ID: 1190697445

View in Genome Browser
Species Human (GRCh38)
Location X:52960816-52960838
Sequence CTCCTATTACAGATGAGGCA CGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 253
Summary {0: 2, 1: 0, 2: 0, 3: 23, 4: 228}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1190697443_1190697445 29 Left 1190697443 X:52960764-52960786 CCTAGACTCAACAAATGAAACTA 0: 2
1: 0
2: 1
3: 15
4: 295
Right 1190697445 X:52960816-52960838 CTCCTATTACAGATGAGGCACGG 0: 2
1: 0
2: 0
3: 23
4: 228

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1190697445 Original CRISPR CTCCTATTACAGATGAGGCA CGG Intronic
901408433 1:9066020-9066042 CACCTACTACAGACCAGGCATGG - Intronic
902797590 1:18809420-18809442 CCCATTTTATAGATGAGGCATGG - Intergenic
903122668 1:21226367-21226389 CTCCTTTTACAGACAAGACATGG + Intronic
903171036 1:21553850-21553872 CACCTATTACAGACCAGGCATGG - Intronic
904396717 1:30227389-30227411 CCCCAACTACAGATGAGGAAAGG + Intergenic
904886218 1:33740524-33740546 TTCCCATTGCAGATGAGGTAAGG + Intronic
905237436 1:36559890-36559912 CTCCCATCACAGAAGAGGCTGGG - Intergenic
907940018 1:59078504-59078526 CTCATTTTACAAATGAGGAATGG - Intergenic
908576871 1:65469187-65469209 GGGCTAATACAGATGAGGCAGGG + Intronic
910778521 1:90900920-90900942 CTCTTAGTTCAGATGTGGCAAGG + Intergenic
912699910 1:111869706-111869728 CTGCTTTCACAGATGAGGAAGGG + Intronic
912707563 1:111926380-111926402 CTCTTATTAAAGATGAGGTGAGG + Intronic
912903238 1:113675391-113675413 TTCGTAGTACAGATGGGGCAAGG - Intronic
916714894 1:167440272-167440294 CCCCAGTTACAGATGAGGAAAGG + Intronic
918566070 1:185933705-185933727 CTCCAATGACAGATTAGCCAAGG - Exonic
919111811 1:193229464-193229486 CTCCTATCACAGAAGGAGCAAGG - Intronic
922430532 1:225547974-225547996 CTCCTCTTACAGGGGAGGTAAGG - Intronic
924363893 1:243269168-243269190 GTCCTTTTAAAGATGAGGCTTGG + Intronic
1066366449 10:34781452-34781474 CTCCTTTCACAGATGAGGCTTGG + Intronic
1067297676 10:44984142-44984164 CTCCTACCCCGGATGAGGCAGGG - Intronic
1068227867 10:54130082-54130104 ATCATACTAAAGATGAGGCAAGG - Intronic
1068946808 10:62737829-62737851 GTCATATTACAGATAAGGCCTGG + Intergenic
1069663207 10:70137571-70137593 CTCCCTTTACAGATTAGGAATGG - Intergenic
1069736264 10:70656709-70656731 CTCATAGTTCAGATGAGGCTGGG + Intergenic
1070826648 10:79394136-79394158 CTCCCATTTCAGATGAGACAAGG + Intronic
1071038635 10:81279340-81279362 ATCCTATTAAAAATGAGGAAAGG + Intergenic
1071963964 10:90833448-90833470 CTCCTTTTACAAATAAGGAAAGG - Intronic
1073515781 10:104074452-104074474 GACCTACTTCAGATGAGGCAGGG + Intronic
1074429442 10:113381269-113381291 CTCCTCTGACAGGTGAGCCAAGG + Intergenic
