ID: 1190662057

View in Genome Browser
Species Human (GRCh38)
Location X:52663874-52663896
Sequence TGTACACGGGCCACTGCAAT GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 103
Summary {0: 2, 1: 1, 2: 3, 3: 10, 4: 87}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1190662057 Original CRISPR TGTACACGGGCCACTGCAAT GGG Intronic
902080440 1:13816834-13816856 TGTACAGTGGGCACTACAATAGG + Intronic
902875343 1:19337615-19337637 GGTACAGGGGCCACTGCAGTGGG - Intergenic
905954882 1:41984247-41984269 TGGACATGAGCCACTGCACTGGG + Intronic
910719694 1:90272460-90272482 AGTAGAGGGACCACTGCAATAGG - Intergenic
916289066 1:163143928-163143950 TGTACACAAGCCATTTCAATAGG - Intronic
917462539 1:175244851-175244873 TGTACCCGGGTAACTGCATTGGG + Intergenic
922232625 1:223700001-223700023 GGCATAGGGGCCACTGCAATGGG - Intergenic
924225821 1:241920880-241920902 TGTACACAGAAAACTGCAATAGG + Intergenic
1064646181 10:17462113-17462135 TGGGCACGAGCCACTGCACTTGG - Intergenic
1065311969 10:24425007-24425029 TGTACACTGGCATCTGAAATGGG - Intronic
1069367508 10:67709861-67709883 AGTATAGGGACCACTGCAATAGG - Intergenic
1074252029 10:111760677-111760699 TGTACATGGCTCACTGGAATGGG - Intergenic
1077354635 11:2109392-2109414 TTTACACGGGCTGCTGCAGTGGG - Intergenic
1082939524 11:58689461-58689483 GGTATAGGGACCACTGCAATGGG + Intronic
1084620821 11:70269415-70269437 TGTCCACTGGCCACTGCTGTTGG - Intergenic
1086836534 11:91631245-91631267 GGTGTAGGGGCCACTGCAATTGG + Intergenic
1088681553 11:112247698-112247720 TGTATAGGGACCACTGCAACAGG - Intronic
1089945046 11:122461950-122461972 GGGACAAGGGCCACTGCAATTGG + Intergenic
1093886386 12:24466386-24466408 TAGACACGAGCCACTGCACTTGG + Intergenic
1100950428 12:99842733-99842755 GGTATAGGGACCACTGCAATGGG - Intronic
1100989212 12:100234222-100234244 GGTACAGGGACCACTGCTATGGG + Intronic
1102380934 12:112466359-112466381 TGCACACAGGCCAGTACAATTGG + Intronic
1108291479 13:48966192-48966214 GGTAGAGGGACCACTGCAATGGG + Intergenic
1110893231 13:80716117-80716139 GGTATAGGGACCACTGCAATAGG + Intergenic
1112063937 13:95771363-95771385 GGTAGAGGGGCCACTGCAGTGGG + Intronic
1112558325 13:100489716-100489738 TTTACCCAGGCCACTGCAGTAGG + Intronic
1124510057 15:30316331-30316353 TTTACAGGGGCCACTGAACTTGG + Intergenic
1124732833 15:32214222-32214244 TTTACAGGGGCCACTGAACTTGG - Intergenic
1134107905 16:11497161-11497183 TGTGCACGTCCCAGTGCAATGGG + Intronic
1134880374 16:17740712-17740734 TGGACATGAGCCACTGCATTTGG + Intergenic
1135054631 16:19220656-19220678 TGTACAGGGACCACAGTAATGGG + Intronic
1139289484 16:65844596-65844618 TGTCCGCAGGCCACTGCATTTGG + Intergenic
1144673387 17:17145736-17145758 TGTACAGGGCCCACTGCACAGGG - Intronic
1146935686 17:36811302-36811324 CTTACGCGGGCCACTGCACTAGG + Intergenic
1147377190 17:40029536-40029558 TGTACACCAGGCACTGCAGTAGG - Intronic
1147719665 17:42531230-42531252 GGATCAGGGGCCACTGCAATGGG + Intergenic
1152219708 17:79056531-79056553 GGTACAGGGACCATTGCAATGGG + Intergenic
1153134910 18:1905711-1905733 GGTACAGGGGCCACTGCAATGGG + Intergenic
1153354646 18:4121726-4121748 GGTACAGGGACCACTGCAACAGG - Intronic
1156774633 18:40772060-40772082 GGTATAGGGACCACTGCAATAGG - Intergenic
1159507495 18:69356093-69356115 GGTTCAAGGGCCACTGCAATGGG - Intergenic
1164488365 19:28682697-28682719 TGTACATGTGACACTGCATTTGG + Intergenic
1165362394 19:35344960-35344982 TGGACACGGGCCTCTGCCAAGGG - Intronic
1168517925 19:57023935-57023957 GGTATAGGGGCCACAGCAATGGG + Intergenic
931892990 2:66695571-66695593 GGGACAAGGGCCACTGCTATGGG + Intergenic
937468474 2:122155314-122155336 TGGACAGGGGCCACTGCTCTGGG + Intergenic
940627375 2:156192271-156192293 TGCACACGTTCCACTGCAAATGG - Intergenic
1168860812 20:1044810-1044832 TGAACACCGGCCTCTGCAAATGG - Intergenic
1171452389 20:25245421-25245443 GGTACAGGGACCACTGCAACGGG + Intergenic
