ID: 1190708315

View in Genome Browser
Species Human (GRCh38)
Location X:53048618-53048640
Sequence GACCTGGATTTGTGTGCACC GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 115
Summary {0: 1, 1: 0, 2: 0, 3: 11, 4: 103}

Found 9 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1190708307_1190708315 4 Left 1190708307 X:53048591-53048613 CCAGGCTGGGTGTCCCCAGCATC 0: 1
1: 0
2: 2
3: 29
4: 311
Right 1190708315 X:53048618-53048640 GACCTGGATTTGTGTGCACCGGG 0: 1
1: 0
2: 0
3: 11
4: 103
1190708303_1190708315 20 Left 1190708303 X:53048575-53048597 CCCACTGATGCTCTATCCAGGCT 0: 1
1: 0
2: 1
3: 7
4: 102
Right 1190708315 X:53048618-53048640 GACCTGGATTTGTGTGCACCGGG 0: 1
1: 0
2: 0
3: 11
4: 103
1190708300_1190708315 28 Left 1190708300 X:53048567-53048589 CCGGACTCCCCACTGATGCTCTA 0: 1
1: 0
2: 0
3: 10
4: 177
Right 1190708315 X:53048618-53048640 GACCTGGATTTGTGTGCACCGGG 0: 1
1: 0
2: 0
3: 11
4: 103
1190708302_1190708315 21 Left 1190708302 X:53048574-53048596 CCCCACTGATGCTCTATCCAGGC 0: 1
1: 0
2: 2
3: 10
4: 148
Right 1190708315 X:53048618-53048640 GACCTGGATTTGTGTGCACCGGG 0: 1
1: 0
2: 0
3: 11
4: 103
1190708311_1190708315 -9 Left 1190708311 X:53048604-53048626 CCCCAGCATCGTGGGACCTGGAT 0: 1
1: 0
2: 0
3: 7
4: 92
Right 1190708315 X:53048618-53048640 GACCTGGATTTGTGTGCACCGGG 0: 1
1: 0
2: 0
3: 11
4: 103
1190708298_1190708315 30 Left 1190708298 X:53048565-53048587 CCCCGGACTCCCCACTGATGCTC 0: 1
1: 0
2: 0
3: 12
4: 124
Right 1190708315 X:53048618-53048640 GACCTGGATTTGTGTGCACCGGG 0: 1
1: 0
2: 0
3: 11
4: 103
1190708312_1190708315 -10 Left 1190708312 X:53048605-53048627 CCCAGCATCGTGGGACCTGGATT 0: 1
1: 0
2: 0
3: 6
4: 68
Right 1190708315 X:53048618-53048640 GACCTGGATTTGTGTGCACCGGG 0: 1
1: 0
2: 0
3: 11
4: 103
1190708299_1190708315 29 Left 1190708299 X:53048566-53048588 CCCGGACTCCCCACTGATGCTCT 0: 1
1: 0
2: 2
3: 30
4: 263
Right 1190708315 X:53048618-53048640 GACCTGGATTTGTGTGCACCGGG 0: 1
1: 0
2: 0
3: 11
4: 103
1190708304_1190708315 19 Left 1190708304 X:53048576-53048598 CCACTGATGCTCTATCCAGGCTG 0: 1
1: 0
2: 0
3: 22
4: 170
Right 1190708315 X:53048618-53048640 GACCTGGATTTGTGTGCACCGGG 0: 1
1: 0
2: 0
3: 11
4: 103

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1190708315 Original CRISPR GACCTGGATTTGTGTGCACC GGG Intergenic
900420758 1:2555037-2555059 GGCCAGGATGTGAGTGCACCAGG + Intergenic
900594416 1:3474205-3474227 CACGTGTATGTGTGTGCACCGGG - Intronic
902563778 1:17296240-17296262 GACAAGGATTTGTGTGCAAGAGG - Intergenic
903372385 1:22844946-22844968 CACCCGGATTTGTGTGCTCCTGG + Intronic
