ID: 1190695136

View in Genome Browser
Species Human (GRCh38)
Location X:52943973-52943995
Sequence TTCTTTTAGACTATAGAGGA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 236
Summary {0: 2, 1: 0, 2: 3, 3: 24, 4: 207}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1190695136_1190695141 -8 Left 1190695136 X:52943973-52943995 CCCTCCTCTATAGTCTAAAAGAA 0: 2
1: 0
2: 3
3: 24
4: 207
Right 1190695141 X:52943988-52944010 TAAAAGAATCTGTGAAGGGTTGG 0: 2
1: 0
2: 2
3: 34
4: 379
1190695136_1190695142 16 Left 1190695136 X:52943973-52943995 CCCTCCTCTATAGTCTAAAAGAA 0: 2
1: 0
2: 3
3: 24
4: 207
Right 1190695142 X:52944012-52944034 ATTATGTATTTTGTAAATGTTGG 0: 2
1: 0
2: 5
3: 112
4: 888

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1190695136 Original CRISPR TTCTTTTAGACTATAGAGGA GGG (reversed) Intronic
901505856 1:9685250-9685272 TTCTATTAGAATAAACAGGAGGG - Intronic
901893577 1:12289252-12289274 TTTTTTTAAACTATAGAGACAGG + Intronic
902700409 1:18168273-18168295 TTCTTTTAAACTACCCAGGAAGG + Intronic
902975293 1:20083968-20083990 TTCTTTTAAAATCAAGAGGAAGG + Intronic
906743440 1:48205053-48205075 GTCGTTTAGACTATAAAGGGTGG + Intergenic
907486643 1:54782528-54782550 TTCATTTAGAGCAGAGAGGAAGG - Intronic
910282639 1:85518355-85518377 TTCTCTTAGACTGTACAGGAAGG - Intronic
911712005 1:101084675-101084697 TTCATTTTGGCTATAAAGGATGG - Intergenic
912173014 1:107123764-107123786 TGCATTTAGAATAAAGAGGATGG + Intergenic
912245016 1:107952721-107952743 TGCTTTTAGTCTATACAGTACGG - Intronic
912842934 1:113054688-113054710 TTCATTATGACTGTAGAGGATGG - Intergenic
914207375 1:145544628-145544650 TTCTCTTAGACTGTACAGGAAGG + Intergenic
915060040 1:153173904-153173926 TTCTTTCACACCATAAAGGATGG + Intergenic
920083723 1:203398124-203398146 TTATTTTAGACCCTATAGGATGG - Intergenic
922678413 1:227568467-227568489 TTCTTTGAGAACATAAAGGATGG + Intronic
924398210 1:243647518-243647540 TTCTTTTATGCTATTGTGGAGGG + Intronic
924652455 1:245941817-245941839 TTCTTTAAGAATATTGAGGCAGG - Intronic
1064877427 10:20010329-20010351 TTCTTTTAGCATATTGATGAGGG + Intronic
1064980751 10:21164282-21164304 TCCTTTAAGTCTCTAGAGGAAGG - Intronic
1067166694 10:43871079-43871101 TGCTTCTAGACCACAGAGGATGG + Intergenic
1068756067 10:60654813-60654835 CTCTTTGAGAAAATAGAGGAAGG - Intronic
1068895493 10:62195452-62195474 TTTTTTTAAACTGTAAAGGAAGG + Exonic
1069591326 10:69644121-69644143 TTCTTTCAGACTACAGAGGAGGG + Intergenic
1070763410 10:79040585-79040607 TTCTTTCAAACCATAGAGGATGG + Intergenic
1071796263 10:89009573-89009595 GTCTTTTAGGCTAAAGAGGTTGG + Intronic
1071881356 10:89901389-89901411 TTATTTTAGGCTATAGTGTATGG + Intergenic
1074101974 10:110360765-110360787 TTCTTGTAGACATCAGAGGATGG - Intergenic
1076539400 10:131204659-131204681 TTATTTTAGCCTCTAGTGGAAGG - Intronic
1078388375 11:10913064-10913086 TTTTTTTAGACTCTGGAGAATGG + Intergenic