1075776735 10:124993975-124993997 TTCCTTCCACAGATGAGGCAGGG - Exonic
1078402979 11:11044494-11044516 CTCATTTTACAGTTGAGGGAAGG - Intergenic
1079451566 11:20603464-20603486 CCTCTTTTACAGATGAGACACGG + Intronic
1080745501 11:35105006-35105028 CTCCTATTATGGAGAAGGCAAGG + Intergenic
1081659695 11:44880417-44880439 CTCATTTTACAGATGAGGAGAGG - Intronic
1081978329 11:47249821-47249843 CTGGTATTACAGGTGAGCCACGG - Intronic
1083096169 11:60253735-60253757 CTCTTCTTACAGAGGAGGCCTGG + Intergenic
1083404901 11:62449789-62449811 CCCACATTACAGATGAGGCTAGG - Intronic
1084521688 11:69666974-69666996 CTCATTTTACAGAGGAGGGAGGG - Exonic
1085251982 11:75150118-75150140 CTGATTTTACAAATGAGGCATGG - Intronic
1087519541 11:99214035-99214057 CTGCTATTAGAGCAGAGGCATGG + Intronic
1088587097 11:111368920-111368942 CTCCGATGACAGATGGGCCATGG - Intronic
1089813164 11:121148121-121148143 CTCCCATTACTGGTGAGCCAGGG - Intronic
1090908510 11:131097772-131097794 CCCCAGTTACAGATGAGGAAGGG + Intergenic
1091843953 12:3640960-3640982 CTCCTTTTACAGACAAGGCTAGG - Intronic
1095700891 12:45189969-45189991 CTCCTGTTACAGATTTGGCAAGG + Intergenic
1096802488 12:54120381-54120403 CTCTTTTTACAGGTGAGGCCCGG - Intergenic
1097734211 12:63164377-63164399 GTTCTATCACAGGTGAGGCATGG + Intergenic
1099405673 12:82259121-82259143 CTACTATGGCAGTTGAGGCAGGG - Intronic
1102414578 12:112749405-112749427 CTCCTTTTACAGATGAGAGCTGG - Intronic
1102917623 12:116766443-116766465 CCCATTTTACAGATGAGGAAAGG + Intronic
1103149131 12:118621836-118621858 CCCATTTTACAGATGAGGAAAGG - Intergenic
1108195339 13:47988996-47989018 CTTCTATTAAATATGAAGCATGG + Intronic
1110310534 13:74044254-74044276 CCCATTTTACAGATGAGGAATGG - Intronic
1111975492 13:94962684-94962706 TTCATGTTACAGATGAGGGAGGG + Intergenic
1112618107 13:101026372-101026394 CTCCTTTTACAGAAGAGAAAAGG + Intergenic
1114061472 14:19021250-19021272 CTCCTATGACATATGTGGTAAGG - Intergenic
1114100776 14:19378714-19378736 CTCCTATGACATATGTGGTAAGG + Intergenic
1116805182 14:49487520-49487542 CTCTAATTACAGAAGAGGCTAGG - Intergenic
1117128743 14:52662627-52662649 TTCATATTACAGATGGGGTAGGG + Intronic
1117238609 14:53804789-53804811 CTGCTATCACAGATAAAGCAAGG - Intergenic
1117331239 14:54713932-54713954 CTCATTTTATAGATGAGGAAAGG - Intronic
1117688862 14:58284497-58284519 CCCATGTTACAGATGAGGCAAGG + Intronic
1118233711 14:63979605-63979627 CTCCTTTTAGAGATGAGGTGGGG + Intronic
1118375776 14:65175782-65175804 CTGGGATTACAGATGAGCCACGG + Intergenic
1119188464 14:72661782-72661804 CTCCTAGAAGAGATGAGGAAAGG - Exonic
1119206255 14:72796200-72796222 CTCCTTTTATAGATGGGGAAAGG - Intronic
