ID: 1190689009

View in Genome Browser
Species Human (GRCh38)
Location X:52898049-52898071
Sequence GTCTCATGTTTAGAGAGGGA GGG
Strand +
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 181
Summary {0: 2, 1: 0, 2: 0, 3: 13, 4: 166}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1190689005_1190689009 -7 Left 1190689005 X:52898033-52898055 CCGCACAAGCTGCAGGGTCTCAT 0: 2
1: 0
2: 2
3: 10
4: 165
Right 1190689009 X:52898049-52898071 GTCTCATGTTTAGAGAGGGAGGG 0: 2
1: 0
2: 0
3: 13
4: 166
1190689000_1190689009 15 Left 1190689000 X:52898011-52898033 CCAGGCCATTTGTGTCCAGTAGC 0: 2
1: 0
2: 2
3: 14
4: 101
Right 1190689009 X:52898049-52898071 GTCTCATGTTTAGAGAGGGAGGG 0: 2
1: 0
2: 0
3: 13
4: 166
1190689001_1190689009 10 Left 1190689001 X:52898016-52898038 CCATTTGTGTCCAGTAGCCGCAC 0: 2
1: 0
2: 1
3: 11
4: 59
Right 1190689009 X:52898049-52898071 GTCTCATGTTTAGAGAGGGAGGG 0: 2
1: 0
2: 0
3: 13
4: 166
1190689002_1190689009 0 Left 1190689002 X:52898026-52898048 CCAGTAGCCGCACAAGCTGCAGG 0: 2
1: 0
2: 0
3: 9
4: 112
Right 1190689009 X:52898049-52898071 GTCTCATGTTTAGAGAGGGAGGG 0: 2
1: 0
2: 0
3: 13
4: 166

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1190689009 Original CRISPR GTCTCATGTTTAGAGAGGGA GGG Exonic
902533120 1:17103165-17103187 TTCTGATGTTTGGAGAGGGTTGG - Intronic
902799642 1:18821280-18821302 GTTTCATGTTTTGACAGGCAGGG + Intergenic
903466821 1:23557742-23557764 GTCTCATGTCCATTGAGGGATGG - Intergenic
904400962 1:30256501-30256523 GTCACATGTTGAGTGAGGGCTGG + Intergenic
905773769 1:40654965-40654987 GTCCCATGTTCACAGTGGGAAGG - Intronic
909607948 1:77525508-77525530 ATCACATGTTGAGAGAGAGATGG + Intronic
911215303 1:95186561-95186583 GGCTTATGATTAGAGAGGAATGG + Intronic
915448674 1:155989709-155989731 GCCCCTTGGTTAGAGAGGGAAGG - Intronic
915632641 1:157164019-157164041 GTCACATGTTTACACGGGGACGG - Intergenic
916325534 1:163555375-163555397 TTCTCATGTTTATTGAGGCAAGG + Intergenic
919547704 1:198944263-198944285 GACTCATATTTAGATGGGGAAGG - Intergenic
920561646 1:206943024-206943046 GTCTCTGGTTTTGAGAGGAAGGG - Intronic
921809367 1:219494526-219494548 ATCTCATTTTTATAAAGGGAGGG + Intergenic
921897907 1:220420257-220420279 GTCTCATGTTTGGTTTGGGAAGG + Intergenic
923346395 1:233057449-233057471 GTCTCATGATAAGAGATAGAGGG + Intronic
923698180 1:236275482-236275504 GTGGCATGTTGAGAGAGGCACGG - Intronic
924477683 1:244395858-244395880 GACTCAAGCTCAGAGAGGGAAGG - Intergenic
1065164441 10:22960478-22960500 GTCTCTTTTTTAGGGAGGGAGGG - Intronic
1065863895 10:29896590-29896612 GTCTCATAGTTAGCGAGTGACGG + Intergenic
1069860986 10:71471670-71471692 GTGGGATGGTTAGAGAGGGAGGG - Intronic
1070741117 10:78903909-78903931 GTATCATGTTTAGAAGGGGCTGG - Intergenic
1074436193 10:113436411-113436433 GCCTCATGTTTGGAGAAGCATGG + Intergenic