1078817331 11:14838911-14838933 TCCTTGTATACTGTAGAGGAAGG + Intronic
1079569275 11:21922371-21922393 TTCATTTAGTCTCTAGAGGCAGG - Intergenic
1079950320 11:26793857-26793879 TTCTTTTAGAATAAAGGTGAAGG + Intergenic
1081005143 11:37727109-37727131 TTTTTATAAAGTATAGAGGAGGG + Intergenic
1082718248 11:56641540-56641562 ATTTTTTAAACTATAGATGAGGG + Exonic
1082774481 11:57235042-57235064 TTCTCATAGAAAATAGAGGAAGG + Exonic
1085498586 11:76995926-76995948 TTCTTTTAAACTATAGACCTAGG + Intronic
1086024746 11:82277307-82277329 TTATTTTACACGATTGAGGAGGG + Intergenic
1089459169 11:118642586-118642608 TAGTTTTAGACTATGGAGGCTGG - Intronic
1090494653 11:127198667-127198689 TTCTTTTGCACTGTTGAGGAAGG + Intergenic
1091977204 12:4835059-4835081 TTCTTGGAGTCTATATAGGAGGG + Intronic
1092966260 12:13646496-13646518 TTCTTTTAAACAATAGAATATGG + Intronic
1093484274 12:19636653-19636675 TTCTTTTACACCAGAGAGAATGG - Intronic
1094080312 12:26527724-26527746 TTCTTCTATACTATAAAGCAAGG + Intronic
1098217008 12:68231460-68231482 TTCTTCTGGATTATAGAAGAAGG - Intergenic
1098425386 12:70359687-70359709 TTCTTTTAGACAATAATTGAAGG + Intergenic
1098741933 12:74184041-74184063 TTCTTTTAGATAATTGAGAAAGG - Intergenic
1099441362 12:82703393-82703415 TCCTTTTATGATATAGAGGAGGG + Intronic
1099564596 12:84227215-84227237 TTCTTATAGACAATAGAGAAAGG - Intergenic
1099869163 12:88324789-88324811 TTTTTTAAGCCTATAGAGAAAGG + Intergenic
1099920151 12:88947358-88947380 TACTTTATGACTCTAGAGGAAGG + Intergenic
1100689008 12:97019075-97019097 TTCTCCTTGACTATTGAGGAAGG - Intergenic
1103453196 12:121044098-121044120 TTCTTGTTGACTATAGGTGAGGG + Intergenic
1103732377 12:123036509-123036531 TTCTTTTTTAATAGAGAGGAGGG - Intronic
1105453252 13:20518888-20518910 TTCTTTTGGACAAGAAAGGATGG + Intronic
1108775273 13:53758083-53758105 TTCTCTTAGACTAAAGTGAATGG - Intergenic
1110648188 13:77913875-77913897 TTATTTTAGGATATATAGGAAGG + Intronic
1112064070 13:95773002-95773024 CTCTTTCAGAAAATAGAGGAGGG - Intronic
1114136617 14:19859103-19859125 TAGTTTTGGAATATAGAGGAGGG + Intergenic
1114716693 14:24833915-24833937 TCCATTTAGAATATAGAGGAAGG + Intronic
1115854324 14:37613521-37613543 TTCTTTCAGCAAATAGAGGAGGG - Intronic
1115862379 14:37701621-37701643 TTCTTGGACACTAAAGAGGAGGG + Intronic
1116180800 14:41530828-41530850 TTCTTTTAGACTAAAGAACAAGG - Intergenic
1116248340 14:42448270-42448292 TGCTTTAAAACTATAGAGCAAGG + Intergenic
1118526662 14:66652112-66652134 GTCTTTCAGAATATAGAGGGGGG + Intronic
1119098004 14:71852133-71852155 TTCCTTTAGACTGTAGTGCAGGG - Intergenic
1124430054 15:29599298-29599320 TTCATTTAGACTAATAAGGATGG + Intergenic
1125133919 15:36318459-36318481 TTCTTTCAGAAGATAGAGGAAGG - Intergenic
1125164916 15:36691534-36691556 TTCTGTTAGATTATAGAAAAAGG + Intronic
1126791747 15:52227747-52227769 TACTTTTAAACAATAGGGGACGG + Intronic
1130842708 15:87716473-87716495 TGCTTTTAGACAAGAGAAGATGG + Intergenic
