ID: 1190708792

View in Genome Browser
Species Human (GRCh38)
Location X:53050568-53050590
Sequence ATCCCTACACACACCCATCA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 172
Summary {0: 1, 1: 0, 2: 2, 3: 10, 4: 159}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1190708792_1190708796 21 Left 1190708792 X:53050568-53050590 CCCTGATGGGTGTGTGTAGGGAT 0: 1
1: 0
2: 2
3: 10
4: 159
Right 1190708796 X:53050612-53050634 GTAAGAGATGTGCATCGAGGTGG 0: 1
1: 0
2: 0
3: 4
4: 67
1190708792_1190708795 18 Left 1190708792 X:53050568-53050590 CCCTGATGGGTGTGTGTAGGGAT 0: 1
1: 0
2: 2
3: 10
4: 159
Right 1190708795 X:53050609-53050631 TAAGTAAGAGATGTGCATCGAGG 0: 1
1: 0
2: 1
3: 2
4: 73

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1190708792 Original CRISPR ATCCCTACACACACCCATCA GGG (reversed) Intronic
905974779 1:42166206-42166228 TTGGCTACACACACCCATCAGGG - Intergenic
910259264 1:85279950-85279972 TTCCTTACACACAGCCATCCAGG + Intergenic
910749742 1:90616114-90616136 ATCCTTACACAGCCCCATGAGGG + Intergenic
911138594 1:94471091-94471113 CCCCCTACAAACACCCTTCAAGG - Intronic
916741436 1:167650292-167650314 ACCCCAACACACACACATCCAGG - Intronic
917866851 1:179204419-179204441 ATCTCTACTCCCACCCAGCAAGG + Intronic
920029900 1:203030504-203030526 CTACCTACCCCCACCCATCAGGG - Intronic
920424640 1:205865313-205865335 ATACCCACACACACACACCATGG + Intergenic
920836237 1:209513655-209513677 AGCCCTGCACACACTCATTAAGG - Intergenic
920987600 1:210905091-210905113 ATCCCTACAGTCACCTTTCAGGG - Intronic
921722258 1:218486228-218486250 TTCCCTACTCACAACCATAATGG + Intergenic
1064314543 10:14243074-14243096 ATCCATACACACACACATGCTGG + Intronic
1068227376 10:54123472-54123494 ATACCTACTCACACCAGTCAGGG + Intronic
1068834697 10:61541304-61541326 ATCCCTACACGAACCCTTGATGG + Intergenic
1071399513 10:85255888-85255910 GACACTTCACACACCCATCATGG + Intergenic
1071457034 10:85858787-85858809 ATCCACACACTCACACATCAGGG + Intronic
1071678497 10:87680480-87680502 ATCCCTCTACAGACCCACCATGG - Intronic
1073115612 10:101089902-101089924 ACCCCAACACACACCCAGCATGG - Exonic
1074310455 10:112317947-112317969 ATCCCAACACACCCTCACCATGG + Intergenic
1075297190 10:121288062-121288084 ATACACACACACACCCATCCAGG + Intergenic
1076458916 10:130625050-130625072 ATACCTACATACACACATCTTGG + Intergenic
1077366347 11:2162837-2162859 CTCCCTACACACTCCTCTCAAGG - Intergenic
1079122166 11:17693948-17693970 ATCCCAAGACACACAGATCAGGG + Intergenic
1080773543 11:35364709-35364731 ATACATACACACCCCCATGATGG + Intronic
1081749006 11:45494513-45494535 TTCCCTACAAACTCCCTTCATGG - Intergenic
1084042154 11:66548355-66548377 ATCCCTACCCCCACCCACCCGGG + Intronic
1088967546 11:114738849-114738871 GTCCCTACACATGCCCATTATGG + Intergenic
1089132983 11:116226716-116226738 ATCCCTGCACTCAGCCATCCAGG + Intergenic
1091513534 12:1154198-1154220 ATACATACACACACACACCATGG - Intronic
1100356884 12:93839290-93839312 ATTCCTACACAGATCCATGAGGG - Intronic
1102032935 12:109753413-109753435 ATACATACACACCCCCATCAGGG - Intronic
1102765022 12:115425245-115425267 ATACATACACACACACACCATGG + Intergenic
1107786350 13:43961949-43961971 ATCCCTCCCCACCCCCACCATGG + Intergenic
1108438873 13:50428298-50428320 ATCTCTAAACAGCCCCATCAGGG + Intronic
