ID: 1190689952

View in Genome Browser
Species Human (GRCh38)
Location X:52905501-52905523
Sequence ACCCATGAAAAGGAGTACTT TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 168
Summary {0: 2, 1: 0, 2: 0, 3: 18, 4: 148}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1190689952 Original CRISPR ACCCATGAAAAGGAGTACTT TGG Intronic
900826086 1:4928080-4928102 AGCCAGGAAAGGGAGTTCTTGGG + Intergenic
905786111 1:40759069-40759091 ACACATTAAAAGAAGTACCTTGG + Intronic
905842712 1:41197810-41197832 ACCCAGGAAAAGGAATTCTGTGG - Intronic
906186457 1:43865801-43865823 ACCAATGAAAAGGTCTTCTTTGG - Intronic
907586484 1:55622415-55622437 ACCGCTGAAAAGAAGTTCTTTGG + Intergenic
909628665 1:77748029-77748051 AACCATGAAAAGGATTAGTGAGG - Intronic
913687062 1:121242381-121242403 ACTCATGAATACGAGTAATTGGG - Intronic
914038920 1:144030019-144030041 ACTCATGAATACGAGTAATTGGG - Intergenic
914150533 1:145037908-145037930 ACTCATGAATACGAGTAATTGGG + Intronic
915610943 1:156992121-156992143 ACAAATGAAAATGATTACTTGGG - Intronic
915730172 1:158047826-158047848 ACCCATGCACAAAAGTACTTTGG + Intronic
915891355 1:159777061-159777083 ACCAATGCAAAGGATTGCTTGGG - Intergenic
921336531 1:214092616-214092638 ACACATGGAAAGGAGTCCATAGG - Intergenic
921561299 1:216661692-216661714 ATCCAAGAACAGAAGTACTTAGG - Intronic
1063970480 10:11378267-11378289 ACCCTGGAAAAGGAGTAATTAGG + Intergenic
1067038625 10:42936474-42936496 ACCCATGGAAAGGAGCCCTAAGG + Intergenic
1068754554 10:60636912-60636934 ACCCATGAAATGGAGAAGATAGG + Intronic
1070905701 10:80071368-80071390 AACAAAGAAAAGGAGAACTTAGG + Intergenic
1071233417 10:83615746-83615768 ACCCAGGAACAAGAGTACCTTGG - Intergenic
1073899634 10:108204915-108204937 ACCCACAAATAGGAGAACTTTGG - Intergenic
1074205558 10:111280032-111280054 AGCCATGTAAAGGACTACTCGGG + Intergenic
1078862585 11:15264079-15264101 ACCTTTGAAAAAGAGTACCTTGG - Intergenic
1078862623 11:15264403-15264425 ACCTTTGAAAAAGAGTACCTTGG - Intergenic
1078862660 11:15264729-15264751 ACCTTTGAAAAAGAGTACCTTGG - Intergenic
1081125392 11:39314673-39314695 TCCCATGAAAAGGCATGCTTAGG - Intergenic
1081835089 11:46146884-46146906 ACCCTAAAAAAGGAGTAGTTTGG + Intergenic
1085276874 11:75306206-75306228 GCCCATGAAAAGGAGTTCCCTGG + Intronic
1087301799 11:96444335-96444357 ACCCCTGAAAAGGAGTTCTGAGG - Intronic
1088087819 11:106002676-106002698 ATGTAAGAAAAGGAGTACTTTGG + Intronic
1088520476 11:110692939-110692961 CCCCATGAAATGGATTCCTTAGG + Intronic
1088897090 11:114086685-114086707 TCCTATTAAAAGGAATACTTGGG + Intronic
1090651978 11:128815069-128815091 ACTCTTGAAAAGGTGTCCTTTGG + Intergenic
1094765276 12:33587499-33587521 CCCTAGGAAAAGGAGTGCTTTGG + Intergenic
1098467353 12:70802951-70802973 ACTCATGAGAATGAGTATTTGGG + Intronic
1099943055 12:89212992-89213014 ACCCATGAAAGGGAATAATCAGG - Intergenic
1101589733 12:106115029-106115051 ACCCATGAATACGCATACTTGGG + Intronic
1103063992 12:117881937-117881959 AGCCCTGAATAGGAGGACTTTGG - Intronic
1105228747 13:18467377-18467399 ACCCTTAAAAAAGAGTACTCTGG - Intergenic