1131370356 15:91875952-91875974 TTCTTTAAGATTCTAGAGCAGGG - Intronic
1131987617 15:98060907-98060929 TTCTTTTCAACTACATAGGAAGG - Intergenic
1133691734 16:8222148-8222170 TGCTTTTAGACTACAAAGGCAGG - Intergenic
1134333178 16:13269217-13269239 TCCTTTTAGACTATATAGCATGG + Intergenic
1135228079 16:20678924-20678946 TTCTTCTAGTCTACAGATGATGG - Intronic
1137469977 16:48745478-48745500 TTTTTTTAGAAAATGGAGGAAGG + Intergenic
1137907628 16:52339560-52339582 TTCTTTTAAATTAAAGGGGAGGG + Intergenic
1139642893 16:68305631-68305653 TTCTTTTTGACTTTGGAGCAAGG - Intronic
1140073306 16:71672025-71672047 TTCTTAAAGACTATAGATGTAGG - Intronic
1140156412 16:72432139-72432161 CTTTTTCAGAGTATAGAGGAGGG - Intergenic
1143475309 17:7199630-7199652 TTCTTTCATACTAGAGAGCAAGG - Intronic
1145404544 17:22574592-22574614 TTATTTTAGACAATAGAGAAAGG - Intergenic
1147023727 17:37561628-37561650 TCCTTTTAGATGATAAAGGAGGG - Intronic
1147443660 17:40462213-40462235 TTCTATTAGCCTACAGAGGGTGG + Intergenic
1149083555 17:52686715-52686737 TTCTTTTATTTTATAGAAGAAGG + Intergenic
1149938369 17:60833166-60833188 TTCTTTTAGAATATATAAAATGG - Intronic
1153005234 18:492330-492352 TTTTGTTAGACTGTAAAGGAAGG - Intronic
1154460888 18:14584115-14584137 TAGTTTTGGAATATAGAGGAGGG + Intergenic
1155971820 18:32090820-32090842 TTCATTTAGACCATGGGGGAGGG + Intergenic
1156708212 18:39909767-39909789 TTCTTTTAGACTGCTAAGGAAGG - Intergenic
1158749950 18:60247358-60247380 TTCTTTTAATCTATGCAGGAAGG + Intergenic
1163090338 19:15015011-15015033 TTATTTTAAAATATAGATGAGGG - Intronic
925121149 2:1419476-1419498 TACTTTTAGGCAATAGAGGCAGG - Intronic
926067425 2:9854550-9854572 TTCTGTTACAGTCTAGAGGACGG + Intronic
926702642 2:15813928-15813950 TTCCTTGAGACAAGAGAGGAAGG - Intergenic
927306026 2:21574096-21574118 TACTTTAAGAGTTTAGAGGAAGG - Intergenic
928500254 2:31885005-31885027 TTCTTTTAAAATTTAGAGTAAGG + Intronic
930998670 2:57754590-57754612 TTTTTTTAAACTATAGAGAAGGG - Intergenic
931689001 2:64819404-64819426 TTCTTTTAGAGAATCAAGGAAGG + Intergenic
932516417 2:72354701-72354723 TTCTTTTTGACTACAGATGATGG - Intronic
933235340 2:79858454-79858476 TTCTTTTAGTCTACAGAGCCTGG + Intronic
936880668 2:117246681-117246703 TTTTTTTTTACTACAGAGGAAGG - Intergenic
937488361 2:122339392-122339414 TTCTTTTGTACTTTACAGGATGG + Intergenic
939729761 2:145768253-145768275 TGCTTTTAGAATAAAGAGGCTGG - Intergenic
939978905 2:148755154-148755176 TTTTTTTAAACATTAGAGGATGG + Intronic
941900108 2:170669980-170670002 TTTTTTTAAACTAGAGATGAGGG + Intergenic
942568796 2:177292663-177292685 TTCTTTTAGACTAAAGATGCAGG + Intronic
942967002 2:181907087-181907109 TCTTTTTAAACTTTAGAGGAAGG + Intronic
943813962 2:192227518-192227540 TTATTTTAGAAGATAGATGATGG - Intergenic
944530289 2:200661197-200661219 TTCTGCTAGTCTATAGAGTAAGG - Intronic
947431222 2:230029800-230029822 GTTTTTCAGAGTATAGAGGAAGG + Intergenic
948212774 2:236207403-236207425 TTCTTGTACTCCATAGAGGATGG + Intronic
