ID: 1190708413

View in Genome Browser
Species Human (GRCh38)
Location X:53048936-53048958
Sequence GCCATGGCCCGTGTGCTCCC AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 198
Summary {0: 1, 1: 0, 2: 3, 3: 10, 4: 184}

Found 8 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1190708404_1190708413 0 Left 1190708404 X:53048913-53048935 CCCCCAACCTGGGGCTCTCCCAG 0: 1
1: 0
2: 3
3: 59
4: 663
Right 1190708413 X:53048936-53048958 GCCATGGCCCGTGTGCTCCCAGG 0: 1
1: 0
2: 3
3: 10
4: 184
1190708402_1190708413 2 Left 1190708402 X:53048911-53048933 CCCCCCCAACCTGGGGCTCTCCC 0: 1
1: 0
2: 3
3: 51
4: 476
Right 1190708413 X:53048936-53048958 GCCATGGCCCGTGTGCTCCCAGG 0: 1
1: 0
2: 3
3: 10
4: 184
1190708403_1190708413 1 Left 1190708403 X:53048912-53048934 CCCCCCAACCTGGGGCTCTCCCA 0: 1
1: 0
2: 3
3: 41
4: 382
Right 1190708413 X:53048936-53048958 GCCATGGCCCGTGTGCTCCCAGG 0: 1
1: 0
2: 3
3: 10
4: 184
1190708398_1190708413 14 Left 1190708398 X:53048899-53048921 CCTGGATGAGAGCCCCCCCAACC 0: 1
1: 0
2: 0
3: 6
4: 139
Right 1190708413 X:53048936-53048958 GCCATGGCCCGTGTGCTCCCAGG 0: 1
1: 0
2: 3
3: 10
4: 184
1190708405_1190708413 -1 Left 1190708405 X:53048914-53048936 CCCCAACCTGGGGCTCTCCCAGG 0: 1
1: 0
2: 3
3: 50
4: 353
Right 1190708413 X:53048936-53048958 GCCATGGCCCGTGTGCTCCCAGG 0: 1
1: 0
2: 3
3: 10
4: 184
1190708408_1190708413 -3 Left 1190708408 X:53048916-53048938 CCAACCTGGGGCTCTCCCAGGCC 0: 1
1: 1
2: 11
3: 66
4: 532
Right 1190708413 X:53048936-53048958 GCCATGGCCCGTGTGCTCCCAGG 0: 1
1: 0
2: 3
3: 10
4: 184
1190708407_1190708413 -2 Left 1190708407 X:53048915-53048937 CCCAACCTGGGGCTCTCCCAGGC 0: 1
1: 0
2: 2
3: 42
4: 344
Right 1190708413 X:53048936-53048958 GCCATGGCCCGTGTGCTCCCAGG 0: 1
1: 0
2: 3
3: 10
4: 184
1190708409_1190708413 -7 Left 1190708409 X:53048920-53048942 CCTGGGGCTCTCCCAGGCCATGG 0: 1
1: 0
2: 1
3: 56
4: 469
Right 1190708413 X:53048936-53048958 GCCATGGCCCGTGTGCTCCCAGG 0: 1
1: 0
2: 3
3: 10
4: 184

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1190708413 Original CRISPR GCCATGGCCCGTGTGCTCCC AGG Intergenic
900356616 1:2268121-2268143 GCCCTGGCCCAGGTGCCCCCTGG + Intronic
900601008 1:3502609-3502631 TCCCTGGCCTCTGTGCTCCCTGG - Intronic
900951026 1:5858390-5858412 GCCATGTCCCGTGAGTTCTCCGG - Intergenic
900989608 1:6092298-6092320 GCAAAGGCCCCTGGGCTCCCTGG - Intronic
901209495 1:7516424-7516446 GCTCTGGCCGGTGAGCTCCCTGG - Intronic
902987601 1:20164578-20164600 ACCCTGGCCTGTGTGCTGCCTGG - Intronic
904682957 1:32241453-32241475 GCCAGGGCCCGCGTCCTCTCCGG - Intergenic
904834397 1:33325442-33325464 GCCAAGGCCCTGGTGGTCCCCGG + Intronic