1119516624 14:75253421-75253443 CCCCTCTTACAGATGAGAAATGG - Intronic
1121173853 14:91875760-91875782 CTCCTAGTTCAGAGCAGGCAAGG - Intronic
1121322422 14:92999700-92999722 CTCCATTTACAGGTGAGGCCCGG - Intronic
1121335529 14:93075642-93075664 CTCCTATGACCGCTGAGGGAAGG + Intronic
1121375617 14:93407589-93407611 CTCCTAACACAGATAAGGCCTGG - Intronic
1122231734 14:100309533-100309555 CTCCCATCCCAGAGGAGGCAGGG + Intergenic
1124487067 15:30127673-30127695 CTCCGTTTACAGATGGGCCAAGG + Intergenic
1124542152 15:30596648-30596670 CTCCGTTTACAGATGGGCCAAGG + Intergenic
1124756458 15:32410650-32410672 CTCCGTTTACAGATGGGCCAAGG - Intergenic
1126105550 15:45144756-45144778 CTCCTTTTACAGAAGAGGAAAGG - Intronic
1126366034 15:47895570-47895592 TTCCTATTATCCATGAGGCATGG + Intergenic
1127572848 15:60261249-60261271 CTCATACTGCAGATGAGGAAAGG - Intergenic
1127601753 15:60544560-60544582 TTGCCATTACAGATGAGACAAGG + Intronic
1129236748 15:74228318-74228340 CTCATTTTACAGATGAGGAAAGG - Intergenic
1131424784 15:92336805-92336827 CTCCTACTACTGAAGAGTCAAGG + Intergenic
1132163519 15:99564879-99564901 CCCATTTTACAGATGAGGAAAGG - Intergenic
1133773482 16:8881241-8881263 CCTATTTTACAGATGAGGCAGGG + Intergenic
1133921754 16:10159627-10159649 CCCATTTTACAGATGAGGAAAGG + Intronic
1134776408 16:16857417-16857439 CTTGTTTTTCAGATGAGGCAGGG + Intergenic
1135178632 16:20253633-20253655 CTCACATGACAGAAGAGGCAAGG + Intergenic
1135940816 16:26820117-26820139 CTCCTTTTACAGATGGGGAAAGG - Intergenic
1136579996 16:31145692-31145714 CTCCTTTTGCAGATGAGGCTTGG + Intronic
1137876919 16:52006129-52006151 GTCCTATGGCACATGAGGCAAGG - Intronic
1140153924 16:72402480-72402502 CTCCTTGTACTGATGAGGAAGGG - Intergenic
1140697684 16:77551118-77551140 CTCCGATCACAGATGAAGAAAGG + Intergenic
1140909317 16:79437599-79437621 CTCATTTTACAGCTGAGGAAAGG + Intergenic
1141124635 16:81392415-81392437 CTCCTATTCCAGCTGAAGGACGG - Intergenic
1141545248 16:84762883-84762905 CTTCCATTTCAGAGGAGGCATGG + Intronic
1142295825 16:89221401-89221423 CTCCTATTGCAGATATGGAACGG - Intronic
1142888060 17:2925640-2925662 CTCCTCTTAGAGAAAAGGCAGGG - Intronic
1143798737 17:9359796-9359818 CTCCTATCACAGTCCAGGCACGG - Intronic
1144394229 17:14827969-14827991 CTCCTTTAACAGAAGAGGAAAGG - Intergenic
1146032146 17:29375446-29375468 CTCATTTTACAGATGGGGAAAGG + Intergenic
1147671509 17:42179578-42179600 TTCCTATTACAGAGTAAGCAGGG + Intronic
1150337800 17:64343097-64343119 CTCCTTTTACAGATGGGGAAAGG + Intronic
1153929974 18:9869773-9869795 CTCCTTTTACAGAAGGAGCATGG + Intergenic
1157023327 18:43813327-43813349 TTCTCATTACAGAAGAGGCAAGG + Intergenic