1106051813 13:26197588-26197610 ACCCATGAGAAGGAGTAGGGAGG - Intronic
1107640898 13:42442180-42442202 ACCCAAGAAAATCAGTACTTTGG + Intergenic
1109344116 13:61094432-61094454 GCACATGAAAATTAGTACTTAGG + Intergenic
1111550907 13:89811058-89811080 AGCCAAGAAAAGGAGAAATTAGG - Intergenic
1113234303 13:108252877-108252899 ACCCATAAAAAGAAATACCTAGG - Intronic
1118584999 14:67344201-67344223 GCCAATGAAAAGGACAACTTGGG + Intronic
1122099660 14:99397519-99397541 ACTCAAGAAAAGGAGTCCTTAGG - Intergenic
1122421806 14:101582513-101582535 ACCCATTAAAAGGCTTACTCTGG + Intergenic
1126702705 15:51382230-51382252 ACCCCTGACAAGGGGTACTGGGG - Intronic
1129635193 15:77308947-77308969 ATCCAAAAAAAGCAGTACTTTGG + Intronic
1130634465 15:85604344-85604366 ACCCATTAAAATGAGTATTTAGG + Intronic
1131649756 15:94386151-94386173 ACCCATGTAAAGGCATTCTTTGG - Intronic
1136386610 16:29930558-29930580 AGCCTTGAAAAGGATTTCTTTGG + Intergenic
1139149655 16:64366230-64366252 CCCCATAAAATGGAGTACTTAGG - Intergenic
1140292336 16:73671743-73671765 AGCCAGGAAAAGTAGTAATTTGG - Intergenic
1140782300 16:78307761-78307783 TCCCATGAAAAGGAATATTAAGG - Intronic
1143060341 17:4195455-4195477 ACACATGTAAAGGAGTCCTGCGG + Exonic
1146529965 17:33600108-33600130 ACCCATGAAAAGGATTCCTGTGG - Intronic
1149318211 17:55458611-55458633 ACACATCAAAAGGAGCACGTCGG + Intergenic
1151264913 17:72947376-72947398 ACAAATGAAAAGGAGTATTCAGG + Intronic
1154524716 18:15272921-15272943 ACCCTTAAAAAAGAGTACTCTGG + Intergenic
1155926687 18:31663182-31663204 AGCCATTAAAAGGTGTTCTTTGG - Intronic
1156557875 18:38087979-38088001 TCCCATGAAAAGGAATGTTTAGG - Intergenic
1157427405 18:47595597-47595619 ACCCAGAAAAAGGAATACCTTGG + Intergenic
1158481916 18:57829525-57829547 ACCCAGCAAAAGGATTATTTTGG + Intergenic
1162962379 19:14135947-14135969 CCCCATGAAAACGGGTACCTAGG + Intronic
925631249 2:5895531-5895553 ACCCATGTAAAGAAGTAATGAGG - Intergenic
931578855 2:63751802-63751824 ACCCATGAATGGGAGAACTATGG - Intronic
931997957 2:67857047-67857069 ACACATGAGAAGGAGGATTTTGG - Intergenic
932141829 2:69285647-69285669 ATCCATGTAAACTAGTACTTAGG - Intergenic
934897274 2:98129789-98129811 ACCCATTTCAAGGAGAACTTAGG - Intronic
935324396 2:101922917-101922939 AGGCATGAAGAGGAGAACTTGGG + Intergenic
936558934 2:113519862-113519884 ACTCATGAAGAAGAGTGCTTGGG + Intergenic
937550742 2:123086961-123086983 ACCTATTACAATGAGTACTTTGG + Intergenic
940592653 2:155748886-155748908 ACCCATTTAATGAAGTACTTTGG - Intergenic
941590778 2:167417476-167417498 ACACCTAAAAAGGAGTAATTAGG - Intergenic
947568819 2:231214725-231214747 ACCACTGAAAAGGAGTATATGGG + Intronic
948765291 2:240216289-240216311 ACCCAAGAAAAAGGGTACATAGG + Intergenic
1174709354 20:52688384-52688406 ACCCTTGAACAGGAGTTGTTTGG - Intergenic
1176201632 20:63863426-63863448 TCCCGTGAAAAGGAGGACATTGG + Intergenic
1176772727 21:13095564-13095586 ACCCTTAAAAAAGAGTACTCTGG - Intergenic
1177242320 21:18475197-18475219 AACTCTGAAAAGGAGTAGTTTGG - Intronic
1178352523 21:31882638-31882660 ACCCGTGGAAATGAATACTTAGG - Intronic
