ID: 1190679402

View in Genome Browser
Species Human (GRCh38)
Location X:52811792-52811814
Sequence GCAGAGGTGCCCGCCCGGTG AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 147
Summary {0: 1, 1: 0, 2: 0, 3: 14, 4: 132}

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1190679398_1190679402 -2 Left 1190679398 X:52811771-52811793 CCAAGGTTTGTATAACGAACCGC 0: 1
1: 0
2: 0
3: 0
4: 21
Right 1190679402 X:52811792-52811814 GCAGAGGTGCCCGCCCGGTGAGG 0: 1
1: 0
2: 0
3: 14
4: 132
1190679396_1190679402 0 Left 1190679396 X:52811769-52811791 CCCCAAGGTTTGTATAACGAACC 0: 1
1: 0
2: 0
3: 2
4: 40
Right 1190679402 X:52811792-52811814 GCAGAGGTGCCCGCCCGGTGAGG 0: 1
1: 0
2: 0
3: 14
4: 132
1190679394_1190679402 6 Left 1190679394 X:52811763-52811785 CCGCCACCCCAAGGTTTGTATAA 0: 1
1: 0
2: 2
3: 11
4: 151
Right 1190679402 X:52811792-52811814 GCAGAGGTGCCCGCCCGGTGAGG 0: 1
1: 0
2: 0
3: 14
4: 132
1190679397_1190679402 -1 Left 1190679397 X:52811770-52811792 CCCAAGGTTTGTATAACGAACCG 0: 1
1: 0
2: 0
3: 0
4: 12
Right 1190679402 X:52811792-52811814 GCAGAGGTGCCCGCCCGGTGAGG 0: 1
1: 0
2: 0
3: 14
4: 132
1190679395_1190679402 3 Left 1190679395 X:52811766-52811788 CCACCCCAAGGTTTGTATAACGA 0: 1
1: 0
2: 1
3: 2
4: 33
Right 1190679402 X:52811792-52811814 GCAGAGGTGCCCGCCCGGTGAGG 0: 1
1: 0
2: 0
3: 14
4: 132
1190679392_1190679402 18 Left 1190679392 X:52811751-52811773 CCGGACTGGTGACCGCCACCCCA 0: 1
1: 0
2: 1
3: 14
4: 120
Right 1190679402 X:52811792-52811814 GCAGAGGTGCCCGCCCGGTGAGG 0: 1
1: 0
2: 0
3: 14
4: 132

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1190679402 Original CRISPR GCAGAGGTGCCCGCCCGGTG AGG Intergenic
900508385 1:3042663-3042685 GCAGTGGTGCATGCCAGGTGCGG - Intergenic
902228026 1:15009041-15009063 GCACACGAGCCCGCCCGCTGGGG + Intronic
912276348 1:108262323-108262345 GCAGGGATGCCCTCCAGGTGAGG - Intergenic
912291880 1:108432035-108432057 GCAGGGATGCCCTCCAGGTGAGG + Intronic
915271878 1:154759299-154759321 GCTGAGGTGCCCGTCCTTTGAGG + Intronic
923391193 1:233515501-233515523 GCAGAGTTGCCAGCTGGGTGAGG + Intergenic
923731731 1:236557781-236557803 GCAGAGGGGCCCACCCAGTTAGG - Intronic
924614962 1:245605309-245605331 CCAGGGGTGCCCACCCTGTGGGG - Intronic
1063652215 10:7948979-7949001 GCAGAGGTGCTGGGCGGGTGGGG + Intronic
1070813283 10:79309033-79309055 GCGGATGTGCCAGGCCGGTGGGG + Intronic
1073580346 10:104659970-104659992 GCAGAGATGCCTGCACAGTGGGG + Intronic
1076227751 10:128793939-128793961 ACAGTGGTGCCAGCCCAGTGAGG + Intergenic
1076335455 10:129703668-129703690 GCAAAGGTGCCCCCCCGGCGAGG - Intronic
1077199362 11:1297744-1297766 GCAGAGGTGCCTGAGCGGAGTGG + Intronic
1080595839 11:33774043-33774065 CCGCAGGTGCCCGCCCGGTTGGG - Intronic
1080749444 11:35139009-35139031 GCAGAGGGGCCCGCCCGGGAGGG + Intronic
1083165167 11:60880285-60880307 GCAGATGTGCCGGTCCTGTGTGG - Intergenic
1084408427 11:68992155-68992177 CCAGAGGACCCCTCCCGGTGGGG + Intergenic
1085076712 11:73598098-73598120 GCCGAGGAGCCCGACGGGTGGGG + Exonic
