ID: 1190688712

View in Genome Browser
Species Human (GRCh38)
Location X:52896394-52896416
Sequence GCCCCCTTTATCCCCCTTAA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 80
Summary {0: 6, 1: 0, 2: 1, 3: 5, 4: 68}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1190688712_1190688714 0 Left 1190688712 X:52896394-52896416 CCCTTAAGGGGGATAAAGGGGGC 0: 6
1: 0
2: 1
3: 5
4: 68
Right 1190688714 X:52896417-52896439 TGCAAGTGAAGAAACTAAAATGG 0: 8
1: 21
2: 27
3: 70
4: 543
1190688712_1190688715 11 Left 1190688712 X:52896394-52896416 CCCTTAAGGGGGATAAAGGGGGC 0: 6
1: 0
2: 1
3: 5
4: 68
Right 1190688715 X:52896428-52896450 AAACTAAAATGGAGTCTGTCCGG 0: 23
1: 16
2: 9
3: 33
4: 360
1190688712_1190688716 25 Left 1190688712 X:52896394-52896416 CCCTTAAGGGGGATAAAGGGGGC 0: 6
1: 0
2: 1
3: 5
4: 68
Right 1190688716 X:52896442-52896464 TCTGTCCGGCTCTCTCTGCTAGG 0: 4
1: 4
2: 5
3: 17
4: 367

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1190688712 Original CRISPR GCCCCCTTTATCCCCCTTAA GGG (reversed) Intronic
901766753 1:11504902-11504924 GTCCCCTTTCTTCTCCTTAAGGG + Intronic
906953675 1:50354811-50354833 GCCCCCTTTGTCTCCCATTAAGG - Intergenic
912016160 1:105039258-105039280 TACCCCTTTTTCCCCCTTCATGG - Intergenic
918142751 1:181732650-181732672 GTCCCCTCCATCCCCCTTGAGGG - Exonic
923452910 1:234136508-234136530 GCTCCCTTTATCTTTCTTAATGG + Intronic
1069997901 10:72354343-72354365 GCGCCCATTCTCTCCCTTAAAGG + Intronic
1071394220 10:85205914-85205936 GTCCCCTATATCCCCCTTTGGGG + Intergenic
1075877454 10:125819790-125819812 CCCGCCTTTTTCCCCCTCAATGG - Intronic
1077423397 11:2463347-2463369 GCCCCCTCTATCCCCCAGATCGG + Intronic
1094223323 12:28018277-28018299 TCTCCGTTTATCCCCCTTAATGG + Intergenic
1094500467 12:31016582-31016604 GCTCCCTTTATAACACTTAACGG - Intergenic
1095243327 12:39887350-39887372 GTGCTCCTTATCCCCCTTAAGGG - Intronic
1096120979 12:49089371-49089393 GCCACCTTTATCCCCCTCTCTGG + Intergenic
1097195730 12:57241640-57241662 GCGCCCTCCATCCCCCTAAACGG - Intergenic
1101756822 12:107627597-107627619 GACAGCTTCATCCCCCTTAAGGG + Intronic
1104639697 12:130459584-130459606 GCCGCCCTTAGCCCCCTTGATGG - Intronic
1106068016 13:26377188-26377210 GCTCCCTTTATCCCCCAACAGGG + Intronic
1106960555 13:34992530-34992552 GCTCCTTTTCTCCCCATTAAGGG - Intronic
1120697967 14:87665467-87665489 GCCCCCTTTCTCCATCTTCAAGG - Intergenic
1123434518 15:20245309-20245331 GCCCCCTTTATCCCCCTTAAGGG + Intergenic
1127264899 15:57353336-57353358 GCCCCCTTCCTCCATCTTAAAGG - Intergenic
1128162401 15:65432214-65432236 CCCCCATTTATCCCCTTTTAAGG + Intergenic
1136850104 16:33605794-33605816 GCCCCCTTTATCCCCCTTAAGGG - Intergenic
1140630947 16:76851550-76851572 CCTTCCTTTTTCCCCCTTAAGGG + Intergenic
1141011315 16:80402655-80402677 GCCTCCTTCATACCCCTTACTGG - Intergenic
1203111717 16_KI270728v1_random:1454247-1454269 GCCCCCTTTATCCCCCTTAAGGG - Intergenic
1144132456 17:12259966-12259988 GCCCCCCTTAGACCCCTGAAGGG - Intergenic
1146678029 17:34786668-34786690 GCCCCATTTATCCTCCTCAGAGG + Intergenic
1149241241 17:54652244-54652266 GCCTCCTTTAACCTCCCTAAGGG + Intergenic
1149300981 17:55304465-55304487 GCCCCCTTGAACCCACTGAAAGG - Intronic
1150774700 17:68070117-68070139 GCCCCCTTTATCCCCCTTAAGGG - Intergenic
1160840270 19:1143647-1143669 GGCCCCTTCTTCCCCCTTCACGG + Intronic