905369396 1:37474996-37475018 GCCATGGGCCTTGCGCTGCCTGG + Intronic
912058343 1:105632801-105632823 GACATGCCCTGTGTGCTCCGGGG - Intergenic
912183803 1:107250351-107250373 GGCATGGCAGGTGTGCTCCTGGG + Intronic
912198167 1:107424360-107424382 GACCTGGCCCCTGTCCTCCCTGG - Intronic
913192374 1:116424579-116424601 CCCATGGACGGTGAGCTCCCTGG - Intergenic
917471501 1:175329930-175329952 GGCATGGCCCTTCTTCTCCCTGG + Intronic
917967305 1:180186791-180186813 GGCATGGCACTTGAGCTCCCTGG - Intronic
919879668 1:201893363-201893385 GTCATGGTCCTTGTGCTCTCAGG + Intergenic
920665512 1:207959907-207959929 CCCAAGGCCCCTCTGCTCCCCGG - Intergenic
922729290 1:227941617-227941639 GCCATCTCCCCTGTGCTCCCAGG - Intronic
1069642180 10:69963197-69963219 GCCACGGCCCCTGTACCCCCAGG + Intronic
1069810715 10:71157613-71157635 TCCATAGCCTTTGTGCTCCCTGG - Intergenic
1070148467 10:73791373-73791395 GCTACGGCCCGTGTGCCCACTGG - Exonic
1072862472 10:99020891-99020913 TCCATGGCCTGTGTGTTCCCTGG - Intronic
1075388135 10:122072418-122072440 GCCAAGGTCAGTGGGCTCCCAGG + Intronic
1076583979 10:131532977-131532999 CCCAGGGCCCTTGTGCTCACAGG + Intergenic
1077110248 11:859101-859123 GCCAGGGCACGTGTGAGCCCGGG - Intronic
1077355530 11:2115059-2115081 GCCAGGGCCCGTGTGCCCAGGGG - Intergenic
1078509558 11:11975478-11975500 GCCAGGCCCTGAGTGCTCCCAGG + Intronic
1078822561 11:14896418-14896440 GCCATGGTCCCTGTGTTCCTGGG + Intergenic
1081529257 11:43946878-43946900 GCCATGGCCCATGGGCTACATGG + Intergenic
1081861036 11:46333395-46333417 GCCCTGGCCCGAGGGTTCCCGGG + Intronic
1084221840 11:67686275-67686297 GACATGGTCCGGGTGGTCCCCGG - Intergenic
1084412912 11:69014357-69014379 GGCATGGCCCGTGAGCCTCCAGG - Intergenic
1089680449 11:120116340-120116362 GTCATGGCCTGTGTCTTCCCAGG - Intronic
1090446473 11:126768856-126768878 GCCATGGCTCTCGTGCTCCATGG - Intronic
1091438757 12:496229-496251 GCCTTGGTCCCTGGGCTCCCTGG + Intronic
1092084291 12:5742958-5742980 AACACTGCCCGTGTGCTCCCGGG + Intronic
1102007291 12:109596885-109596907 GCCTTGGCCTGTGTTCTTCCTGG + Exonic
1102602815 12:114045609-114045631 GCCATGACGGGTGTGCTTCCAGG - Intergenic
1102793633 12:115669781-115669803 GCCATTGCCAGTGGGCTCCAAGG - Intergenic
1103613503 12:122138093-122138115 GCCCTGGCCCTTGGGCACCCAGG + Intronic
1103922055 12:124404242-124404264 GCCTTGGCCCCTGGGCTGCCCGG + Intronic
1104721328 12:131046549-131046571 TCCCTGGCCAGTGTCCTCCCTGG + Intronic
1104721433 12:131046905-131046927 TCCCTGGCCAGTGTCCTCCCTGG + Intronic
1104837578 12:131801534-131801556 GCCATGGCCCGTGTTTGCCGTGG + Intergenic
1107114114 13:36727969-36727991 GACATGTCCCCTCTGCTCCCAGG - Intergenic
1107992970 13:45834550-45834572 GCCATAGGCCCTGAGCTCCCAGG - Intronic