1088686349 11:112287396-112287418 GCAGAGGTGCCCACCTGGGAAGG - Intergenic
1092206894 12:6620287-6620309 GCCGAGGTCCTGGCCCGGTGCGG + Exonic
1094493204 12:30974096-30974118 GCAGAGGTGCCCTCCCAGGCAGG + Intronic
1095349166 12:41188828-41188850 GGTGAGGTGCCCGCGCGGGGGGG + Exonic
1096519197 12:52174601-52174623 GCAGCAGTGCCAGCCTGGTGAGG - Intronic
1096691631 12:53325342-53325364 CCGGAGGAGCCCGCCCGGCGGGG + Intergenic
1100844556 12:98645185-98645207 GCAGCGGTGGCCGCCCCTTGGGG + Exonic
1103173794 12:118844363-118844385 GCACAGGTGCCAGCTCTGTGAGG - Intergenic
1103557162 12:121773568-121773590 GCAGGGCTGCACTCCCGGTGTGG - Intronic
1103565494 12:121813186-121813208 GCAGAGCCCCCCGCCCTGTGAGG + Intronic
1104961109 12:132489248-132489270 TCGGAGGGGCCCGCCTGGTGGGG - Intergenic
1105374135 13:19828181-19828203 GCAGAGGTGTGGGCCAGGTGCGG + Intronic
1110131649 13:72018814-72018836 GCAGAGGTGGCCTTCCGGTGAGG + Intergenic
1113984563 13:114303493-114303515 GCAGAATTGTCGGCCCGGTGCGG + Intronic
1116887128 14:50232007-50232029 GCACAGGCGCCAGCCCGGCGCGG + Intergenic
1122262328 14:100530615-100530637 GCAGGTGTGCCCGCCTGGTGAGG + Intergenic
1122957351 14:105076898-105076920 GCAGAGTTGCCCGCCCACGGCGG + Intergenic
1126675207 15:51155011-51155033 GCTGAGGGGCCCGCCTGGTTTGG + Intergenic
1126688380 15:51267572-51267594 GCAGCGGTGTTCGCCGGGTGGGG + Intronic
1128665923 15:69538487-69538509 GCTGAGGTGTCCACACGGTGTGG - Intergenic
1132550600 16:552500-552522 GCAGGGGTGCCCGGCAGGGGCGG - Exonic
1133069339 16:3235397-3235419 GGAGAGGTGCCAGCCCGTCGTGG - Intronic
1134164015 16:11915767-11915789 GCAGGGGCGCCCGGCCGGAGAGG + Exonic
1135402848 16:22178188-22178210 GCAGAGGCACCTGCCCCGTGTGG + Exonic
1138501462 16:57447562-57447584 GCTGCGATGCCTGCCCGGTGAGG + Exonic
1138590498 16:57996996-57997018 GCACAAGTGCCTGCCCGGCGCGG - Exonic
1139597729 16:67968161-67968183 GCAGACGTGGCCGCCCAGGGAGG - Intronic
1142495802 17:305696-305718 GGAGAGGAGCCCACCAGGTGTGG - Intronic
1143189828 17:5033277-5033299 GCAGTGGTGCCCACCAGGGGTGG + Exonic
1143200710 17:5111494-5111516 GGGCAGGTGCCCGCCCGGGGAGG + Intronic
1145255071 17:21317958-21317980 GCAGGGGTGGGCGCCCGGGGTGG - Intergenic
1146446592 17:32937188-32937210 ACAGAGGTGCCCTCCCGGGTGGG - Intronic
1148355294 17:46971864-46971886 GGAGAGGTGCCCAACAGGTGTGG - Intronic
1152137713 17:78514722-78514744 GCAGAGCTGGCCGCCAGGGGCGG + Intronic
1153464514 18:5374352-5374374 GCAGAAGTTCCCGACTGGTGTGG + Intergenic
1153480534 18:5543211-5543233 GCAGCGGCCCCCGGCCGGTGGGG - Intronic
1153814412 18:8780291-8780313 GCAGAGTTGCCTGCATGGTGCGG - Intronic
1154365957 18:13709347-13709369 GCAGAGCTGCAAGCCCAGTGTGG - Intronic
1157201242 18:45661710-45661732 GCAGAGGTGCCTTCCCAGTCTGG + Intronic
1157334676 18:46729220-46729242 GCAGAGGTGACCGCTGAGTGAGG - Intronic
1161032030 19:2061986-2062008 GCAGGGGCGCCCGCCAGGGGAGG - Intergenic
1161468035 19:4442921-4442943 GCAGAGGTCCAAGCCCCGTGTGG + Exonic
