ID: 1190710078

View in Genome Browser
Species Human (GRCh38)
Location X:53061326-53061348
Sequence TTAACTGCACAGAAGCAGCT AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 180
Summary {0: 1, 1: 0, 2: 0, 3: 9, 4: 170}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1190710078_1190710083 30 Left 1190710078 X:53061326-53061348 CCTAGCTGCTTCTGTGCAGTTAA 0: 1
1: 0
2: 0
3: 9
4: 170
Right 1190710083 X:53061379-53061401 GTCTCATTGTGCTTATCGGCTGG 0: 1
1: 0
2: 0
3: 3
4: 46
1190710078_1190710082 26 Left 1190710078 X:53061326-53061348 CCTAGCTGCTTCTGTGCAGTTAA 0: 1
1: 0
2: 0
3: 9
4: 170
Right 1190710082 X:53061375-53061397 GAGTGTCTCATTGTGCTTATCGG 0: 1
1: 0
2: 1
3: 8
4: 123

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1190710078 Original CRISPR TTAACTGCACAGAAGCAGCT AGG (reversed) Intronic
900331737 1:2138288-2138310 TCAAGTGCACAGAAAGAGCTGGG - Intronic
902192391 1:14772947-14772969 TCAACTGCGCAGAAGCTGCCTGG - Intronic
902490118 1:16775387-16775409 TCAGGTGCACAGAAGGAGCTGGG + Intronic
903127101 1:21255692-21255714 TTAATTACAGAGAAGCAGCCTGG + Intronic
904089866 1:27937279-27937301 CTAACTGCAGAGAAGCAGACAGG + Intronic
906976547 1:50580093-50580115 TAAACTGCACAGAAACATTTAGG - Intronic
907254340 1:53167148-53167170 TGTACTGCACAGAGACAGCTCGG + Intergenic
907346164 1:53782566-53782588 GAAACTGTACAGAAGCAGCAAGG + Intronic
908900475 1:68950776-68950798 TTGACTGCAAAGAATCACCTAGG - Intergenic
912190011 1:107327100-107327122 TAAGCTGAAGAGAAGCAGCTGGG + Intronic
912211447 1:107561648-107561670 TTACCTACACAGAAGTACCTAGG + Intergenic
912647860 1:111412053-111412075 GTAACTGCACTGAAGAGGCTAGG - Intergenic
912972694 1:114298937-114298959 TTCACAGCACAGGAGAAGCTTGG - Intergenic
917074463 1:171189591-171189613 TTCATTGTGCAGAAGCAGCTAGG + Intronic
918557889 1:185826586-185826608 TTTACTGCTCAGAACCAACTGGG - Intronic
920202400 1:204267653-204267675 TTAACAGCAGAGCCGCAGCTAGG - Intronic
920343837 1:205293130-205293152 TTAACAGCACAGAGGTGGCTGGG - Intergenic
922240293 1:223751189-223751211 TGAACTTCACACGAGCAGCTTGG - Intronic
922469224 1:225865699-225865721 TTCACTGCACAGCACCAGCAGGG + Intronic
923530319 1:234807143-234807165 TCAGGTGCACAGAAGGAGCTGGG - Intergenic
924471422 1:244346018-244346040 TCAACTGCACAGTGGCTGCTGGG + Intergenic
924878986 1:248137176-248137198 TTAGCTGCACAGAATTTGCTCGG - Intergenic
1069606734 10:69743602-69743624 CCCACTGCACAGAAGCAGCATGG + Intergenic
1069997423 10:72351282-72351304 TAAACTGCAAAGCAGTAGCTGGG - Intronic
1071625391 10:87163469-87163491 ATAACTACACAGAAGCGGGTGGG + Intronic
1072313018 10:94175159-94175181 TTAACAAGAGAGAAGCAGCTGGG - Intronic
1078238432 11:9507615-9507637 TTAACTACACTGAAGGGGCTGGG - Intronic
1078719500 11:13871454-13871476 AGAAGTGCACGGAAGCAGCTGGG - Intergenic
1080632655 11:34093311-34093333 TTAACTCCCCACAAGTAGCTTGG + Intronic
1081775803 11:45675244-45675266 TTACCTACACAAAAGGAGCTGGG - Intergenic