1076198261 10:128536444-128536466 GATTCATGTCCAGAGAGGGACGG + Intergenic
1078655275 11:13233016-13233038 GTGTTAAGTTTGGAGAGGGAGGG + Intergenic
1083486867 11:62988575-62988597 GGCACAGGCTTAGAGAGGGAGGG - Intergenic
1086035559 11:82410030-82410052 GCCTCAGGATTAGAGAGGGCTGG - Intergenic
1090330440 11:125927150-125927172 GTTTAATGTTTAAAGGGGGATGG - Intergenic
1090481459 11:127072315-127072337 AACTGATGTTTAGAGATGGATGG + Intergenic
1090636315 11:128692564-128692586 GACTAATTTCTAGAGAGGGAGGG + Intronic
1091397772 12:164203-164225 GGCTCATGGATAGAGAGGGCCGG - Intronic
1095202061 12:39395918-39395940 GTGGGGTGTTTAGAGAGGGAAGG - Intronic
1099032223 12:77540905-77540927 ATACCATGGTTAGAGAGGGAGGG + Intergenic
1100763428 12:97835150-97835172 GTCTCATAGTTAAATAGGGAAGG + Intergenic
1101636702 12:106549487-106549509 GTCTAATGTTGACAGTGGGAGGG + Intronic
1101982087 12:109416345-109416367 GTCAAATCTATAGAGAGGGAAGG - Intronic
1102944343 12:116972664-116972686 CTCTCATGCTTGGAGAAGGAAGG + Intronic
1104743208 12:131193882-131193904 GTCTCATGTTGAAAGGGGGAGGG + Intergenic
1105841061 13:24253998-24254020 GGTTTATGCTTAGAGAGGGAGGG + Intronic
1107721968 13:43258666-43258688 GTCTTCCCTTTAGAGAGGGATGG - Intronic
1110475122 13:75904883-75904905 TTCCCATGTCGAGAGAGGGAGGG - Intergenic
1114565951 14:23632955-23632977 GCTTCCTGTTGAGAGAGGGAGGG - Intronic
1116134916 14:40910217-40910239 GGCTAGTGTCTAGAGAGGGAAGG + Intergenic
1119891299 14:78184425-78184447 GTCTTATGTCTTAAGAGGGAAGG + Intergenic
1122374981 14:101251522-101251544 GGATCATGGTTGGAGAGGGAGGG - Intergenic
1123897469 15:24842653-24842675 GTCACATCTTTAGTTAGGGAGGG - Intronic
1128127214 15:65201982-65202004 CTCTCATGCTTGTAGAGGGAAGG + Exonic
1128238207 15:66081678-66081700 TTCTCATCTTTAAAGTGGGAAGG - Intronic
1133484826 16:6209686-6209708 GTCTGATCTTCAGAAAGGGAGGG + Intronic
1133523405 16:6580701-6580723 GTCTCATCTCTAGAAAGGTAAGG - Intronic
1135067228 16:19320647-19320669 TTCACATGTTCATAGAGGGATGG - Intronic
1135775178 16:25251877-25251899 GTCTTATATTTGGAAAGGGAAGG + Intronic
1138399247 16:56732020-56732042 GTCTGACGTTTGGAAAGGGAGGG - Intronic
1144663155 17:17084566-17084588 GACTCCTGCTGAGAGAGGGATGG + Intronic
1145347409 17:22049729-22049751 GTTTCTTGTCTAGAGAGAGATGG - Intergenic
1148149803 17:45389846-45389868 GTCACCTGTTGAGAGAGGGAAGG + Intergenic
1149163381 17:53721813-53721835 GTCTCATGTCTAGAGTTCGAAGG - Intergenic
1156310038 18:35913416-35913438 ATCTCATGTTTAGAAAGGCTAGG - Intergenic
1156597866 18:38568375-38568397 GTCTCATGTATAAAGTGGGCTGG - Intergenic
1157240978 18:46009092-46009114 CTCTCATGCTTAGTGAGAGAAGG + Intronic
1157466892 18:47955139-47955161 GTCTTATTTTTAGAGGAGGAGGG - Intergenic
1158310073 18:56148672-56148694 TGCTCATGTGGAGAGAGGGAGGG + Intergenic