1109992888 13:70082142-70082164 GCCATGGCCAGGGAGCTCTCAGG - Intronic
1113506526 13:110820868-110820890 CCCATGCCCCGTGTGCTCTCTGG + Intergenic
1119223487 14:72927145-72927167 GCCACGCCTCGTGGGCTCCCCGG + Intronic
1119561014 14:75589830-75589852 GCCATGGCTCAAGTGGTCCCAGG - Intronic
1121048012 14:90802139-90802161 GATGTGGCCCGTGTGCTGCCAGG - Intronic
1121281884 14:92704995-92705017 GCCATGGCCTGGGATCTCCCCGG + Intronic
1121668464 14:95690647-95690669 GCAATGGCCAGTGGGCTGCCAGG - Intronic
1122203934 14:100138953-100138975 CCCATGGCCTGTCTGCTTCCAGG - Intronic
1122418750 14:101562670-101562692 GCCCTTGTCCGTGTGCCCCCAGG + Exonic
1127396203 15:58545838-58545860 GCTCAGGCCCATGTGCTCCCGGG - Exonic
1129755907 15:78098749-78098771 GCCATGGCACGGGTGAACCCTGG - Intronic
1132693676 16:1192763-1192785 GCCATTGCCCGATTTCTCCCAGG - Intronic
1132807162 16:1780126-1780148 ACCATGGGCCGTGTCCTTCCGGG - Intronic
1132852125 16:2029517-2029539 GCCACTGCCCATGTGCTGCCCGG + Intronic
1132904170 16:2273696-2273718 CCCATGGGCCGTCTGCTCACGGG + Intergenic
1134042980 16:11082304-11082326 GCCAGGGCCCTAGGGCTCCCAGG + Intronic
1136220130 16:28823323-28823345 GCCGTGGCCCGTCGGCCCCCCGG + Exonic
1136402598 16:30026688-30026710 GCTATGGCCCACGTGCTGCCCGG + Exonic
1136553104 16:30992175-30992197 GCCATGGCCTGTGTGTACCTGGG + Exonic
1138093389 16:54194338-54194360 GCCATGGCCCGTGTGGCCCGGGG - Intergenic
1138659662 16:58509661-58509683 GCCAGGGGCCGTGTCCTGCCAGG + Intronic
1139528232 16:67529241-67529263 GCCCTGGCACGCGCGCTCCCTGG + Intronic
1139594569 16:67950277-67950299 CCCATGGCCTGGCTGCTCCCAGG - Intronic
1140048811 16:71461783-71461805 AGTATGGACCGTGTGCTCCCAGG - Exonic
1141175737 16:81717884-81717906 GACATGGCCCTTGTCCTCCAGGG + Intergenic
1141587872 16:85047202-85047224 TCCATGGCCTGTGTGGGCCCCGG + Intronic
1142147819 16:88499852-88499874 CCCAAGTCCCGTGGGCTCCCCGG + Intronic
1142209172 16:88799788-88799810 GCCATGGCCCCTTCCCTCCCAGG + Intergenic
1142395371 16:89828667-89828689 GGCGTGGGCCGTGTGCTTCCAGG + Exonic
1142519396 17:494314-494336 GCCAGGCCACGGGTGCTCCCTGG - Intergenic
1142525330 17:536210-536232 GCCTTGGCCAGGGAGCTCCCTGG + Intronic
1143780416 17:9226065-9226087 GCCCTGTCCCGTGTTCTCTCGGG + Intronic
1145243457 17:21252877-21252899 GCCCTGGCCCCTGCTCTCCCGGG + Intronic
1146645436 17:34573993-34574015 GGCATGGGCTGTGGGCTCCCAGG + Intergenic
1151684306 17:75637749-75637771 GCCAGGGCCCGAGAGCCCCCTGG - Exonic
1152638439 17:81439665-81439687 GCCAGGGCTCCTGGGCTCCCGGG - Intronic
1152798575 17:82320694-82320716 GCCATGTCCCCTGCGCACCCAGG - Intergenic
1153027007 18:681268-681290 GGCATGTGCCCTGTGCTCCCTGG + Intronic