1110335176 13:74321718-74321740 ATTCATACACACACACATGAGGG + Intergenic
1114405012 14:22448542-22448564 ATCTCTACATTCACCCAGCAGGG + Intergenic
1117574593 14:57085435-57085457 ATCCCTCCACACACCCATAATGG + Intergenic
1122412650 14:101533863-101533885 ATCTGCACAGACACCCATCACGG + Intergenic
1129560216 15:76558823-76558845 ATACATACACACACACACCATGG + Intronic
1130569312 15:85026266-85026288 ATCCCAACCCCCAGCCATCATGG - Intronic
1137825589 16:51491831-51491853 ATGCCCCCACACACCCCTCAAGG + Intergenic
1139152565 16:64400883-64400905 ATACATATACACACACATCAAGG - Intergenic
1142109630 16:88324319-88324341 ACCCCCACACACACCCCTTATGG + Intergenic
1146309099 17:31753324-31753346 ATCCTTACAAAAACCCATCAAGG - Intergenic
1147328845 17:39684516-39684538 ATCCCTATTAACACCCAACAGGG - Intronic
1149514709 17:57271797-57271819 ATCACTACACACACAAATCATGG - Intronic
1155636454 18:27961407-27961429 ATCCCTTCCCACAGGCATCAAGG + Intronic
1160695704 19:483362-483384 AGCCCTACAGACGCCCATCCTGG + Intergenic
1161702402 19:5802626-5802648 ACCCCTGCACACACACAGCAGGG - Intergenic
1164571056 19:29374612-29374634 ATCCCCACACACACCCCACCAGG + Intergenic
1168350019 19:55670345-55670367 TTCCATACATACACCCAGCAAGG - Intronic
1168571094 19:57470651-57470673 ATCTCTACCCAAACCAATCAAGG + Exonic
926459504 2:13111328-13111350 ATCCCTAAGCAAAGCCATCAGGG + Intergenic
927513343 2:23658157-23658179 CACCCTACTCACACCCTTCAAGG + Intronic
929245029 2:39692322-39692344 CTCACTACACACACCCACAAAGG + Intronic
931308693 2:61057765-61057787 ATCCTTACACACAACCTTCAAGG - Intergenic
935180840 2:100690046-100690068 ATCCCTACCCAGACCCAGTAGGG + Intergenic
938483264 2:131679640-131679662 CACCCTCCACACAACCATCAAGG + Intergenic
940400401 2:153242279-153242301 CTTCCCACCCACACCCATCATGG + Intergenic
941649410 2:168077779-168077801 ATCCCTACAAACTCCCTACAAGG - Intronic
942127012 2:172837120-172837142 ATACACACACACACCCAACATGG - Intronic
943531898 2:189092877-189092899 ATCTCTACAAACTCCAATCAAGG - Intronic
947492906 2:230611226-230611248 TTCTCCACACACACCCTTCAAGG + Intergenic
948808402 2:240462811-240462833 ATCCCTGCCCAGAACCATCATGG + Intronic
1176524239 21:7853333-7853355 ATGCCAACAGACTCCCATCAGGG - Intergenic
1178658259 21:34483346-34483368 ATGCCAACAGACTCCCATCAGGG - Intergenic
1179542307 21:42091394-42091416 ATCCCTCCCCACTCCCAACAGGG - Intronic
1179673937 21:42969071-42969093 CCCCCTGCACACACCCATCCTGG - Intergenic
1180843437 22:18969785-18969807 ACCCCTACACACACCACACAGGG - Intergenic
1184825923 22:46950783-46950805 ATCCATGCACACATCCATCCCGG - Intronic
1184937030 22:47732261-47732283 ATCCCTGTACACACCTAGCAAGG - Intergenic
949503824 3:4707460-4707482 CTCTCTACACACACTCATCTTGG - Intronic
950073969 3:10174077-10174099 ATCCACACACACTCCCATCTTGG - Intronic
951980777 3:28564107-28564129 AGCCCCACACACCCCCACCACGG - Intergenic
953952564 3:47203072-47203094 AACCCTAGACACACTCATCCTGG + Intergenic
954745505 3:52785384-52785406 ATCCCTCCACACAGGCATCCTGG + Intronic
954806306 3:53222873-53222895 TGCCCTACACACACCCATCTTGG + Intergenic
955475660 3:59333520-59333542 CTCCCTACACACTCACATCTAGG - Intergenic
956445182 3:69319098-69319120 ACCTCTACACAAACCTATCAAGG + Intronic
962746217 3:138398966-138398988 ATCCCTGCACACACCCAGAGGGG - Intronic
