ID: 1190681744

View in Genome Browser
Species Human (GRCh38)
Location X:52831709-52831731
Sequence TGGACTTGTGGTGCCTTTTC TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 2530
Summary {0: 2, 1: 13, 2: 66, 3: 102, 4: 2347}

Found 8 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1190681737_1190681744 6 Left 1190681737 X:52831680-52831702 CCAGGCAGCCAATCCCAGAGACC 0: 1
1: 8
2: 537
3: 310
4: 371
Right 1190681744 X:52831709-52831731 TGGACTTGTGGTGCCTTTTCTGG 0: 2
1: 13
2: 66
3: 102
4: 2347
1190681734_1190681744 25 Left 1190681734 X:52831661-52831683 CCTTCAGACCAGGGACTGGCCAG 0: 1
1: 0
2: 2
3: 25
4: 246
Right 1190681744 X:52831709-52831731 TGGACTTGTGGTGCCTTTTCTGG 0: 2
1: 13
2: 66
3: 102
4: 2347
1190681741_1190681744 -8 Left 1190681741 X:52831694-52831716 CCAGAGACCAGAGTGTGGACTTG 0: 1
1: 1
2: 6
3: 55
4: 230
Right 1190681744 X:52831709-52831731 TGGACTTGTGGTGCCTTTTCTGG 0: 2
1: 13
2: 66
3: 102
4: 2347
1190681740_1190681744 -7 Left 1190681740 X:52831693-52831715 CCCAGAGACCAGAGTGTGGACTT 0: 1
1: 1
2: 6
3: 40
4: 251
Right 1190681744 X:52831709-52831731 TGGACTTGTGGTGCCTTTTCTGG 0: 2
1: 13
2: 66
3: 102
4: 2347
1190681736_1190681744 17 Left 1190681736 X:52831669-52831691 CCAGGGACTGGCCAGGCAGCCAA 0: 1
1: 1
2: 4
3: 23
4: 220
Right 1190681744 X:52831709-52831731 TGGACTTGTGGTGCCTTTTCTGG 0: 2
1: 13
2: 66
3: 102
4: 2347
1190681731_1190681744 29 Left 1190681731 X:52831657-52831679 CCCACCTTCAGACCAGGGACTGG 0: 1
1: 1
2: 4
3: 55
4: 457
Right 1190681744 X:52831709-52831731 TGGACTTGTGGTGCCTTTTCTGG 0: 2
1: 13
2: 66
3: 102
4: 2347
1190681738_1190681744 -2 Left 1190681738 X:52831688-52831710 CCAATCCCAGAGACCAGAGTGTG 0: 1
1: 1
2: 1
3: 33
4: 309
Right 1190681744 X:52831709-52831731 TGGACTTGTGGTGCCTTTTCTGG 0: 2
1: 13
2: 66
3: 102
4: 2347
1190681733_1190681744 28 Left 1190681733 X:52831658-52831680 CCACCTTCAGACCAGGGACTGGC 0: 1
1: 1
2: 1
3: 55
4: 423
Right 1190681744 X:52831709-52831731 TGGACTTGTGGTGCCTTTTCTGG 0: 2
1: 13
2: 66
3: 102
4: 2347

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1190681744 Original CRISPR TGGACTTGTGGTGCCTTTTC TGG Intergenic
Too many off-targets to display for this crispr