1155277057 18:24198661-24198683 GCCATGGCTTGTGTGCTGCGTGG - Intronic
1156463883 18:37336631-37336653 GCCAGGGCCTGTGGGCTCTCTGG - Intronic
1157574845 18:48736720-48736742 GCCATGGCCAGTGAGCCCCTAGG + Intronic
1158557236 18:58485501-58485523 GCCATGGACTGTGGGCTCCCAGG - Intronic
1159775873 18:72602242-72602264 GCAGTGGCCTGTGTGATCCCAGG - Intronic
1159944793 18:74436400-74436422 GCCATTTCCCCTGTGCTCTCTGG - Exonic
1160073090 18:75645420-75645442 TCCATGGCCCCTGCTCTCCCCGG - Intergenic
1161041515 19:2113111-2113133 GCCAGGGCCTCTGTGCTCACAGG - Intronic
1162630381 19:11923101-11923123 GCCATGGCACCTGGCCTCCCAGG + Intergenic
1163513834 19:17751358-17751380 CCCATGGCCTGTGTGGTTCCAGG + Intronic
1164921125 19:32089377-32089399 GCAATGGCCCCTGGGCTCACTGG - Intergenic
1165087534 19:33361442-33361464 GCCATGGCTGCTGCGCTCCCTGG + Intergenic
1166571562 19:43799924-43799946 GGCCTGGCCCCTCTGCTCCCAGG + Intronic
1167414793 19:49364396-49364418 GCCAGGCCCCGTCTTCTCCCAGG - Intronic
1168284724 19:55325202-55325224 GCCCTGTCCCCTGTCCTCCCAGG - Intronic
925929093 2:8693484-8693506 GCCGCAGCCCGTGTGCTTCCCGG + Intergenic
927489700 2:23512955-23512977 CCCACGGCCTGTGTGCCCCCAGG - Intronic
927508591 2:23630247-23630269 GCCGTGGCCGGTGTGCTTGCAGG + Intronic
931190622 2:59996671-59996693 GCCCTGGCCCCTGGCCTCCCAGG - Intergenic
935147157 2:100403672-100403694 GCCTTGGCCTCAGTGCTCCCGGG - Intronic
937471767 2:122179962-122179984 CCCATGGCCTATGTTCTCCCTGG + Intergenic
938343260 2:130549261-130549283 GCCATGGGCTGTGTGCTCCCGGG - Intronic
938346573 2:130571461-130571483 GCCATGGGCTGTGTGCTCCCGGG + Intronic
940328636 2:152451963-152451985 ACCCAGGCCCGTGGGCTCCCTGG + Intronic
941094045 2:161215102-161215124 GCCATGGCCCCTGAGCATCCTGG - Intronic
947714703 2:232333681-232333703 GCCCTGGCCCCAGTCCTCCCTGG + Intronic
948140705 2:235670267-235670289 GCCCCGGCCCGCGCGCTCCCCGG + Intronic
948283062 2:236763129-236763151 GGCATTGTCCCTGTGCTCCCTGG + Intergenic
1172954796 20:38748544-38748566 GCAGTGGCCCGTGTGCCACCGGG - Exonic
1174093831 20:48071425-48071447 GCCATGGTCTCTCTGCTCCCAGG - Intergenic
1176203953 20:63878044-63878066 GCCATGGCGCGTGCTCTTCCTGG + Intronic
1176230667 20:64031151-64031173 GCCCAGGCCCTTGTGCTGCCTGG + Intronic
1176592905 21:8659899-8659921 GCCCTGGCCCGCCTTCTCCCTGG + Intergenic
1179361526 21:40713960-40713982 GCCATGGCTCAAGTGGTCCCAGG + Intronic
1179801552 21:43813625-43813647 GCCGTGGCCTGTCTGCTGCCTGG + Intergenic
1180618067 22:17141401-17141423 GCCCTGGGCCTTGTGCACCCAGG - Intronic
1183062820 22:35346262-35346284 GCCCTGCCCCTTCTGCTCCCTGG - Intronic
1183362505 22:37389990-37390012 CCCAGGGCCCGTGGGCTCCTTGG - Intronic