963421798 3:145070210-145070232 AACCCTAGACAGACCCTTCAAGG + Intergenic
965250499 3:166337392-166337414 ATACACACACACACACATCATGG - Intergenic
968278644 3:197459331-197459353 ATCCCTACTCACAGCCTCCAAGG - Intergenic
969311899 4:6357720-6357742 ACCCCTACCCCCACCCACCAGGG - Intronic
974240496 4:59239415-59239437 ATACACACACACACACATCATGG + Intergenic
976899120 4:90152317-90152339 TAACCTACACACACCAATCAAGG - Intronic
981334798 4:143558390-143558412 ATCCCTACACCCAGCCAGCATGG - Intergenic
985420965 4:189784969-189784991 ATCCCTAGACACACCTTACAAGG + Intergenic
986636545 5:9827564-9827586 ATCCCTATACACACACACCCGGG + Intergenic
992149942 5:73892922-73892944 CTCACCACACACACCCATAATGG - Intronic
994626636 5:102228730-102228752 ATCTCTGGACACACCCAGCAGGG - Intergenic
995675161 5:114654895-114654917 ACCCCAACAAACACCCTTCAGGG - Intergenic
996661903 5:126013909-126013931 ATGCATACACACACTCATAAGGG + Intergenic
997404512 5:133634243-133634265 ATCCCTACACACACCAACAAAGG - Intergenic
997656790 5:135561155-135561177 TTCCGTGCACACACCCCTCATGG - Intergenic
998031179 5:138869579-138869601 CTTCCTACACACAGCTATCAGGG - Exonic
998139775 5:139693261-139693283 ACCCCTGCCCACACCCATCCAGG - Intergenic
998703334 5:144730960-144730982 TTCCCTAGCCACACTCATCAAGG - Intergenic
999044117 5:148449088-148449110 ACCTCTACAGACACCAATCATGG + Intergenic
1001877118 5:175211065-175211087 ACCCCTCCACCCACCCAGCATGG + Intergenic
1002704534 5:181151313-181151335 CTCCCAACACACTCCCAGCAAGG - Intergenic
1003071304 6:2947495-2947517 ATCCCTGCACCCAGCCATCCAGG - Intergenic
1007124704 6:39416057-39416079 ATCCCTCCACAGACCCCTCCAGG - Intronic
1007762588 6:44141695-44141717 GTCCCTACACACCCCCATGGAGG - Intronic
1010858301 6:80871583-80871605 ATCCATCCACCCACCCACCATGG + Intergenic
1012764139 6:103342855-103342877 ATACATACACACATGCATCAGGG - Intergenic
1015643321 6:135362099-135362121 ACACCTACACACACACACCATGG - Intronic
1016796492 6:148123533-148123555 ATCCACACACACACTCCTCACGG - Intergenic
1017158284 6:151341778-151341800 AAACCCACACACACCCATCTCGG - Intronic
1017526641 6:155246989-155247011 ATTCCTACACACACCCTTCATGG + Intronic
1018546551 6:164942906-164942928 AACCCTACACACCCCAATTAGGG + Intergenic
1019363667 7:619238-619260 ATCCCCACACACAGCCCTCAGGG + Intronic
1020105166 7:5419463-5419485 ATGCACACACACACACATCACGG + Intronic
1021921370 7:25488723-25488745 ATCCCTATACCTACTCATCAAGG - Intergenic
1027878219 7:83799262-83799284 ATAAATACACACACACATCATGG + Intergenic
1028570374 7:92279886-92279908 ACACATACACACACACATCAGGG + Intronic
1029327755 7:99824298-99824320 ATTCATTCACACACCCCTCATGG + Intergenic
1032136611 7:129285185-129285207 ATCCATACATCCACACATCAGGG - Intronic
1034562758 7:151891986-151892008 GTCCCCACAGACACCCAGCATGG - Intergenic
1035001379 7:155615217-155615239 ATACCACCTCACACCCATCAGGG - Intronic
1035001386 7:155615261-155615283 ATACCACCTCACACCCATCAGGG - Intronic
1035001399 7:155615349-155615371 ATACCACCTCACACCCATCAGGG - Intronic
1035001424 7:155615525-155615547 ATACCACCTCACACCCATCAGGG - Intronic
1035001436 7:155615613-155615635 ATACCACCTCACACCCATCAGGG - Intronic
1035001449 7:155615701-155615723 ATACCACCTCACACCCATCAGGG - Intronic
1035001461 7:155615789-155615811 ATACCACCTCACACCCATCAGGG - Intronic