1169886301 20:10402380-10402402 TTTTCTTGAACTATAGAGGAAGG + Exonic
1170187961 20:13612948-13612970 TTATTTTAGGATATAGAGGATGG + Intronic
1170331902 20:15221685-15221707 TTCTTTTTTAATATAGAGGATGG + Intronic
1171507645 20:25651705-25651727 TTGTTATAGCCTTTAGAGGAGGG + Intergenic
1172713990 20:36949801-36949823 TTCTTTTATATGATAAAGGACGG + Intronic
1176669130 21:9715726-9715748 TTATTTTCTACTTTAGAGGAAGG - Intergenic
1179082325 21:38183065-38183087 TTCTTTTATTCTATTGAGAATGG + Intronic
952400518 3:32959223-32959245 TTCTTTGGGACTCCAGAGGAAGG + Intergenic
952814114 3:37431925-37431947 TGCTGTAAGACTATAGAGGAAGG - Intronic
954002766 3:47570846-47570868 TTCATTTAGACTTTAGATAAGGG + Intronic
954971511 3:54655182-54655204 TTCTCTTGGACTATTGAGTAGGG + Intronic
955086241 3:55705707-55705729 TTCTGTTCTGCTATAGAGGAGGG - Intronic
956336093 3:68165753-68165775 TCCTTTTAGACAAGAGGGGAGGG - Intronic
956531692 3:70226941-70226963 TTATTTTAGCCTATAGACAATGG + Intergenic
957377254 3:79374165-79374187 TTCCTTTAGTGTATAGAGGCTGG + Intronic
959479602 3:106855032-106855054 TTCTTTAAGAATATTGAGGCTGG - Intergenic
961002882 3:123385829-123385851 TTTTTGTAGACTATAGAGAGAGG - Intronic
961365364 3:126396013-126396035 TTCTTGGAGACTATAGTGGACGG - Exonic
964446731 3:156767028-156767050 TTCTTTTAGGTTAGACAGGAAGG + Intergenic
965475637 3:169151374-169151396 TGTTTTTAGTTTATAGAGGAAGG + Intronic
965670658 3:171144435-171144457 TTATTTTAGACATTAGAGAAAGG + Intronic
966212637 3:177469172-177469194 TTCTCTTGAACTATAGAGGTGGG + Intergenic
966268311 3:178073349-178073371 GTCTATTAGACTATATAAGAAGG + Intergenic
967672228 3:192250800-192250822 TTCTGGTAGACTAGAAAGGAAGG + Intronic
968787400 4:2632857-2632879 TTCTTGTAGAAGACAGAGGAGGG - Intronic
969538928 4:7773819-7773841 TGCTTTTGGAGTTTAGAGGAGGG - Intronic
970010771 4:11456511-11456533 TTTTTTAAGATTATAGATGAAGG + Intergenic
970939736 4:21617721-21617743 TTTATTTAGACAATAGAGGGTGG - Intronic
971578948 4:28309266-28309288 CTATTTTAGACTGTAGAGTAAGG - Intergenic
972531484 4:39965126-39965148 TTCTTTTAACCAATAGAGTAAGG + Intronic
973815025 4:54611563-54611585 TTCTTTTTGACTACAAAAGAAGG + Intergenic
974320156 4:60337114-60337136 TTCTTTCTGGCTAGAGAGGATGG + Intergenic
976489011 4:85644898-85644920 TGCTTCTAAACTATAGATGATGG + Intronic
976628895 4:87217659-87217681 TTTTTTTGGAATATAGAGAAAGG + Intronic
979905796 4:126289987-126290009 TTCTTTCAGAATATAGAGGAGGG - Intergenic
980407539 4:132373033-132373055 TTTTTTTATAATATAGTGGAAGG + Intergenic
981070836 4:140536373-140536395 TTCTATGTGAATATAGAGGAAGG + Intronic
981207232 4:142057050-142057072 TTCTTTTAAATTTTAGAGTATGG + Intronic
982666202 4:158267206-158267228 CTCTTTTAGAATATAGAAGCAGG - Intergenic
983845978 4:172518470-172518492 TTTTTTTAGAATTTAGAGAACGG + Intronic
984121649 4:175752515-175752537 CTTTTTTAGAGCATAGAGGAGGG - Intronic
984607034 4:181797185-181797207 TTCTTTTAGGATTGAGAGGAAGG - Intergenic