1161568171 19:5015028-5015050 GCAGAGGAGCTCGCCCCCTGGGG - Intronic
1163441337 19:17323933-17323955 GCAGGGTTGCCAGCCCGGCGGGG - Intronic
1165996783 19:39849250-39849272 CCAGAGGTCCCAGCCTGGTGGGG + Intergenic
1166723376 19:45010428-45010450 GCAGAGCTGATAGCCCGGTGTGG + Intronic
1168444955 19:56404026-56404048 GCCGGGGTGCCAGCGCGGTGAGG - Intronic
1168689492 19:58368297-58368319 GCTGGGGTGCCCGCCCTGCGGGG - Exonic
925169104 2:1740206-1740228 GCAGAGGGGCCCGCCTGCCGGGG - Intronic
926225521 2:10964515-10964537 GCAGAGGTCCCCACCCAGCGGGG - Intergenic
926400525 2:12491763-12491785 ACAGAGGTGCCAGCATGGTGGGG - Intergenic
927830564 2:26346342-26346364 GCTGAGGGGCCCGCGCGGCGCGG + Intronic
928432020 2:31228041-31228063 GCAAAGGAGCCCGCGTGGTGAGG + Intronic
933090434 2:78110469-78110491 GCTGAGGTGCCCGGCTTGTGGGG - Intergenic
933655189 2:84881088-84881110 GCAGAGGTGGCCGCCCGCCCTGG + Exonic
934745902 2:96759683-96759705 CCACAGCTGCCCGCCCTGTGAGG - Intergenic
936509524 2:113133828-113133850 GCAGAGCTCCCAGCCCGGTGGGG - Exonic
937218979 2:120330578-120330600 GCAGAGGTGCCGGCAGGGTCAGG - Intergenic
946332407 2:219017870-219017892 GCAGAGCTGCCAGCCTGGTGGGG - Intronic
946422476 2:219572409-219572431 GCAGCTGTGCCCACCCTGTGGGG - Exonic
948485553 2:238278748-238278770 GCAGAGGGGCCTGGCAGGTGTGG + Intronic
948725639 2:239932122-239932144 GCAGAGGTGCAGGCCGGGCGCGG - Intronic
948751604 2:240136377-240136399 TCTGTGGTGCCCGCCCGCTGGGG + Intronic
1171391974 20:24807439-24807461 GCAGAGGTGCCAGGCAGTTGAGG + Intergenic
1172937337 20:38629606-38629628 GCAGAGGTGCCTCCCCGGGATGG - Exonic
1173642945 20:44616230-44616252 GAAGAGGTGCCTCCCCGGTCTGG - Intronic
1174611646 20:51802247-51802269 GCTGGGGCGCCCGCCCGGGGAGG - Intronic
1175251946 20:57615217-57615239 GCAGAGGTGCCCTGAGGGTGGGG + Intronic
1175801656 20:61804470-61804492 GCAGAGCTGCCCCCCGGGTGTGG - Intronic
1176125773 20:63473805-63473827 TCAGTGCTGCCCGCCCTGTGAGG + Intergenic
1179975254 21:44861761-44861783 GCACAGGTGCCCGGCGTGTGGGG - Intronic
1180704026 22:17797839-17797861 GCCGACGTGCCTGCCCGCTGTGG - Intronic
1181144323 22:20833457-20833479 GCAGTGGTGCACGGCCGCTGGGG + Intronic
1181639411 22:24188873-24188895 GCACTGGTGCCCGCACGGTCCGG - Exonic
1183744848 22:39686294-39686316 GCAGCGGTGCCCGGCCGGGGGGG - Exonic
1184128809 22:42505137-42505159 GCAGAGGTGGGTGCCCGGTGTGG + Intergenic
1184137604 22:42558452-42558474 GCAGAGGTGGGTGCCCGGTGTGG + Exonic
960993962 3:123329062-123329084 CCAGAGGTGCCCTCCTGGAGGGG - Intronic
962363453 3:134760844-134760866 GCAGAGGTGCCCTCCAAGTCCGG - Intronic
962408157 3:135117921-135117943 GCAGAGGTGCCCAGAAGGTGAGG + Intronic
965310097 3:167116456-167116478 GCAGAGCTGCCCGCCAGCCGGGG - Intergenic
968592623 4:1466471-1466493 GCAGAGGTCCCTGGCCGGGGTGG + Intergenic
968737303 4:2304088-2304110 GCAGAGGCACCTGCCCTGTGGGG - Intronic
968775581 4:2537474-2537496 GGAGACGTCCCCGCCCGTTGAGG - Intronic
969842856 4:9895614-9895636 CCAGAGGTCCCAGCCCTGTGGGG - Intronic