1162742964 19:12783552-12783574 GTACCATTTTTAGAGAGGGGAGG + Intronic
1163349302 19:16765296-16765318 TTCACATGTTTAGACAGGAAAGG - Intronic
1163526342 19:17823859-17823881 ATCTGAGGTTGAGAGAGGGAAGG + Intergenic
1167903843 19:52642121-52642143 GACTCAGGTGTACAGAGGGACGG + Intronic
1168094444 19:54106718-54106740 GCTTTATGTTCAGAGAGGGAAGG - Intronic
924978060 2:195981-196003 TTCTCATTTTGAGAGAGGGAGGG + Intergenic
926101437 2:10120731-10120753 GACTCAGGTTTAGCGCGGGAGGG + Intergenic
927113617 2:19881690-19881712 GACTCATCTTAAGAGAGGAAGGG - Intergenic
927516649 2:23675417-23675439 GTCTCTTGTTTAGGAAGGAACGG - Intronic
928377214 2:30785244-30785266 GTGACATGATTAGAGAGGGAAGG - Intronic
930872837 2:56184981-56185003 GTCACCTGTTGAGGGAGGGAGGG - Intronic
931468534 2:62514040-62514062 TTCTGATTTTTAGAGGGGGATGG + Intergenic
931828252 2:66024079-66024101 GTCTCATGTTCAGTGAGTCAAGG + Intergenic
943699503 2:190974436-190974458 GTGTTATTTTTAGAAAGGGAGGG - Intronic
943747066 2:191472981-191473003 GTCTAAGGATTAGAGAGAGAAGG - Intergenic
944766168 2:202866293-202866315 ATCGCATGGTGAGAGAGGGAAGG - Intronic
944884485 2:204048794-204048816 GTCACCTTATTAGAGAGGGAGGG - Intergenic
945775831 2:214104797-214104819 GTTTAATGTTTACAGAGGTATGG + Intronic
946559527 2:220897271-220897293 GTCTCATCTTTCGACAAGGATGG - Intergenic
947425472 2:229979437-229979459 TTGTTTTGTTTAGAGAGGGAAGG + Intronic
947525266 2:230873597-230873619 GGGTCATGTCTAGAGAGGCATGG + Intronic
947952778 2:234162353-234162375 GTCTCTTGTTGTGACAGGGATGG + Intergenic
948381696 2:237554753-237554775 GTGTCTTATTGAGAGAGGGAAGG - Exonic
1169602210 20:7274559-7274581 GTCTCATCCTTAGAGGGAGAAGG + Intergenic
1170798695 20:19572166-19572188 GTAACATTTTTAGAGGGGGAGGG - Intronic
1171164147 20:22956030-22956052 GTCTGATGTGTAGAGAAGCAGGG + Intergenic
1178776856 21:35559848-35559870 ATCTCATGTATAGATATGGAGGG + Intronic
1179149345 21:38796687-38796709 TTCTCATTTTTACAGAGAGAAGG + Intergenic
1179276196 21:39893858-39893880 CTAACATGTTTAAAGAGGGAGGG + Intronic
1181999598 22:26909398-26909420 ATCTGAGGTTTAGAGAGGGGAGG + Intergenic
1183011518 22:34950662-34950684 TTTGCATGTTTAGAGGGGGAGGG - Intergenic
1184709177 22:46238202-46238224 GTCTCTTGTGTTGATAGGGAAGG + Exonic
1185152752 22:49175243-49175265 GTCTCCTGTTTTGAGAGGCGGGG - Intergenic
950512572 3:13440267-13440289 GTCTCATGGTGAGTGAGGGAAGG - Intergenic
951300066 3:20985788-20985810 GTTTCATTTTTAGAGAAGGTGGG - Intergenic
954279234 3:49564221-49564243 TTCTCATGCTGTGAGAGGGAAGG - Intronic
957899958 3:86476412-86476434 GGCTCTTTTTTAGAGAGAGAAGG + Intergenic
959592269 3:108093169-108093191 GTTTCTTGGGTAGAGAGGGAGGG + Intergenic
960996807 3:123345589-123345611 GGCTCAGGTTTAAAGTGGGAAGG - Intronic
961194350 3:124988951-124988973 GTCATATGAGTAGAGAGGGAGGG - Intronic