1184160402 22:42694112-42694134 GCCTTGGCCCCTGTGGGCCCAGG - Intronic
1185073454 22:48669695-48669717 CCCATGGCCCCTTTGCCCCCAGG - Intronic
1185086651 22:48744469-48744491 GCCATGACCCGTGTGGTTCGTGG + Intronic
1185101418 22:48842854-48842876 GCCAGGGCCCGGGAGCTTCCAGG - Intronic
950239445 3:11354940-11354962 GCCATAGCCCGTGAGAGCCCAGG + Intronic
952287282 3:31981175-31981197 TCCATGGTCCGTGGGCGCCCGGG + Exonic
953030604 3:39177644-39177666 GCCTTGGCCGGTGTGACCCCTGG - Intergenic
967980468 3:195062248-195062270 GCCATGGCCTGTGTCTGCCCTGG + Intergenic
968623603 4:1615666-1615688 GCCATCCCCTGTGTGCGCCCAGG - Intergenic
968702106 4:2062109-2062131 GCCATGCCCCGTGTGCCCACCGG - Intronic
969675810 4:8613793-8613815 GCCTGGGCCCGTGGTCTCCCTGG + Intronic
974877119 4:67714443-67714465 GGCATGGGGCCTGTGCTCCCAGG - Intergenic
977994157 4:103482436-103482458 GTCATGGCCATTCTGCTCCCCGG - Intergenic
985534359 5:455242-455264 GCCATGGCCCGGGAGGGCCCAGG - Intronic
985552922 5:542432-542454 CCCATGGGGCCTGTGCTCCCAGG - Intergenic
987133837 5:14882822-14882844 GCCATGGCCAGGCTGCTCACAGG + Intergenic
991181521 5:63756689-63756711 GACATGGGCATTGTGCTCCCAGG - Intergenic
998396539 5:141822229-141822251 GCCAAGGCCCCAGAGCTCCCAGG - Intergenic
999261433 5:150241192-150241214 TCCAATGCCCGTGTGCTCACAGG + Intronic
1002527890 5:179825049-179825071 GCCAAGGTCCCTGTGTTCCCGGG - Intronic
1003114046 6:3271569-3271591 GCCATGGGCTGTGTCCTTCCAGG - Exonic
1005894182 6:30163889-30163911 CCCATGGCCCCTGTGCCCCTGGG + Exonic
1006911774 6:37567902-37567924 GCCATGCCCAGTGTGTCCCCAGG - Intergenic
1009610743 6:65937720-65937742 TCCATGGGCCGGGGGCTCCCTGG - Intergenic
1010828206 6:80498437-80498459 GCCATGCCAGATGTGCTCCCAGG - Intergenic
1012140120 6:95616309-95616331 GCCATGGCTCAAGTGGTCCCAGG + Intergenic
1013786742 6:113789725-113789747 GCCATGGGCCCACTGCTCCCTGG + Intergenic
1016866134 6:148768991-148769013 GACATGGCCACTGTCCTCCCTGG + Intronic
1017096446 6:150809473-150809495 GCCAGGGCCCGGCTGCTACCTGG - Exonic
1018710873 6:166497538-166497560 GCCAGGGCCTGTGAGCTCCCGGG + Intronic
1018815216 6:167325293-167325315 ACCCTGGCCCCTGTGCTCTCGGG - Intronic
1019329479 7:455529-455551 ACAGTGGCCCCTGTGCTCCCCGG - Intergenic
1019640262 7:2099716-2099738 GCCACGGCCCGGGTGCTTCCTGG - Intronic
1019726284 7:2604664-2604686 GCCATGCCCTGTCAGCTCCCTGG + Intronic
1020115003 7:5471279-5471301 GCCCCGGCCCGTGTGTTCCGAGG - Intronic
1022496776 7:30858189-30858211 GCCATGTCACTTCTGCTCCCCGG - Intronic
1024241313 7:47438639-47438661 GCCCTGGCCCAGGTGCTACCTGG - Intronic
1024306758 7:47935678-47935700 GACTTGGCCCGTGGTCTCCCAGG + Intronic