1179644257 21:42765970-42765992 CCCCATGAGAAGGTGCACTTAGG + Intronic
1181927330 22:26370419-26370441 AACCATGAAAAGGGCCACTTTGG + Intronic
1182623996 22:31632726-31632748 AACCCTGAAATGGAGTAATTAGG + Intronic
953938037 3:47063640-47063662 ATCAGTGAAAAGTAGTACTTAGG - Intronic
954007691 3:47605066-47605088 ACCCAACAAAAGGGGTAATTTGG + Intronic
956917935 3:73893231-73893253 AACCAAGAATATGAGTACTTTGG - Intergenic
957499860 3:81040859-81040881 AGCCATGAAATACAGTACTTGGG + Intergenic
957975201 3:87434163-87434185 CCCCATGAAAATGCATACTTTGG + Intergenic
958437872 3:94120162-94120184 TCCCATGAAAATGACTATTTTGG - Intronic
962317090 3:134365708-134365730 CCCCTTGCAAAGTAGTACTTTGG - Intronic
962725038 3:138216145-138216167 AACCATGAAAAGCAGCACTTTGG - Intronic
963684966 3:148421738-148421760 AGTCAGGAAAAGGAGTCCTTGGG + Intergenic
963926416 3:150956230-150956252 TCCCAGGAAAGGGATTACTTCGG + Intronic
964503879 3:157377421-157377443 CCCCATGAAAAGAAGAATTTAGG - Intronic
965448912 3:168812518-168812540 ACATATGTAAAGGAGTAGTTTGG - Intergenic
966198571 3:177338224-177338246 ACCCAAGAAAATGGGCACTTAGG - Intergenic
966863937 3:184246025-184246047 ACCCAGGAAAAGGAGTAGATTGG - Intronic
967839710 3:193995381-193995403 ACCCATGGAAAGGGCTACCTTGG - Intergenic
972098091 4:35374514-35374536 ACCCATGAAAAGGTACACATTGG + Intergenic
972508536 4:39744603-39744625 ACCCATTTAAAGGAATAATTTGG + Intronic
979379242 4:119988975-119988997 ATCAATAAAAAGGAGAACTTTGG + Intergenic
982449155 4:155531614-155531636 ACCCATGACATGGAACACTTAGG - Intergenic
983615988 4:169705773-169705795 ACACAGTAAAAGTAGTACTTAGG + Intronic
984162148 4:176266184-176266206 CCCCATGAGCAGTAGTACTTTGG - Intronic
984399410 4:179242726-179242748 AGCCATCAAAATGAGTAGTTAGG - Intergenic
986018981 5:3783398-3783420 ACCAATGGAAAGGAATACCTTGG + Intergenic
986434150 5:7711323-7711345 ACTCATGAAAAACAGTAATTTGG + Intronic
986462920 5:7991488-7991510 AGCCATGAAAAAGAATACCTGGG - Intergenic
987743330 5:21937875-21937897 CCCCATGAAAAGGAGGTCTTGGG - Intronic
990698839 5:58453221-58453243 TCCTATGAAAAGAAGTGCTTTGG - Intergenic
991656107 5:68905310-68905332 ACCCAGCAAAAGGAGGGCTTGGG + Intergenic
991749581 5:69786632-69786654 CCCCATGAAAAGGAGGTCTTGGG + Intergenic
991763529 5:69948008-69948030 CCCCATGAAAAGGAGGTCTTGGG - Intergenic
991783797 5:70170121-70170143 CCCCATGAAAAGGAGGTCTTGGG + Intergenic
991801160 5:70366446-70366468 CCCCATGAAAAGGAGGTCTTGGG + Intergenic
991827439 5:70643596-70643618 CCCCATGAAAAGGAGGTCTTGGG - Intergenic
991842758 5:70823068-70823090 CCCCATGAAAAGGAGGTCTTGGG - Intergenic
991876243 5:71170496-71170518 CCCCATGAAAAGGAGGTCTTGGG + Intergenic
996049903 5:118920243-118920265 TCCCATGAAAAGGAAAACTGGGG + Intronic
996395350 5:123008001-123008023 ACCCATGAAAAGGAGGCCACAGG + Exonic
999698169 5:154204417-154204439 ACCCTTGCAAATGTGTACTTGGG - Intronic
1003287944 6:4751153-4751175 AACCATTAAAAAGAGTATTTTGG - Intronic
1006975232 6:38094288-38094310 ACCCATGGAAAGTGTTACTTTGG - Intronic
1008374973 6:50781198-50781220 AGCCATGAAGAGGATTATTTGGG - Intergenic