903894149 1:26591974-26591996 AACCTGGATTTGTCTGGATCTGG - Intergenic
905297347 1:36962548-36962570 GCCCTGGGTTTGTGTGCAGTGGG + Intronic
908297172 1:62724313-62724335 GGCATGGCTTTGTGTGTACCTGG - Intergenic
910446337 1:87302134-87302156 GACCTGGACCAGTGTACACCGGG + Intergenic
911519460 1:98911052-98911074 GACATGTATTTGTGTTCATCAGG - Intronic
918175232 1:182037954-182037976 AACCTGTATTTGAGTGCACCTGG + Intergenic
920589457 1:207203020-207203042 GACAAGGATTTGTGAGCAACTGG + Intergenic
923267409 1:232328052-232328074 GACCTGCAGAAGTGTGCACCAGG + Intergenic
1071400458 10:85263690-85263712 GACCTGGCTTCAGGTGCACCTGG - Intergenic
1073097678 10:100989685-100989707 GCCCTGGATTTGTGTTCCCAGGG + Exonic
1073856954 10:107687350-107687372 AATCTGGATTTGTGTTCATCTGG + Intergenic
1074658189 10:115618908-115618930 TACCTGGATGTCTGTGCATCTGG + Intronic
1076451997 10:130562377-130562399 AACCTGGGTGTGTGTGCACTGGG - Intergenic
1077004603 11:347253-347275 AACCTGCATTTGAGTGCACCTGG - Intergenic
1077849609 11:6062853-6062875 CACCTGAATTTCTGTGCACCAGG + Intergenic
1079394421 11:20049674-20049696 GCCCTGGATTTCTCTGCAGCAGG + Intronic
1084856956 11:71995612-71995634 GACCTGCATTTGGGTCCTCCTGG + Intronic
1085839637 11:79996684-79996706 GTTCTGGACTTGAGTGCACCAGG + Intergenic
1086537628 11:87867127-87867149 GGCCTGGATTTCTGTTCATCTGG - Intergenic
1088470550 11:110184399-110184421 GACCTGGATTTCCCTACACCAGG - Intronic
1089102287 11:115973722-115973744 GTCCAGGATTTGTGTCCACAGGG + Intergenic
1091182987 11:133624042-133624064 GACTTGAAATTGTGTGCTCCTGG - Intergenic
1091254723 11:134173384-134173406 GACCTGGTTCTGTGTGCAAGAGG + Intronic
1096701141 12:53383573-53383595 GGCCTTGAATTGGGTGCACCTGG - Exonic
1099166862 12:79317562-79317584 GAGCTGGGTTTGTGTGCCCCGGG - Intronic
1101272610 12:103163438-103163460 GCCCTTGAATTGTGTGCTCCAGG + Intronic
1110683633 13:78346272-78346294 GAAGTGGATTTGTGGGCCCCAGG + Intergenic
1111411768 13:87886687-87886709 GACCAGGATTAGTGTGCAAGCGG + Intergenic
1111913454 13:94337195-94337217 GACCTGGATCTGGGTTCACATGG + Intronic
1115179722 14:30609614-30609636 GACCTGTATTTTTGAGCCCCCGG + Intronic
1116835929 14:49768847-49768869 GAGTTGGCTTTGTGAGCACCAGG - Intronic
1121308135 14:92919660-92919682 GACAAGGATTTGAGTGCACGTGG + Intergenic
1128929888 15:71694869-71694891 CACCTGGAGTCGTGTGCACCTGG + Intronic
1131320399 15:91384360-91384382 AACCTGGATTGGTGTCCACTGGG + Intergenic
1137938692 16:52659368-52659390 TACCTTGATTTCTGTGCATCTGG - Intergenic
1144047695 17:11468576-11468598 GACCTGGATTTGTCAGCACAAGG + Intronic
1144295599 17:13872244-13872266 GTTCTTGATTTGGGTGCACCTGG - Intergenic