1157535166 18:48452505-48452527 CCCCTATTACGTACGAGGCATGG - Intergenic
1160105726 18:75973991-75974013 CCCATTTTACAGATGAGGAAAGG - Intergenic
1166164660 19:40978872-40978894 CTCATTTTACAGATGAGAAACGG + Intergenic
1166661151 19:44647915-44647937 ACCCTTTTACAGATGAGGAAAGG - Intronic
1166700667 19:44879720-44879742 CCCGTGTTACAGAGGAGGCATGG - Intronic
925125064 2:1448451-1448473 CCCACATTACAGATGAGGAAGGG - Intronic
926950773 2:18240742-18240764 CTTTTATTACAGATAAGGAAAGG + Intronic
930867076 2:56132647-56132669 CTCATGTTACAGATGAGAAACGG + Intergenic
931915092 2:66945573-66945595 CCCTTATCACAGATGAGGAATGG + Intergenic
932275959 2:70452503-70452525 CTCCTTTTACAGATGAAAAAGGG + Intronic
932967173 2:76490182-76490204 CACCTAGTACATATCAGGCATGG - Intergenic
933772409 2:85752919-85752941 CTCGTTTTACAGGTGAGGAAAGG + Intronic
934677340 2:96258890-96258912 CTCACATTACTGATGAGGCCAGG + Intronic
936434008 2:112487636-112487658 CCCATTTTACAGATGAGACACGG - Intronic
937845153 2:126571541-126571563 CTCATTTTACAGATGAAGCACGG + Intergenic
938478832 2:131641585-131641607 CTCCTATGACATATGTGGTAAGG - Intergenic
938714798 2:134009691-134009713 CTCCTATGCAAGAGGAGGCAGGG - Intergenic
939639080 2:144617601-144617623 CCCTTTTTACAGATGAGGAAAGG + Intergenic
940894946 2:159072275-159072297 CTCCTATTAAAAATCAGGCTGGG - Intronic
940986322 2:160055706-160055728 CTTCTTTTACAGATGAAGAAGGG - Intronic
945573689 2:211503525-211503547 CTCCTAGTCCAGATCAGGAATGG + Intronic
946429018 2:219614820-219614842 CTTCTGTGACTGATGAGGCAGGG - Intronic
946491651 2:220154521-220154543 CTCCTTTTAAAAATGAGGAAAGG - Intergenic
946523480 2:220492450-220492472 CTCCTAATACAGATGATACTCGG - Intergenic
948198013 2:236109498-236109520 CTGCCATTACAGAGGATGCACGG - Intronic
1170238813 20:14139331-14139353 CTCCTTTTATAGATGAAGAAAGG + Intronic
1170238973 20:14141401-14141423 CTCCTTTTATAGATGAAGAAAGG - Intronic
1170957364 20:20993515-20993537 CGCCTATCACAGATTCGGCAGGG - Intergenic
1170986479 20:21263947-21263969 CTCCTATAACAAATGATGAATGG - Intergenic
1171023729 20:21609983-21610005 CTCTTGGTGCAGATGAGGCAAGG - Intergenic
1171854217 20:30330186-30330208 CTCTTTTTACAGGTGAGGCCTGG - Intergenic
1172670863 20:36633653-36633675 CACCTCTTTCAGATGAGCCAAGG + Intronic
1174300711 20:49580211-49580233 CGCATTTTACAGATGAGGAATGG + Intergenic
1174511004 20:51052500-51052522 CCCTTTTTACAGATGAGGAAAGG + Intergenic
1177061217 21:16376585-16376607 CACCTTTTATACATGAGGCAAGG + Intergenic
1180479960 22:15743848-15743870 CTCCTATGACATATGTGGTAAGG - Intergenic
1181107687 22:20584639-20584661 CACCCATTTCAGAGGAGGCAGGG + Intronic