1174380778 20:50154001-50154023 GGTTCACGGGCCCATGCAATGGG + Intergenic
1174428153 20:50448052-50448074 TGCACCCGGACCACTGCAGTGGG - Intergenic
1177443835 21:21165793-21165815 TGTACAAGGGCCAATTCATTTGG - Intronic
1178929108 21:36802123-36802145 TGGACTTGGGCCACTGCAGTTGG - Intronic
1182137754 22:27921522-27921544 AGTATACGGACCACTGTAATGGG + Intergenic
1182219041 22:28743112-28743134 TGTAGAGGGGCCACTGCAATAGG + Intronic
1183493913 22:38131295-38131317 TGTACACGAGCCACTGCAGCTGG + Intronic
1184857038 22:47151953-47151975 TGCACACGGCCCTCTGCAGTGGG - Intronic
1184910727 22:47532232-47532254 GGTATAGGGGCCACTGCAAAGGG + Intergenic
951461723 3:22958241-22958263 TGTACAGGGACCACTGCAATGGG - Intergenic
953878837 3:46681287-46681309 GGTACACGGGCCACTGGGAGAGG - Exonic
957264234 3:77941292-77941314 TTTACACATGCCAGTGCAATAGG + Intergenic
960122227 3:113958530-113958552 TGGACACAGGCCAGTACAATAGG + Exonic
962108030 3:132414093-132414115 GGTACAGGAGCCACTGCAACAGG - Intergenic
966772676 3:183517950-183517972 TGAACACAGGCAGCTGCAATAGG + Intronic
970329826 4:14968766-14968788 TGTACACTGGCAATTGCAAATGG + Intergenic
970855571 4:20646895-20646917 GGTATAGGGACCACTGCAATGGG - Intergenic
971390883 4:26184282-26184304 GGTACAGGGATCACTGCAATGGG + Intronic
977165007 4:93683937-93683959 GGTATAGGGACCACTGCAATGGG + Intronic
977932816 4:102767191-102767213 TATACATGGGCCACTGCACCTGG - Intergenic
977993626 4:103476086-103476108 AGTACAGGGACCACTGAAATGGG + Intergenic
980132201 4:128827174-128827196 GGTACAGGGAACACTGCAATGGG - Intronic
989134694 5:38142168-38142190 TCAAAATGGGCCACTGCAATGGG - Intergenic
989201806 5:38771323-38771345 TGAACTCAGGCCACTGAAATGGG - Intergenic
991139769 5:63226700-63226722 GGTGCAGGGACCACTGCAATGGG + Intergenic
991257764 5:64634030-64634052 GGTACAGGGACCACTGCAATGGG + Intergenic
995356483 5:111243132-111243154 TGAATAGGGACCACTGCAATGGG + Intronic
1003753472 6:9089102-9089124 TGTACACAGAGCACTGCAATTGG + Intergenic
1007044605 6:38759934-38759956 GGTATAGGGACCACTGCAATGGG - Intronic
1008157610 6:48035941-48035963 AGTACAGGGAGCACTGCAATGGG - Intronic
1008545820 6:52582220-52582242 CAGACATGGGCCACTGCAATTGG + Intergenic
1009380776 6:63026211-63026233 GGTATAGGGGCCACTGTAATAGG + Intergenic
1010004770 6:70983765-70983787 GGTATAGGGACCACTGCAATGGG + Intergenic
1012497062 6:99844965-99844987 GGTATAGGGACCACTGCAATGGG - Intergenic
1015646235 6:135391788-135391810 GGTACAGGGACTACTGCAATGGG + Intronic
1016968683 6:149742487-149742509 TGTACATGGTGCACTGCTATAGG + Exonic
1017144020 6:151217548-151217570 TGTATAGGGACCACTGCAATGGG - Intergenic
1019364262 7:623723-623745 GGTACAGGGATCACTGCAATGGG - Intronic
1025963400 7:66245232-66245254 GGTACAGGGACCACTGCAGTCGG + Intronic
1030845208 7:114400843-114400865 GGTACAGGGACCACTGCAATGGG + Intronic
1035716507 8:1759316-1759338 GGTGCAGGGGCCACTGCAGTGGG + Intronic
1053185330 9:36011639-36011661 TGTATAGGGACCACTGCCATGGG + Intergenic
1056443439 9:86642408-86642430 TGAACACTGGCAACTGCAACAGG - Intergenic
1057211582 9:93203568-93203590 TGTGGACGTGCCACTGCACTCGG + Intronic
1185481842 X:452046-452068 TGTGAACAGGCCACTTCAATGGG + Intergenic
1189615591 X:42779771-42779793 GATACACGAACCACTGCAATGGG - Intergenic
1190175607 X:48146546-48146568 GGTACAGGGACCACCGCAATGGG - Intergenic
1190182481 X:48204952-48204974 TGTACACGGGCCACTGCAACGGG + Intronic
1190182893 X:48208438-48208460 GGCACAGGGACCACTGCAATGGG - Intronic
1190195607 X:48315662-48315684 TGTACACGGGCCACTGCAATGGG + Intergenic
1190201714 X:48367476-48367498 GGTACAGGGACCACTGCAATGGG + Intergenic
1190208825 X:48427935-48427957 GGTACAGGGACCACTGCAATGGG - Intergenic
1190662057 X:52663874-52663896 TGTACACGGGCCACTGCAATGGG + Intronic
1190662469 X:52667403-52667425 GGCACAGGGACCACTGCAATGGG - Intronic