1027270145 7:76514469-76514491 GCCAAGGCCCTTCTCCTCCCGGG + Intronic
1027996103 7:85427122-85427144 GCCATGGGCCTTGTGCTCTAAGG + Intergenic
1031971092 7:128065691-128065713 GCAGTGGCCCATGTTCTCCCAGG - Intronic
1034355070 7:150445092-150445114 GCCCTGGCCGCTGGGCTCCCTGG - Intergenic
1034698263 7:153074146-153074168 GCCATGGCCTGCATACTCCCCGG + Intergenic
1035242256 7:157539832-157539854 GGCAGGGTTCGTGTGCTCCCGGG + Exonic
1035328881 7:158083813-158083835 GCTCTGGCCCTTGTGCTCTCAGG + Intronic
1036010453 8:4716001-4716023 GCCCTGGCCCCTGTGCTCTTTGG - Intronic
1037893543 8:22636818-22636840 GCCCTGCCCCGTGAGCACCCTGG - Intronic
1038481795 8:27907084-27907106 GCCAATGCCCATGTGCTGCCTGG + Intronic
1044568844 8:93695936-93695958 GCCAAGGCACTTGTCCTCCCAGG + Intergenic
1047209512 8:122830141-122830163 GCCTCAGCCCGTGTGCACCCAGG - Intronic
1048328705 8:133457843-133457865 GGCATGGGGCCTGTGCTCCCAGG - Exonic
1049021102 8:139958187-139958209 GCCTTGGCCCCTGAGCTTCCAGG + Intronic
1049844165 8:144792110-144792132 GCCATGGGCCGTGTGATCCGTGG - Exonic
1050120855 9:2305613-2305635 GCCATAGTCCATGTGCTCCCTGG - Intergenic
1052038230 9:23707470-23707492 GCCATGTCCCATGGGCTCCAGGG + Intronic
1053147913 9:35724368-35724390 CCCATGGCCCCTGTGCTGTCTGG + Intronic
1055514329 9:77020833-77020855 GCCATCCACCGTGTGCTCCGCGG + Exonic
1057801122 9:98192164-98192186 GCTGTGGCCCGGGTGCTCCATGG - Intronic
1057827502 9:98382186-98382208 GCCATGGCCCCAGTCCTTCCCGG - Intronic
1059633100 9:116145916-116145938 TCCAGGGTCCGTATGCTCCCAGG + Intergenic
1060549114 9:124476855-124476877 GCCAGGCCCCCAGTGCTCCCAGG - Intronic
1061053145 9:128207755-128207777 GCCCTGCCCCGAGTGCTTCCTGG - Intronic
1061607010 9:131718303-131718325 GACGTGGCCTGTGTGCGCCCTGG - Intronic
1061786343 9:133030841-133030863 CCCATGGGCCATTTGCTCCCTGG + Intronic
1062371671 9:136242448-136242470 GCCATGGCCTGTGTGCCCCCAGG + Intronic
1062559862 9:137136700-137136722 GCCAGGGCGCGTCTGCACCCGGG + Intergenic
1062607813 9:137355860-137355882 GCCAGGTCCCCTTTGCTCCCAGG - Intronic
1186646367 X:11511435-11511457 GGCATGGCCACTGTCCTCCCAGG - Intronic
1188014828 X:25097036-25097058 GCCAAGTCCCTTCTGCTCCCAGG + Intergenic
1190708413 X:53048936-53048958 GCCATGGCCCGTGTGCTCCCAGG + Intergenic
1195378536 X:104250424-104250446 CCCATGGCGCGTGTGCCACCCGG - Exonic
1195378545 X:104250451-104250473 CCCATGGCGCGTGTGCCACCCGG - Exonic
1198251508 X:134883548-134883570 TCCATGGCCAGTAAGCTCCCAGG + Intergenic
1200310040 X:155069028-155069050 GTCTTGGCCAGTGTGCTCTCTGG - Intronic
1202370239 Y:24191288-24191310 CCCATGACCCCTGTGCTTCCCGG - Intergenic
1202500545 Y:25478829-25478851 CCCATGACCCCTGTGCTTCCCGG + Intergenic