1181468823 22:23125673-23125695 CCCATTTTACAGATGAGGAAAGG + Intronic
1181869256 22:25885236-25885258 CCCATCTCACAGATGAGGCAAGG + Intronic
1182722625 22:32415583-32415605 CCCATTTTACAGATGAGGAAAGG - Intronic
1183215808 22:36479194-36479216 CTCCTATTACAAGTGAAGAAAGG + Intronic
1183528556 22:38339042-38339064 TTCATGTTACAGATGAGGAAAGG + Intronic
1183571669 22:38657615-38657637 CATGTATTACAGATGAGGAAGGG - Intronic
1183602995 22:38850839-38850861 CCCATTTTACAGATGAGGAAAGG - Intergenic
1184404798 22:44293695-44293717 CCCATTTTACAGATGAGGAAGGG - Intronic
1185020679 22:48372946-48372968 TTCCAATTACAGATGCGGCCTGG - Intergenic
950708931 3:14801658-14801680 CTCATCTTACAGATGAGGAGAGG + Intergenic
951522543 3:23622700-23622722 CTCCCATCACAGAAGGGGCAAGG + Intergenic
951901083 3:27658271-27658293 CTCCTTTTCCAGATGAGGAAAGG + Intergenic
953948152 3:47166177-47166199 CCCCATTTACAGGTGAGGCACGG - Intergenic
955071182 3:55573708-55573730 CTCACATTAAAGATGAGGCAGGG - Intronic
955510290 3:59673370-59673392 CTCCTTTTAGAGATAATGCATGG - Intergenic
955748696 3:62166293-62166315 ATTCTATTACATATGAGGAATGG - Intronic
955758346 3:62250221-62250243 CCCATTTTACAGATGAGGAAAGG + Intronic
962217287 3:133533515-133533537 CACCTGTTAGAGATGAGGCTAGG - Intergenic
962348851 3:134642270-134642292 CTCCTGTTTCATATGGGGCATGG + Intronic
963719841 3:148849792-148849814 CTCATTTTCCAGCTGAGGCATGG + Intronic
964092651 3:152894481-152894503 CTCGTATGACAGAAGGGGCAAGG - Intergenic
965301247 3:167007618-167007640 TTCCTATCACAAATGAGGGAGGG - Intergenic
967178909 3:186886158-186886180 CTCCTATTACTGATGAGGAGTGG + Intergenic
968802491 4:2752370-2752392 CTTGTGTTACAGATGAGGTAAGG + Intronic
969290210 4:6234083-6234105 CTTATTTTACAGATGAGGCCGGG - Intergenic
969981928 4:11166512-11166534 CTCCCATTAAAGATGGGGCAGGG - Intergenic
970263203 4:14251614-14251636 CTTCCATTACAAATGAGGAAAGG + Intergenic
970422423 4:15918100-15918122 CCCATATTACAGAGGAGGGAAGG + Intergenic
972580960 4:40395303-40395325 TTCCTGTTACAGGTGAGGAATGG + Intergenic
972656935 4:41072903-41072925 CCCATTTTACAGATGAGGCTTGG - Intronic
972707962 4:41564186-41564208 CCCATTTTACAGATGAGGAAAGG + Intronic
972936953 4:44147835-44147857 CTGCTAGTGCAGATGATGCATGG - Intergenic
975333157 4:73142765-73142787 CTCCTAAAACAGAAAAGGCATGG + Exonic
982270700 4:153583738-153583760 CTACAACTACAGATTAGGCATGG + Intronic
982545559 4:156728333-156728355 ATCCTATTACAAATGTGGTATGG + Intergenic
985358204 4:189143808-189143830 TTCCTATTGCAGTTGAGACAAGG + Intergenic
990041684 5:51384337-51384359 CTCCTTTTAAAAATGAGTCAAGG + Intronic
993289192 5:86042613-86042635 TACCTATTACATGTGAGGCACGG - Intergenic