980740805 4:136947384-136947406 GCACAGGTGCCAGCACTGTGGGG - Intergenic
985579316 5:688755-688777 GCAGAGGTGCCACCCCGCCGAGG + Intronic
985594161 5:780814-780836 GCAGAGGTGCCACCCCGCCGAGG + Intergenic
992962654 5:81971837-81971859 GGAGAGCTGCCCGCCAGGCGAGG + Intergenic
997384840 5:133464514-133464536 GCAGAGGGGCCGGCCTCGTGGGG + Intronic
997798997 5:136841034-136841056 GCAGAGGTGGCCAGACGGTGGGG + Intergenic
999229243 5:150052069-150052091 ACAGAGCTGCCAGCCTGGTGAGG + Exonic
999448929 5:151664204-151664226 GCAGTGGAGCCAGCTCGGTGTGG + Exonic
1000180225 5:158802072-158802094 TCAGAGGTGCCTGCCCATTGAGG + Intronic
1001964086 5:175898084-175898106 GCAGAGATGCGGGCCCTGTGTGG + Intergenic
1003267190 6:4576140-4576162 GCAGATGTGCCCTCCCTCTGTGG + Intergenic
1005838193 6:29723569-29723591 AGTGAGGGGCCCGCCCGGTGGGG + Intronic
1006611651 6:35297833-35297855 GCTGAGGCGCCCGCCCGGCTGGG - Exonic
1007363270 6:41373352-41373374 GCGGAGGTCCCGGCCCGGTGGGG - Intergenic
1007546660 6:42699545-42699567 GAAGTGGTGCCCACCCCGTGTGG + Intronic
1010120082 6:72365094-72365116 ACAGAGGTGCCCAGCCAGTGAGG + Intronic
1011124452 6:83992568-83992590 CCAGAGGTGGCTGCCTGGTGGGG - Intergenic
1013273055 6:108560377-108560399 GCAGAGGTTCGAGCCCGGCGGGG - Intronic
1019354831 7:573017-573039 GCGGCGGGGCCCGGCCGGTGGGG - Intronic
1022136940 7:27457836-27457858 GCAGAGGTGGCCGCCGTGGGGGG - Intergenic
1024231494 7:47367196-47367218 ACAGAGGTGCACGCCAGGAGAGG - Intronic
1026926202 7:74195613-74195635 GCAGAGGTGGCCGCCGTGGGGGG + Exonic
1033028985 7:137806721-137806743 GCAGAGGTTCAGGCCGGGTGCGG - Intronic
1033756946 7:144403751-144403773 GCACACCTGCCCGCCCGGCGAGG - Intronic
1034462406 7:151205148-151205170 GCAGTGGGGCCCTCCAGGTGTGG + Intronic
1036787503 8:11697802-11697824 GCAAGGGTGCCGGGCCGGTGGGG + Intronic
1044693415 8:94900254-94900276 GCAGAGGTGTGCTCTCGGTGGGG + Intronic
1048183271 8:132215703-132215725 GCAGATGTGCCTGCCAGGTGAGG + Intronic
1049767266 8:144360675-144360697 GCCGAGGTGCCCACCAGGGGCGG - Exonic
1057203426 9:93156183-93156205 GCAGAGGGGGCAGCCCAGTGTGG + Intergenic
1057904126 9:98971348-98971370 CCAGAGCTGCCTGCCGGGTGGGG + Intronic
1060375875 9:123114872-123114894 GCAGAGGAGCCTGGCCTGTGAGG + Intronic
1060741366 9:126099668-126099690 GCAGGGGTGCCCCCACTGTGTGG - Intergenic
1062029023 9:134353674-134353696 GCAGAGGTGCCCTTGGGGTGGGG + Intronic
1062190163 9:135243880-135243902 GCAGAGCTGCCCGCCAGGCGGGG - Intergenic
1062243715 9:135552802-135552824 CCGGGGGTGCCCGCCCTGTGAGG - Intergenic
1062407166 9:136402351-136402373 GCACAGGTCCCTGCCCGGGGTGG + Exonic
1185463070 X:341170-341192 GGACATGTGCACGCCCGGTGGGG - Intronic
1190108341 X:47574223-47574245 GCGCTGCTGCCCGCCCGGTGGGG + Exonic
1190652876 X:52583513-52583535 GCAGAGGTGCCCAACCAGTGAGG + Intergenic
1190679402 X:52811792-52811814 GCAGAGGTGCCCGCCCGGTGAGG + Intergenic
1195321173 X:103723300-103723322 GCAGGGGTGCCAGCCTGGAGGGG - Intronic
1198814777 X:140577948-140577970 GCACAGAAGCCGGCCCGGTGCGG + Intergenic