1164689591 19:30200568-30200590 GCCTCCTTTGTCTCCCTCAATGG - Intergenic
1166330555 19:42075917-42075939 GCCCCTTTAATCCTCCTTAGAGG - Intronic
1167653788 19:50749710-50749732 GCCCCCCGTATCCCCCTTAAGGG + Intergenic
1167888527 19:52521721-52521743 GTGCCCTTTATCCGCCTTAAGGG - Intergenic
931674697 2:64682726-64682748 GCCCCCATCATTCCACTTAAAGG + Intronic
935794109 2:106624224-106624246 GACCCCTTTAGCCCACGTAAAGG + Intergenic
937840715 2:126521543-126521565 GCACAATTTATCCCCCTTCAGGG - Intergenic
939129223 2:138214218-138214240 GCCCTCTTTTTCCCCCTGTATGG - Intergenic
939392665 2:141588868-141588890 CCCCTGTTTATCCCCCTAAATGG - Intronic
944694283 2:202187198-202187220 GCCCCCCTCATCCCCTTTATCGG - Intronic
946361056 2:219219567-219219589 TCGCCCTTCATCCCCCTTCAGGG + Exonic
1174770244 20:53292789-53292811 GCTCCTTTAATCCCCCTCAATGG + Intronic
1176022083 20:62967082-62967104 GTCCCCTTTGTCCCGCTGAAAGG - Intronic
1178996259 21:37403385-37403407 GACTCCTTTTTCCCCCTTATTGG + Intronic
1181854790 22:25774146-25774168 GCCCACTATATCCCCTTTAATGG - Intronic
1184594236 22:45504195-45504217 GCCCCCTTCAGCCCCCTTCCTGG - Intronic
951076624 3:18401260-18401282 TTCCCCTTTTTTCCCCTTAAAGG + Intronic
956319132 3:67975935-67975957 GGCCCCTTCCTCCACCTTAAAGG + Intergenic
957642646 3:82876958-82876980 GACCACTTTCTCTCCCTTAAGGG - Intergenic
957981118 3:87511659-87511681 GACCCCTTTTTCCCCCTCACAGG - Intergenic
958797244 3:98718669-98718691 GACCCCTTTGTCCACCTTCAAGG - Intergenic
970773903 4:19649488-19649510 GCCCCCTTTTTCCCTTTTACTGG + Intergenic
973716591 4:53682943-53682965 ACACCCTCTATCCTCCTTAAAGG - Intronic
975102172 4:70526008-70526030 GCCCCCATTATCCAACATAATGG + Intronic
975524728 4:75336432-75336454 CCACCATTTATCCCCATTAATGG - Intergenic
976269517 4:83217160-83217182 TGCCCCTTTCTCCCCCTGAAAGG + Intergenic
980927624 4:139153969-139153991 GTCCCCTTTTTCCCCTTTAAAGG + Intronic
986468711 5:8052531-8052553 GCTGCCTTTATCCACCTTACGGG - Intergenic
990289213 5:54331533-54331555 GCTCCCTTTCTCCCTCCTAAGGG + Intergenic
994383808 5:99103577-99103599 TCCCCCTTTATAGACCTTAAGGG - Intergenic
997354502 5:133253664-133253686 GCCCCCTATAGCCTCCTTCATGG + Intronic
1000687638 5:164272453-164272475 GTCCCCTTTTGCTCCCTTAATGG - Intergenic
1003757043 6:9133518-9133540 GCCCTATTAATCCCCTTTAAAGG - Intergenic
1008202117 6:48603309-48603331 GCCCCATGTATCCCTCTTAAAGG - Intergenic
1010731463 6:79395874-79395896 GCCCCCGTGATCCACCATAAGGG + Intergenic
1021961322 7:25875821-25875843 GACCCCTTTCTCACCCTTCAGGG - Intergenic
1026104111 7:67407612-67407634 GGCCCCTTTAGCCCACTGAATGG - Intergenic
1034123744 7:148652286-148652308 GCCCTCCATAGCCCCCTTAAGGG - Intergenic
1038675262 8:29617119-29617141 GCCCCCATTCTCCCCCTAACTGG + Intergenic
1043993763 8:86787971-86787993 GCCCCCTTTATCTGTCTTCAAGG + Intergenic
1046676123 8:117110591-117110613 GGACACTTTATCCCCCTGAAAGG - Intronic
1047402879 8:124560957-124560979 GCCCCCTTTCTCCCTAATAAAGG + Intronic
1060678433 9:125538491-125538513 ACCTGCTTTATCTCCCTTAAAGG + Intronic
1185736212 X:2498749-2498771 GTCCCCTTAAACCTCCTTAAGGG - Intronic
1185963720 X:4576296-4576318 GCATCCTTTATCTCCGTTAATGG + Intergenic
1188926825 X:36054067-36054089 GTCCTCTTTATCTCCCTTACTGG + Intronic
1190688712 X:52896394-52896416 GCCCCCTTTATCCCCCTTAAGGG - Intronic
1190697271 X:52959398-52959420 GCCCCCTTTATCCCCCTTAAGGG + Intronic