188745798 X:33841621-33841643 CTGCCTTTTGTTTTTTTTCTTGG + Intergenic
1189145718 X:38652774-38652796 CTGCGTTTACCCATGTTTCCTGG + Intronic
1189189249 X:39083453-39083475 CTGCCATTTGCTCTTTTTCAGGG - Intergenic
1189674029 X:43442991-43443013 CTGCCTTTTCCTGTGGCTCCTGG - Intergenic
1189819721 X:44858520-44858542 CTGCCATTTCCTTTATTTCCAGG - Intergenic
1190341713 X:49302071-49302093 CGGGGTTTTGCCATGTTTCCCGG + Intergenic
1190343905 X:49320452-49320474 CGGGGTTTTGCCATGTTTCCCGG + Intergenic
1190344999 X:49329996-49330018 CGGGGTTTTGCCATGTTTCCCGG + Intergenic
1190346093 X:49339561-49339583 CGGGGTTTTGCCATGTTTCCCGG + Intergenic
1190347346 X:49530592-49530614 CGGGGTTTTGCCATGTTTCCCGG + Intergenic
1190348445 X:49540148-49540170 CGGGGTTTTGCCATGTTTCCCGG + Intergenic
1190349546 X:49549704-49549726 CGGGGTTTTGCCATGTTTCCCGG + Intergenic
1190350650 X:49559257-49559279 CGGGGTTTTGCCATGTTTCCCGG + Intronic
1190351752 X:49568815-49568837 CGGGGTTTTGCCATGTTTCCCGG + Intergenic
1190352852 X:49578364-49578386 CGGGGTTTTGCCATGTTTCCCGG + Intergenic
1190353953 X:49587911-49587933 CGGGGTTTTGCCATGTTTCCCGG + Intergenic
1190355055 X:49597435-49597457 CGGGGTTTTGCCATGTTTCCCGG + Intronic
1190655972 X:52612403-52612425 CTGCCTTTTGCTATGTTTCCAGG + Intergenic
1190794328 X:53726764-53726786 CAGCCTTTTGCTATGTTGCCAGG + Intergenic
1190871482 X:54428185-54428207 CAGAGTCTTGCTATGTTTCCAGG - Intergenic
1192548708 X:72036150-72036172 TTTCCTTTAGCCATGTTTCCAGG + Intergenic
1195514084 X:105752518-105752540 CTGCATTGTGCTCTATTTCCTGG + Intronic
1195515618 X:105772192-105772214 CTGCCTTTTTCTGAGTATCCAGG - Intergenic
1197011808 X:121573283-121573305 CTGTCATTTGCTCTGTTTCTGGG + Intergenic
1197089766 X:122522686-122522708 CTGCACTTTGCTATGCTTCATGG - Intergenic
1198561211 X:137851996-137852018 CTGCCTTTGCCTAGATTTCCTGG - Intergenic
1198677200 X:139143890-139143912 CTGCCTTCTAGTATGGTTCCAGG + Intronic
1199557236 X:149122692-149122714 CTGCCATTTCCTCTGGTTCCAGG + Intergenic
1200332582 X:155313155-155313177 TGGCATTTTGCTATGTATCCTGG - Intronic
1201965699 Y:19732276-19732298 CTGCATTTTCATATGTTTCCAGG + Intronic