1145272528 17:21412498-21412520 GGGCTGGATTTGTGTGGCCCAGG - Intronic
1145310738 17:21699961-21699983 GGGCTGGATTTGTGTGGCCCAGG - Intronic
1146548586 17:33761039-33761061 CACCTGGATGAGTGTGTACCAGG + Intronic
1148159817 17:45443563-45443585 GACCTGTCTCTGTGGGCACCAGG - Intronic
1148854693 17:50572389-50572411 GGCAGGGATTTGTGGGCACCAGG - Intronic
1149022942 17:51991300-51991322 GACATGGATGTGTTTGCAGCTGG - Intronic
1150391104 17:64790437-64790459 GACCTGTCTCTGTGGGCACCAGG - Intergenic
1150409886 17:64934489-64934511 GACCTGTCTCTGTGGGCACCAGG - Intergenic
1150631986 17:66886230-66886252 GAGCTGGATTTGAGGACACCTGG + Intergenic
1152485879 17:80592473-80592495 GTTCTGGATTTGTGTGCATCTGG + Intronic
1158128370 18:54126526-54126548 AAACTGGCTTTGTTTGCACCTGG + Intergenic
1160178897 18:76617737-76617759 GACCTGGACTTGTGTGGTTCGGG + Intergenic
1161438065 19:4275725-4275747 GAAGTGGATTTGTGTTTACCAGG + Intergenic
1167141605 19:47655089-47655111 CAGCTGGAGATGTGTGCACCAGG - Intronic
925184469 2:1837550-1837572 GACATGGAGTTGTGTGCACAAGG + Intronic
926003785 2:9355461-9355483 GACCTGTGTGTGTGTGCAGCAGG - Intronic
927407720 2:22791017-22791039 TGCCTGGATTTGTGTACCCCTGG - Intergenic
931021932 2:58055615-58055637 GATCTGGCTTTGATTGCACCTGG - Intronic
932097175 2:68861316-68861338 GCACTGGTTTTGTGAGCACCTGG - Intergenic
939388152 2:141529116-141529138 GGCCTGGCCTTGTGTGCAGCTGG + Intronic
940316718 2:152335163-152335185 GAGCTGCATTTGTCTGCTCCAGG + Intergenic
940638087 2:156321597-156321619 GACCTGGATTTGAGAGCATCGGG + Intergenic
942502458 2:176605867-176605889 GACCAGGACCTGTGTGCAGCAGG + Intergenic
944475461 2:200099656-200099678 CACCTGGATTTGTGATCCCCAGG + Intergenic
947841215 2:233208989-233209011 GACCTGGCTTTGATTGCACGTGG + Intergenic
948081234 2:235207059-235207081 GCCCTGGATTTGTGGGCCCTGGG + Intergenic
948693078 2:239719202-239719224 CACCTGGATATATGTTCACCTGG - Intergenic
948693096 2:239719298-239719320 CACCTGGATGTATGTTCACCTGG - Intergenic
1172805793 20:37610751-37610773 GACAAGGATTTGGGTGCACATGG - Intergenic
1173870897 20:46341551-46341573 GACCTGGACATGTGGGCACAGGG - Intergenic
1174294669 20:49537155-49537177 GACCTGGATTCCTATGGACCTGG + Intronic
1175853035 20:62104042-62104064 CCCCTGGCCTTGTGTGCACCAGG + Intergenic
1175991192 20:62790206-62790228 CACATGCATGTGTGTGCACCTGG + Intergenic
1179956582 21:44743458-44743480 AACCTGCATTTGAGAGCACCTGG - Intergenic
1180009971 21:45042996-45043018 GACCTGCGTTTGTGGCCACCTGG - Intergenic
1181560552 22:23697237-23697259 GACCTGGATGTGAGTGAGCCTGG + Exonic
1183521953 22:38300689-38300711 GGCCTGGAGCAGTGTGCACCCGG - Intronic