985831054 5:2230654-2230676 TTCTCATAGACAATAAAGGAAGG - Intergenic
986046755 5:4045211-4045233 TTTTTTTAGACAATAAAGGAAGG + Intergenic
987935641 5:24460969-24460991 TTCTTTTTGGTGATAGAGGAAGG - Intergenic
991315305 5:65297045-65297067 TTTATTTAGACTATAGAGAAAGG - Intronic
991649088 5:68833608-68833630 CTCTTCTAGACTGGAGAGGAAGG - Intergenic
993433988 5:87868447-87868469 TTCTTTTAGACTAGAGATTGAGG - Intergenic
995092658 5:108196489-108196511 TTCCTTTTGACTCTAGTGGAAGG - Intronic
995324411 5:110874140-110874162 TTCTATAAGACTATAGATAATGG - Intergenic
995515703 5:112953140-112953162 TTGTTTTAAACTATAGAATATGG + Intergenic
995586563 5:113654573-113654595 ATCTTTTAGCCCACAGAGGAGGG - Intergenic
996096320 5:119402741-119402763 TTCTTTTAGAGTCTGGGGGAGGG - Intergenic
996317864 5:122181185-122181207 TTCTTTTTACCTAGAGAGGAAGG - Intergenic
997591794 5:135078118-135078140 TTATTTTAGAGAGTAGAGGATGG - Intronic
997934062 5:138095511-138095533 TTATTTTAGAAGATAGAGAAAGG + Intergenic
999727333 5:154447074-154447096 TTGGTTTAGACTTTAGAGCAGGG + Intronic
1000817463 5:165941309-165941331 TGCTTTTAGAGCATAGAGGTCGG + Intergenic
1004188595 6:13444518-13444540 TTTTTTTAAACTCTAGAGAAAGG - Intronic
1005799083 6:29401027-29401049 TCATCTTAGACTCTAGAGGACGG - Intronic
1006878598 6:37319672-37319694 TTCTTTTAGACAAAATAGAATGG + Intronic
1008397928 6:51030906-51030928 TGCTTTTGGAGAATAGAGGAAGG - Intergenic
1008953876 6:57192591-57192613 TTCTTTTAGAAGATGGAGGCTGG + Intronic
1008964102 6:57297000-57297022 TTATTTTATTCTATAGAGTATGG - Intergenic
1009060511 6:58392881-58392903 TTCTTTCACCCTATAGAGAATGG + Intergenic
1009230403 6:61054453-61054475 TTCTTTCACCCTATAGAGAACGG - Intergenic
1009583864 6:65570904-65570926 TTCTTTTAGAATATAAACAAAGG - Intronic
1010177781 6:73049874-73049896 TTCTTTTAGACTTTAGACAATGG - Intronic
1010668995 6:78664120-78664142 TTGTTTTAGAGTATGGAGGCAGG - Intergenic
1012538676 6:100332200-100332222 TACTATTATACTATTGAGGAAGG - Intergenic
1012724642 6:102795028-102795050 TTCTTTGAGCCCAGAGAGGAGGG + Intergenic
1012752138 6:103177614-103177636 TTGTTATAGAATTTAGAGGAAGG - Intergenic
1012955325 6:105563749-105563771 TTCTTTTAAACTTTAGAGGATGG + Intergenic
1013819837 6:114141578-114141600 TTCTTTTTAACTATAAAGAAAGG + Intronic
1016965223 6:149712521-149712543 TTCTTTTTGAATAGAGATGAGGG + Intronic
1020180664 7:5920065-5920087 TTCTCGTGGACTGTAGAGGATGG + Intronic
1020302266 7:6804817-6804839 TTCTCGTGGACTGTAGAGGATGG - Intronic
1028450099 7:90972412-90972434 TTCTTTTAGAATACAGAAAAAGG + Intronic
1028788750 7:94828393-94828415 CTCTTTCAGAAAATAGAGGAGGG - Intergenic
1030260813 7:107562510-107562532 ATCTTGTAGACTATAAAGGTAGG - Intronic
1031344909 7:120652950-120652972 ATCTTTTAGAATGTTGAGGATGG + Intronic
1032060640 7:128722142-128722164 TTCTTTCAGAAAATAGAGGAGGG - Intronic
1035929913 8:3768824-3768846 TTCTTTTAGACTATCCACCAAGG - Intronic