1035001474 7:155615877-155615899 ATACCACCTCACACCCATCAGGG - Intronic
1035001492 7:155616009-155616031 ATACCACCTCACACCCATCAGGG - Intronic
1035001498 7:155616053-155616075 ATACCACCTCACACCCATCAGGG - Intronic
1035001516 7:155616185-155616207 ATACCACCTCACACCCATCAGGG - Intronic
1035001522 7:155616229-155616251 ATACCACCTCACACCCATCAGGG - Intronic
1035001528 7:155616273-155616295 ATACCACCTCACACCCATCAGGG - Intronic
1035001546 7:155616405-155616427 ATACCGCCTCACACCCATCAGGG - Intronic
1035001552 7:155616449-155616471 ATACCACCTCACACCCATCAGGG - Intronic
1035001558 7:155616493-155616515 ATACCACCTCACACCCATCAGGG - Intronic
1035001564 7:155616537-155616559 ATACCACCTCACACCCATCAGGG - Intronic
1035001576 7:155616625-155616647 ATACCACCTCACACCCATCAGGG - Intronic
1035001595 7:155616757-155616779 ATACCACCTCACACCCATCAGGG - Intronic
1035001601 7:155616801-155616823 ATACCACCTCACACCCATCAGGG - Intronic
1035001619 7:155616933-155616955 ATACCACCTCACACCCATCAGGG - Intronic
1035001625 7:155616977-155616999 ATACCACCTCACACCCATCAGGG - Intronic
1035001631 7:155617021-155617043 ATACCACCTCACACCCATCAGGG - Intronic
1035001645 7:155617109-155617131 ATACCACCTCACACCCATCAGGG - Intronic
1035001667 7:155617285-155617307 ATACCACCTCACACCCATCAGGG - Intronic
1035001678 7:155617373-155617395 ATACCACCTCACACCCATCAGGG - Intronic
1035001684 7:155617417-155617439 ATACCACCTCACACCCATCAGGG - Intronic
1035001690 7:155617461-155617483 ATACCACCTCACACCCATCAGGG - Intronic
1035001696 7:155617505-155617527 ATACCACCTCACACCCATCAGGG - Intronic
1035001702 7:155617549-155617571 ATACCACCTCACACCCATCAGGG - Intronic
1035001708 7:155617588-155617610 ATACCACCTCACACCCATCAGGG - Intronic
1042218780 8:66453092-66453114 ATCCAAACAGACACGCATCATGG + Intronic
1048327515 8:133450818-133450840 AACCCTGCACCCACCCCTCATGG + Intergenic
1048865070 8:138754862-138754884 ATCCCCAGAAACCCCCATCATGG + Intronic
1049000730 8:139824206-139824228 ATCTGTACACACACCGCTCAGGG - Intronic
1049013468 8:139903651-139903673 TTCCTTTCACACACTCATCACGG + Intronic
1049031402 8:140040709-140040731 ATCCCAACACACATCATTCAGGG + Intronic
1049374426 8:142282207-142282229 CTCCCTACACCCCCCCAGCACGG + Intronic
1052121141 9:24717816-24717838 ATACACACACACACACATCATGG - Intergenic
1054141403 9:61534247-61534269 ATCCACACACACACAAATCACGG - Intergenic
1054461103 9:65464899-65464921 ATCCACACACACACAAATCACGG - Intergenic
1058816482 9:108687546-108687568 ATCCCTACAAACTCCCACAAAGG + Intergenic
1059088602 9:111332395-111332417 ATACATACACACACACACCATGG + Intergenic
1203426957 Un_GL000195v1:49949-49971 AAGCCTACTCACACCAATCATGG + Intergenic
1190708792 X:53050568-53050590 ATCCCTACACACACCCATCAGGG - Intronic
1191147074 X:57178133-57178155 CTCCCTTCCCACCCCCATCAGGG - Intergenic
1193867457 X:86753080-86753102 ACCCCGACACACACAAATCATGG + Intronic
1194200225 X:90945335-90945357 ACCCATACACACACACATCTTGG - Intergenic
1194505196 X:94725791-94725813 ATACACACACACACCCACCATGG + Intergenic
1195354111 X:104022299-104022321 ATCCCTTCACAAATACATCAAGG - Intergenic
1198559386 X:137832263-137832285 ATATATACACACACACATCATGG - Intergenic
1200113572 X:153758176-153758198 ATCCCCACTGACAGCCATCATGG - Intergenic
1201319451 Y:12681950-12681972 ATGCATACACACACACATCCTGG - Intergenic