1183987108 22:41575933-41575955 GGCCAAGATGTGTGTGCACCCGG + Exonic
1184551851 22:45208935-45208957 GACCTGGCTCTGTGTGCTGCTGG - Intronic
950545638 3:13636444-13636466 GACGTGGATGAGTGTGCACTGGG + Exonic
952403801 3:32987467-32987489 GACAGGGCTTTGTGTGCACGTGG - Intergenic
955076579 3:55619389-55619411 CACCAGGCTTTGTGTGCATCAGG + Intronic
966996149 3:185282829-185282851 GACCTGTCTTTGAGTTCACCTGG - Intergenic
971386011 4:26141050-26141072 ATCCTGGATTTGTGTGACCCAGG + Intergenic
979292467 4:118992727-118992749 GATCTGGAATTATTTGCACCTGG + Intronic
981669945 4:147275302-147275324 GAACTGCATTTGGGTGCGCCTGG + Intergenic
982172601 4:152676234-152676256 GAGCTGCATTTGTTTGCACTGGG - Intronic
986268129 5:6208018-6208040 GACCTGCACCTGTTTGCACCTGG + Intergenic
990373074 5:55140820-55140842 GACCCAGATTTTTGTGCACATGG - Intronic
991421013 5:66442036-66442058 GAGTTGGATTTGTGTGAATCAGG + Intergenic
992326397 5:75664221-75664243 AACCTGGATTGCTGTCCACCTGG + Intronic
996594835 5:125188452-125188474 GACCTGGGTCTGTGTTCATCAGG - Intergenic
1001922137 5:175609140-175609162 GACCTGGATTCCTGTGTCCCTGG - Intergenic
1003267543 6:4579445-4579467 GACGTGAAATTCTGTGCACCAGG - Intergenic
1012043862 6:94243855-94243877 CACATGGACTTGTGTGCACAGGG + Intergenic
1024880674 7:54082287-54082309 CACCTGGAATTGTGGGCACCTGG - Intergenic
1030601029 7:111592432-111592454 GACCTTCATCTGTGTGCTCCAGG - Intergenic
1031753825 7:125612782-125612804 GACCTGGAATTGGGTACCCCAGG - Intergenic
1034939181 7:155219270-155219292 GCCCAGAATGTGTGTGCACCGGG + Intergenic
1037842387 8:22254499-22254521 GAACTGGATGTGTGTGCATGTGG - Exonic
1037925573 8:22841631-22841653 AGCCTGGATTTATCTGCACCAGG - Intronic
1040980136 8:53238523-53238545 GAACTTGAGTTGTGAGCACCGGG + Intronic
1041802632 8:61816113-61816135 GACTTGAACTTGTCTGCACCAGG + Intergenic
1046431295 8:114132529-114132551 TACCTTGATTTCTGTGCATCTGG + Intergenic
1048861543 8:138727674-138727696 GAACAGGATTTGGGGGCACCTGG + Intronic
1049608289 8:143540037-143540059 GACGTGGCTTTCTGTGCCCCCGG - Intronic
1056035979 9:82606190-82606212 GACTTGGAATAGTGTGCACTTGG - Intergenic
1061548561 9:131318941-131318963 CACATGGATGTGTGTGTACCAGG - Intergenic
1186380425 X:9052986-9053008 GACCTGGATTTCTGGCCACATGG - Intronic
1186380599 X:9054768-9054790 GACCTGGATTTCTGGCCACATGG + Intronic
1187961955 X:24574918-24574940 GACGTGGCTTTGTGTGCTACTGG + Intronic
1190177331 X:48161723-48161745 TAGATGGACTTGTGTGCACCTGG + Intergenic
1190708315 X:53048618-53048640 GACCTGGATTTGTGTGCACCGGG + Intergenic
1193624066 X:83794871-83794893 GGCCTGGGTTTGTGTGCCACTGG - Intergenic