1008676351 6:53823396-53823418 ACTCATGAAAAGTAGTGCTAGGG + Intronic
1013589656 6:111609406-111609428 AGCAATGAAAAGCAGCACTTCGG - Intergenic
1015189230 6:130455254-130455276 ACCCTAGAAAATGAGTCCTTTGG + Intergenic
1017552472 6:155523778-155523800 ACCACTGAAAAGAAGTTCTTTGG - Intergenic
1021619344 7:22536245-22536267 ACGCAGGAAAGGGAGTGCTTTGG - Intronic
1022637680 7:32152545-32152567 CCCCATGAAAAGGGCTACTCAGG + Intronic
1023384375 7:39641035-39641057 GCCCAAGAAATGGAGTGCTTTGG + Intronic
1023598746 7:41860317-41860339 ACTCCTGAAAATGAGCACTTTGG + Intergenic
1023968048 7:44973530-44973552 TCCCATGAAATGGAGCTCTTTGG - Intronic
1027981977 7:85236195-85236217 ACCTACAAAAAGGAGTTCTTGGG - Intergenic
1028371915 7:90101345-90101367 ACGCAGGAAAGGGAGTGCTTTGG + Intergenic
1028518051 7:91699207-91699229 ACCCATTTAATGAAGTACTTTGG - Intronic
1029011684 7:97268707-97268729 ACCCCTGGAAAAGAGTAATTGGG + Intergenic
1029906020 7:104094112-104094134 TCCCATGAAAAGAGGTACTAGGG - Intergenic
1033261719 7:139849721-139849743 ACCCTGGAAAAGCAGGACTTAGG + Intronic
1033791367 7:144795874-144795896 ACCCATGCTCAGGAGTACTGTGG - Intronic
1037634405 8:20688460-20688482 AGCCAGGAAAAGAAGTAATTTGG + Intergenic
1039689817 8:39851469-39851491 TCCCATGCACAGGAGTCCTTTGG + Intergenic
1042600578 8:70495272-70495294 ACCCAGGAAGGGGAGTATTTTGG - Intergenic
1042715002 8:71762917-71762939 ACTCATGAAGAGAAGGACTTAGG + Intergenic
1043971976 8:86539978-86540000 ACCTATTACAAGGAGCACTTAGG - Intronic
1045852411 8:106718531-106718553 CCACATGATAAAGAGTACTTTGG + Intronic
1047417489 8:124677076-124677098 GACCATGAGAAGGAGGACTTTGG - Intronic
1047622756 8:126624325-126624347 CCCCATGCAAAGGAGTCCATGGG + Intergenic
1047846936 8:128816353-128816375 ACCAATGCAAAAGAGTACTAGGG + Intergenic
1049893917 9:96319-96341 ACTCATGAAGAAGAGTGCTTGGG - Intergenic
1051901751 9:22050444-22050466 ACCAAAGGAAAGGAGTATTTGGG + Intergenic
1053334994 9:37260193-37260215 TTCCAGGAAGAGGAGTACTTTGG + Intronic
1053702646 9:40712646-40712668 ACCCTTAAAAAAGAGTACTCTGG + Intergenic
1053735145 9:41096403-41096425 ACTCATGAAGAAGAGTGCTTGGG - Intergenic
1054412705 9:64836110-64836132 ACCCTTAAAAAAGAGTACTCTGG + Intergenic
1054693237 9:68334994-68335016 ACTCATGAAGAAGAGTGCTTGGG + Intronic
1056097573 9:83271340-83271362 ATCCATTAAAAAGAGTCCTTGGG + Intronic
1057746050 9:97752237-97752259 TCCCATCAACGGGAGTACTTTGG + Intergenic
1061217451 9:129230022-129230044 ACCCATGAAGAGGAGGAACTGGG + Intergenic
1062129450 9:134884728-134884750 ATCCATGAACAGGAGCACCTGGG + Exonic
1186951458 X:14630032-14630054 ACCCAAGAAATGAAGTACATTGG - Intronic
1189586576 X:42468020-42468042 ACCGAGGAAAAGGAGGACCTTGG + Intergenic
1190689952 X:52905501-52905523 ACCCATGAAAAGGAGTACTTTGG + Intronic
1190696031 X:52950291-52950313 ACCCATGAAAAGGAGTACTTTGG - Intronic
1194137107 X:90159360-90159382 ACTAATGAAAAGAAGTACATGGG - Intergenic
1197636044 X:128915941-128915963 ACCCATTAAAAGAACTACTTGGG - Intergenic
1200482843 Y:3729283-3729305 ACTAATGAAAAGAAGTACATGGG - Intergenic