994820307 5:104641965-104641987 CTCTTGTTTCAGATGAGCCAAGG - Intergenic
995487015 5:112649379-112649401 CTTATTTTAGAGATGAGGCAAGG - Intergenic
997229185 5:132230350-132230372 CTCCCATAACAGACCAGGCACGG + Intronic
999435180 5:151558025-151558047 CTCCTTTTGCAGAGGAGGCTGGG - Intronic
1001329314 5:170751372-170751394 CCCCTTTTACAGATGAGAAAGGG + Intergenic
1001658996 5:173376446-173376468 CTCCTAAGTCAGATGTGGCAGGG + Intergenic
1002938481 6:1695471-1695493 GTCCTATTTCAGAAGAGGAAGGG + Intronic
1003110910 6:3251490-3251512 CTGCAATTGCAGATGAAGCACGG - Intronic
1004676337 6:17846317-17846339 CTCTTTTTAAAGATGAGGAAAGG - Intronic
1005434961 6:25799632-25799654 CTCCTTTTAAAGCTGAGGCAGGG + Intronic
1006254657 6:32820864-32820886 TCCCTTTTACAGATGAGGTAAGG + Intronic
1006480427 6:34288638-34288660 CTCCTCTTTCAAATAAGGCATGG - Exonic
1006828675 6:36955546-36955568 CGCCTTTTACAGATGAGACACGG - Intronic
1007097972 6:39226034-39226056 CTCATTTTGCAGATGAGGAAAGG + Intronic
1007116841 6:39348972-39348994 CACATCTTACAGATGAGGCAAGG + Intronic
1007652789 6:43433568-43433590 CTCACTTTACAGATGAGGAAGGG - Intronic
1011890328 6:92151244-92151266 CTCATATGGCAGAAGAGGCAAGG + Intergenic
1015799556 6:137046466-137046488 CCCTTTTTTCAGATGAGGCAAGG + Intergenic
1017185591 6:151597486-151597508 CTGCTATTAGTGATGATGCAGGG + Intronic
1018655010 6:166026380-166026402 TCCATTTTACAGATGAGGCATGG - Intergenic
1021028513 7:15699992-15700014 CTTCTATTACCTATGAGGCACGG + Intergenic
1022275199 7:28847949-28847971 TTCCTAACACAGATGAGGCCGGG - Intergenic
1026374006 7:69731898-69731920 CCCATTTTACAGATGAGGAAAGG - Intronic
1028178831 7:87691895-87691917 CTCATTTTACAGATGAGAAAAGG - Intronic
1029029698 7:97454587-97454609 CTCATATCACAGAAGGGGCAAGG - Intergenic
1030206300 7:106955368-106955390 CTCATATGACAGAAGGGGCAAGG - Intergenic
1031062714 7:117070308-117070330 CTCCTTTTACAGATGAGAAATGG - Intronic
1032642280 7:133783028-133783050 CCCATTTTAAAGATGAGGCACGG - Intronic
1033929699 7:146506887-146506909 CTCCCATTCCTGATGAGGCATGG - Intronic
1035492262 7:159290772-159290794 TCCCTATTCCAGATGAGGAAAGG + Intergenic
1035738188 8:1904597-1904619 CTCCGAATACACATGGGGCACGG + Intronic
1036516601 8:9450119-9450141 TTCATATTACAGATGAGGAGAGG - Intergenic
1037878588 8:22561616-22561638 CTCATCTTATAGATGAGGAAAGG - Intronic
1038410368 8:27353840-27353862 CTGCTATTGAAGATGAAGCAGGG + Intronic
1041029927 8:53726754-53726776 GTCCTATTTCAGATGATGGAGGG - Intronic
1042417084 8:68533088-68533110 CTTCTGTTACAGATGGGGTAGGG - Exonic
1042809868 8:72812429-72812451 CTGCTGTTACAAATGAGACAAGG - Intronic
1044246982 8:89959830-89959852 CTCATTTTATAGATGAGGAAAGG - Intronic