964097544 3:152950416-152950438 TTTACAGGTTTAGAGAGGGAAGG - Intergenic
964321107 3:155498074-155498096 GACTCATGTCCAGAGTGGGACGG - Intronic
967222589 3:187260186-187260208 GTCTCGTGCTTAGGGAGGGATGG - Intronic
969053727 4:4388996-4389018 GTCTGATGCCTAGACAGGGAGGG - Intronic
971549320 4:27929321-27929343 AACTCATGTTTAGAGAGGTCAGG - Intergenic
973759227 4:54101350-54101372 GTCACAGGATTAAAGAGGGATGG - Intronic
974443781 4:61952518-61952540 GACTCAAATTTAGAGAGAGATGG + Intronic
975804629 4:78099126-78099148 GTCTCAGCTTTAGAGAGGAGAGG + Intronic
975980240 4:80149144-80149166 TTTTCATGTTTAAAGTGGGAGGG - Intergenic
978785366 4:112603180-112603202 GTGTCATATTTAAAGAGAGAAGG + Intronic
979859143 4:125671955-125671977 GCCTCATGTTTTAAGTGGGAGGG - Intergenic
981025345 4:140072144-140072166 CACTCATGTCTAGAGAAGGAAGG - Intronic
981253823 4:142637104-142637126 GTTTTGTGTTTAGAAAGGGATGG - Intronic
981747977 4:148069162-148069184 GTCAGATCTTCAGAGAGGGAGGG + Intronic
983479566 4:168256269-168256291 TTCTCATTTTTAGAGAAGGGTGG - Intronic
983550632 4:169013927-169013949 GTGGGATGTTGAGAGAGGGAAGG - Intergenic
984542908 4:181062611-181062633 CTCTCATGTTTACAGAGACAAGG - Intergenic
985962052 5:3309949-3309971 GGCTCATGTTGGGAGAGGCAGGG + Intergenic
986953412 5:13119924-13119946 CTCCCATGTCTACAGAGGGAAGG + Intergenic
988805644 5:34738051-34738073 TGCTCATATTTATAGAGGGAGGG + Intronic
992018601 5:72600090-72600112 CTGTCATCTTTATAGAGGGAAGG + Intergenic
992042175 5:72846595-72846617 TTCTGAAGTTAAGAGAGGGAAGG + Intronic
992841252 5:80697251-80697273 GTCTTATGTTGACAGAGGAATGG + Intronic
993583859 5:89698983-89699005 TTCCAAGGTTTAGAGAGGGAAGG - Intergenic
995238751 5:109861093-109861115 GTCTCATGGTTAGAAAGCAAAGG - Intronic
996464947 5:123789414-123789436 CTTTCATGGTTACAGAGGGATGG + Intergenic
997607257 5:135184029-135184051 GGCTCCTGTTGGGAGAGGGAAGG - Intronic
999644342 5:153703128-153703150 AACTCATATCTAGAGAGGGAAGG - Intronic
1000328393 5:160188824-160188846 GTTTCAAGTTCAGAGAAGGAAGG - Intronic
1001032185 5:168271104-168271126 GTCTTCTGTTGATAGAGGGAGGG - Intergenic
1001868704 5:175131277-175131299 GTCCCAGGCTCAGAGAGGGAGGG - Intergenic
1002490376 5:179572042-179572064 GGGTAATGTTTAGATAGGGAAGG - Intronic
1003179063 6:3776673-3776695 GTGTCATCTTTGGAGAGGGTTGG + Intergenic
1005421205 6:25652882-25652904 TTCTCATTTTGAGAGAGTGAGGG - Intronic
1005843658 6:29761183-29761205 GTCCCATGTGGAGATAGGGAAGG - Intergenic
1006645272 6:35511247-35511269 GTCTCAGGAGGAGAGAGGGAGGG - Intronic
1010084597 6:71902226-71902248 GGCTCATCTTTTGAGAGTGAGGG + Intronic
1010149153 6:72710019-72710041 ATAACATGTTTAGAGAGGAATGG + Intronic
1014385812 6:120800386-120800408 GTTTCATGTTTAAAGAGCCATGG - Intergenic
1016616197 6:146051361-146051383 GTATCATATTTACAGATGGAGGG - Intronic