1089777964 11:120852226-120852248 TTACCTCCTCAGCAGCAGCTGGG - Intronic
1091081131 11:132669375-132669397 TTCACTGCACAGATACTGCTGGG + Intronic
1091272430 11:134327039-134327061 TGAACTGGACACAGGCAGCTTGG - Intergenic
1092439396 12:8484866-8484888 TTTAATGCACAGAAGCAGAATGG + Intergenic
1100742591 12:97610108-97610130 TGAAATGAACAGAAGAAGCTGGG + Intergenic
1101431795 12:104633081-104633103 ATAAATGCACGAAAGCAGCTGGG + Intronic
1102382776 12:112481786-112481808 TTATCTGTAAAGAATCAGCTGGG - Intronic
1103825890 12:123737785-123737807 TTAACTGTAGATAAGCAGATAGG + Intronic
1108140704 13:47417928-47417950 ATCAATGCAAAGAAGCAGCTAGG + Intergenic
1109331581 13:60937273-60937295 TAAACTGCATATAAGAAGCTTGG - Intergenic
1111111292 13:83713573-83713595 ATAATTGCAAAGAAGTAGCTTGG - Intergenic
1111532238 13:89552944-89552966 CTAAATGCACAGATGCAACTTGG - Intergenic
1112621916 13:101061940-101061962 TGAACTGCACACATGCAGGTTGG - Intronic
1115245178 14:31287341-31287363 TTAACTTCAGAGTAACAGCTTGG - Intergenic
1115675761 14:35671855-35671877 GTTATTGCACAGAAGCAACTAGG - Intronic
1116146179 14:41072099-41072121 TTGACTGCATAGAATCAGTTGGG + Intergenic
1118376685 14:65183691-65183713 TTAACAGAACACTAGCAGCTAGG - Intergenic
1119856513 14:77905004-77905026 TTAACTGAGCAGGAGCAGTTTGG + Intronic
1124182525 15:27490313-27490335 TTGTCTGCACAGAAGCAGTGTGG - Intronic
1125874999 15:43136251-43136273 TTAACTGCAAACAAGCATCATGG + Intronic
1127093673 15:55491895-55491917 TTAACTGCACTCCAGCAGCCTGG - Intronic
1128421106 15:67492333-67492355 TTAACTACAAAGGAGAAGCTGGG + Intronic
1128557034 15:68638900-68638922 TTGACAGCACAGAATCAGCAAGG - Intronic
1129911674 15:79232951-79232973 TCAGCTGCATAGAAGCAACTTGG - Intergenic
1133769663 16:8860381-8860403 TCAAAAGCACAGCAGCAGCTAGG - Intronic
1134202376 16:12209758-12209780 TTAAGTGCAGAGCAGCAGGTAGG - Intronic
1137375601 16:47949388-47949410 CTCACTGCACAGAAGAAGTTGGG - Intergenic
1138946591 16:61858684-61858706 AAAACTGGACAGAAGCATCTGGG + Intronic
1139367073 16:66440048-66440070 TTAACTTCACAGAAGTTGATGGG - Intronic
1139716883 16:68820752-68820774 TTAAATACACAGAAGCAGTCTGG - Intronic
1141404236 16:83777530-83777552 AAAACTGCTGAGAAGCAGCTTGG + Intronic
1142694390 17:1625490-1625512 TGAATTGCAGAGAAGCAGATAGG - Intronic
1143392769 17:6569806-6569828 GAAACTGCACAGAAGGGGCTGGG + Intergenic
1144327734 17:14197834-14197856 TCCTGTGCACAGAAGCAGCTGGG - Intronic
1145045724 17:19614126-19614148 CTTACTGCACACAAGAAGCTGGG - Intergenic
1145744681 17:27307257-27307279 TTAAATGTACAGGACCAGCTGGG - Intronic
1146473404 17:33142402-33142424 ATAAATGTTCAGAAGCAGCTGGG - Intronic
1149481662 17:57008456-57008478 TCACCTGCACAGATGAAGCTAGG + Intergenic
1150288956 17:63970927-63970949 TTAAGAGCACAGACTCAGCTGGG - Intronic
1150376124 17:64683226-64683248 TTAAATGCACAAAAGGAGATTGG + Intergenic
1151126116 17:71846521-71846543 TTAATTGTCCAGAAGCAGCCTGG + Intergenic