1044774202 8:95670613-95670635 TTCCTAGTAGAGATGAGGCCTGG - Intergenic
1045654401 8:104371958-104371980 TTCATATCACAGATGAGGAAAGG - Intronic
1045680315 8:104652423-104652445 TTCTTATCACAGATGAAGCATGG + Intronic
1045769643 8:105720902-105720924 CTACTTTTACAGATGCAGCAAGG - Intronic
1046374716 8:113361825-113361847 TTCCTATTGCTAATGAGGCAGGG - Intronic
1048370922 8:133775488-133775510 CTCATTTTATAGATGAGGAAAGG - Intergenic
1051577860 9:18637827-18637849 CTCTAATTAAAGATGAGCCAAGG - Intronic
1051869461 9:21720141-21720163 CTCATTTCACAAATGAGGCAAGG - Intergenic
1052756055 9:32542784-32542806 CTCCTCTTACAGATGAGTTCAGG + Exonic
1053278649 9:36802102-36802124 TTCCTTTTATAGAGGAGGCAGGG - Intergenic
1053792026 9:41693467-41693489 CTCTTTTTACAGGTGAGGCCCGG - Intergenic
1054153130 9:61621298-61621320 CTCTTTTTACAGGTGAGGCCCGG + Intergenic
1054180431 9:61905487-61905509 CTCTTTTTACAGGTGAGGCCCGG - Intergenic
1054472924 9:65552502-65552524 CTCTTTTTACAGGTGAGGCCCGG + Intergenic
1054657160 9:67675655-67675677 CTCTTTTTACAGGTGAGGCCCGG + Intergenic
1054877422 9:70111452-70111474 CTCATTTTACAGATGAGCAATGG - Intronic
1055609377 9:78005459-78005481 CTCCTTCTTCACATGAGGCAAGG - Intronic
1056596590 9:88012870-88012892 CTCCTTTTTCAGGTGATGCAGGG + Intergenic
1060110229 9:120901645-120901667 CTCCTAATCCAAATGAGCCAAGG - Intergenic
1060110867 9:120905353-120905375 CTCCTAATCCAAATGAGCCAAGG - Intronic
1060230261 9:121820650-121820672 CTCCCCTTTCAGATGAGGAAAGG - Intergenic
1060517120 9:124272780-124272802 TTCATTTTACAGATGAGGAAAGG + Intronic
1060757426 9:126223584-126223606 CTGCTTTCACAGATGAGGGACGG - Intergenic
1061367923 9:130182165-130182187 CCCATTTTACAGATGAGGAAAGG + Intronic
1061403634 9:130382058-130382080 CTCATTTCACAGATGAGGCAGGG + Intronic
1061648267 9:132024315-132024337 CTCCTTTTACAGATGAAGAATGG + Intronic
1062359780 9:136182250-136182272 CTCCTGCCCCAGATGAGGCAGGG - Intergenic
1185668011 X:1783069-1783091 CTCATTTTACAGATGAGAAATGG - Intergenic
1186105951 X:6206058-6206080 CTCATTTTACAGTTGAGGGAAGG + Intronic
1187253614 X:17621859-17621881 CTCATTTTACGGATGAGGAAAGG - Intronic
1189269296 X:39739678-39739700 TTCCCATTACAGATAAGGCTTGG + Intergenic
1190688538 X:52894976-52894998 CTCCTATTACAGATGAGGCACGG - Intronic
1190697445 X:52960816-52960838 CTCCTATTACAGATGAGGCACGG + Intronic
1192583423 X:72302778-72302800 GCCATTTTACAGATGAGGCAGGG - Intronic
1195229247 X:102829609-102829631 CCCCTTTTACAGATGAGCAAGGG - Intergenic
1199001321 X:142640400-142640422 CTCATATGGCAGAAGAGGCAAGG + Intergenic
1199726632 X:150589293-150589315 CTCCTATTACAGAGGAGATGCGG - Intronic