1018064020 6:160113287-160113309 AACTCTTGTTCAGAGAGGGAAGG - Intronic
1019650568 7:2155509-2155531 GTCGCATTCTTAGAGACGGAAGG - Intronic
1022626902 7:32045847-32045869 GTCACATGTGAAGGGAGGGAAGG - Intronic
1029436348 7:100566135-100566157 GACTCTTGTTCAGACAGGGACGG - Exonic
1029981148 7:104880276-104880298 ATCACATGATGAGAGAGGGAGGG - Intronic
1031096586 7:117427630-117427652 GCCTCAAGGTTAGGGAGGGACGG - Intronic
1031345412 7:120659691-120659713 GTCCCATGTATACTGAGGGATGG - Intronic
1031660868 7:124422612-124422634 GTCTGATGCTTAGAAAGGAAAGG + Intergenic
1031741302 7:125434908-125434930 TCCTCATGTTTAGGGAGGAAGGG + Intergenic
1032463493 7:132128772-132128794 GTCTGATGTTTGGGGAGTGAAGG + Exonic
1032547021 7:132752236-132752258 GCCCCATGATTGGAGAGGGAAGG - Intergenic
1035759794 8:2061168-2061190 GTCTCCGGTTTAGTGAGGGAGGG + Intronic
1035759806 8:2061209-2061231 GCCTGGTGTTTAGTGAGGGAGGG + Intronic
1041601113 8:59718148-59718170 GTCTCCCCTTTAGAGAGAGAGGG - Intergenic
1041989312 8:63966806-63966828 TTCTTTTGTTTGGAGAGGGAGGG + Intergenic
1044541771 8:93416446-93416468 GTCTCCTGCTGAGAGAGAGAGGG - Intergenic
1045364097 8:101459742-101459764 TTTGCATGTTGAGAGAGGGAAGG - Intergenic
1046359586 8:113132359-113132381 GTCTCATGTTAATTGAGGGAGGG + Intronic
1046792438 8:118336137-118336159 GTCACATGATCAGAGAGTGACGG + Intronic
1046813710 8:118560541-118560563 TTTTCATGTCTAAAGAGGGAAGG - Intronic
1047078392 8:121431480-121431502 GTGTAATGTTTTTAGAGGGAAGG + Intergenic
1048657780 8:136560884-136560906 GTCACGTATTAAGAGAGGGAAGG - Intergenic
1055867505 9:80832881-80832903 CTCTCATGTTTAGAGTAGGAAGG + Intergenic
1056894090 9:90524771-90524793 GTATGATGTTCAGAGAGGGATGG - Intergenic
1057402285 9:94734819-94734841 TTCTGATGTTTATATAGGGATGG + Intronic
1058426754 9:104882157-104882179 GTTTGGTGTTTAGGGAGGGATGG - Intronic
1060210118 9:121704998-121705020 GTCTCATCTCTAGAGAGGAAGGG + Intronic
1060253986 9:122010265-122010287 ATCTCATTTTTATAAAGGGAGGG - Intronic
1061980638 9:134101554-134101576 GGCTCGTGTTTAGAGGGGGGCGG + Intergenic
1185635175 X:1547043-1547065 GCCTGATGTTGAGAGAGGAACGG + Intergenic
1187721138 X:22151876-22151898 GTATTATTTTTAGAGAGGGAGGG + Intronic
1187760473 X:22578496-22578518 TTCTCTGGTTTACAGAGGGAAGG + Intergenic
1187915855 X:24151246-24151268 GTCTCATGTTTAGAGGTAGGTGG + Intronic
1188701809 X:33273791-33273813 CTCTCATATTTACAGAGGGCAGG - Intronic
1190689009 X:52898049-52898071 GTCTCATGTTTAGAGAGGGAGGG + Exonic
1190696974 X:52957743-52957765 GTCTCATGTTTAGAGAGGGAGGG - Intronic
1190775411 X:53548659-53548681 GTCTTATGATTAGAAAGTGATGG - Intronic
1191576955 X:62716429-62716451 TTATCAGGTTTAGTGAGGGAGGG + Intergenic
1194190249 X:90826229-90826251 GTCACATGGTGAGAGAGGAAGGG - Intergenic
1200536845 Y:4408329-4408351 GTCACATGGTGAGAGAGGAAGGG - Intergenic