1037046410 8:14309992-14310014 TTTTTTTTGACTATTGTGGATGG - Intronic
1040944671 8:52871844-52871866 TTCTTTTAGATTCTTGAGGTGGG + Intergenic
1041059055 8:54018343-54018365 TTCATTTAGATTATAGAAGGAGG - Intronic
1041246147 8:55890103-55890125 TTTTTTTTGTCTATAGAGGCAGG - Intronic
1041707538 8:60862404-60862426 TTCTTTTCCCCTATAGAAGAAGG - Intronic
1041831353 8:62157877-62157899 TTCTTTTAGGTTTTACAGGATGG - Intergenic
1042443892 8:68861373-68861395 TTTTTCTAGATTATAGAGCAAGG + Intergenic
1042867343 8:73367426-73367448 TCCTTTGGGACTTTAGAGGAGGG + Intergenic
1043225158 8:77718101-77718123 TTAATTTAGATTATAGAAGATGG - Intergenic
1043486965 8:80707337-80707359 TTCCTTTATAATATAGAGGTGGG + Intronic
1044919335 8:97151368-97151390 TTATTTTACAGTATAGAAGAAGG + Intergenic
1045069836 8:98491076-98491098 TACTTTTAGAAGATAGAGGTAGG - Intronic
1047711223 8:127554303-127554325 TTCTCTTAGACAGTAGTGGAAGG - Intergenic
1048614928 8:136063524-136063546 TTCTTTGTGACTATAGAAAATGG - Intergenic
1049049093 8:140178656-140178678 TTCTTTCAGAAAGTAGAGGAGGG - Intronic
1050447829 9:5745041-5745063 TTATTTTAAACTATGGAGGTGGG - Intronic
1054700147 9:68405191-68405213 TTCTCTGGGACTATAGAAGATGG + Intronic
1059601877 9:115787620-115787642 TTCTTTGTGACTCTAGAGAATGG + Intergenic
1061745570 9:132737352-132737374 CTCTTTCAGAAAATAGAGGAAGG + Intronic
1061770479 9:132916351-132916373 TTCTTTAGAACTATAGAGGCAGG - Intronic
1062296227 9:135828641-135828663 TTCTTTGAGCCTACAGAGGAGGG + Intronic
1203528680 Un_GL000213v1:115223-115245 CTCATTTAGACTACAGATGAGGG + Intergenic
1203656736 Un_KI270753v1:5210-5232 TTATTTTCTACTTTAGAGGAAGG + Intergenic
1186990217 X:15059194-15059216 TTCTTTTTGATAAAAGAGGATGG - Intergenic
1187720959 X:22150365-22150387 TACTTTGAGAATATAGAGCAGGG + Intronic
1188259290 X:28003523-28003545 TTCTTCTATAGTATAAAGGAGGG + Intergenic
1188888768 X:35583439-35583461 CTATTTTAGAGTCTAGAGGATGG - Intergenic
1189906921 X:45770642-45770664 TTATTGGAGACTATAGAGGAAGG - Intergenic
1190000109 X:46677752-46677774 TTCTTTCAGAAAATAGAAGAGGG - Intronic
1190690847 X:52911819-52911841 TTCTTTTAGACTATAGAGGAGGG + Intergenic
1190695136 X:52943973-52943995 TTCTTTTAGACTATAGAGGAGGG - Intronic
1191689464 X:63925136-63925158 TTCTTTAAGACATTTGAGGAGGG - Intergenic
1191826405 X:65370072-65370094 TTCTTTTTCAATATAGACGAGGG - Intronic
1194740771 X:97571623-97571645 TTCTTTTATAGAATAGAGGCTGG + Intronic
1195898969 X:109777796-109777818 TTCTTTTAGAATAGAAAGGATGG + Intergenic
1196169328 X:112570262-112570284 TTCTTTTTTATTTTAGAGGATGG + Intergenic
1196405128 X:115353280-115353302 TTTTTTTTGACTAAAGAGGTGGG + Intergenic
1198786436 X:140293496-140293518 TTCTTTCAGAAAATAGAAGAGGG - Intergenic
1198848968 X:140944767-140944789 TTCTTTTAGGCTTTTGAGCACGG + Intergenic
1199332009 X:146573168-146573190 TTCTCTTAGAGTACAGAGGAAGG - Intergenic
1200408071 Y:2834587-2834609 TTCTTTTAGGTTCTAGTGGAAGG - Intergenic