1151381390 17:73728128-73728150 TTAGATGCACAGCACCAGCTGGG - Intergenic
1151456272 17:74227854-74227876 TTAAGTGCAGATAAGCAGCCCGG - Intronic
1151848172 17:76672680-76672702 TTAACGCCACAGAGTCAGCTGGG - Exonic
1155364633 18:25037352-25037374 TTAAGTGCACAAAAGCAGTGTGG - Intergenic
1158182991 18:54738940-54738962 TTGACTGCAAAGAAGCATCAGGG - Intronic
1160044874 18:75377172-75377194 TTAAATGCAGAGAAGCAGCCAGG - Intergenic
1165910715 19:39224941-39224963 TCTACTTCACAGAAGCTGCTGGG - Intergenic
925051508 2:819286-819308 TTAACGGCAGAGAAGCAGGAGGG - Intergenic
927675771 2:25104928-25104950 TTAAATGCACACAAGAAGCAGGG - Intronic
928072858 2:28234955-28234977 GCAACTGCACAGAATCAGCAAGG - Intronic
931746141 2:65293546-65293568 TGAACTCCACAGCCGCAGCTGGG - Intergenic
932131182 2:69188676-69188698 CTAGCTTCACAGAAGCAGTTGGG + Intronic
932420096 2:71596545-71596567 TTAAATGCACAGATGCCTCTGGG + Intronic
933345241 2:81076050-81076072 TTTACTGCCCAGAAGAAGATGGG - Intergenic
934730043 2:96650634-96650656 TTAACTGTACAGGAGAGGCTGGG + Intergenic
939232292 2:139444448-139444470 TTACCTCCACAGAGGCAGCTTGG + Intergenic
942954625 2:181759620-181759642 TTTACTGCACAGATTCACCTAGG + Intergenic
949055073 2:241923205-241923227 TTAGCTGCACAGAACCTGCAGGG - Intergenic
949055080 2:241923256-241923278 TTAGCTGCACAGAACCTGCGGGG - Intergenic
949055088 2:241923307-241923329 TTAGCTGCACAGAACCTGCGGGG - Intergenic
949055103 2:241923409-241923431 TTAGCTGCACAGAACCTGCGGGG - Intergenic
1168872064 20:1138129-1138151 CTAGCTTCACAGAAGAAGCTGGG - Intronic
1168894850 20:1317105-1317127 ATAACTATACAGAAGCAGCCTGG + Intronic
1172055765 20:32153193-32153215 TTAACTGCACATAAGGACCTTGG + Intronic
1175320106 20:58079341-58079363 CTAGCTGCAGAAAAGCAGCTAGG + Intergenic
1176230016 20:64027801-64027823 GTGACTCCACACAAGCAGCTGGG - Intronic
1177641549 21:23850136-23850158 TCAACTGAGCAGAAGCAGCAAGG - Intergenic
1184828839 22:46971298-46971320 CTGAGTGCACAGATGCAGCTGGG - Intronic
1185182287 22:49370248-49370270 TTCACTGCACAGAAGCAGTGAGG + Intergenic
949460487 3:4287729-4287751 TAAACTGCACTGAGGCACCTTGG - Intronic
949525651 3:4900722-4900744 TTAACTCCAAAAAATCAGCTGGG + Intergenic
950524171 3:13513887-13513909 TTAAGTTCACAGAGCCAGCTGGG - Intergenic
950658482 3:14452085-14452107 TTTCCTGCCCAGAAGAAGCTGGG - Intronic
953594151 3:44292090-44292112 TTAACTGTACCGAGGCATCTAGG - Intronic
953821875 3:46213999-46214021 TTAACTTCACAGATGCAAGTGGG - Intronic
957156118 3:76547039-76547061 TTCAATGCACAAAAGCAGTTAGG + Intronic
957591597 3:82206096-82206118 TAAACTTCACAGCAGCAGCAGGG - Intergenic
959274052 3:104254763-104254785 GGAGCTGCACAGAAACAGCTAGG - Intergenic
959733858 3:109635089-109635111 TTCACAGAACAGCAGCAGCTTGG + Intergenic
961396966 3:126600427-126600449 TTAACTTCACACAAGCACCTGGG + Intronic
964848567 3:161069670-161069692 TTTTCTGCTCAGTAGCAGCTTGG + Exonic
965608738 3:170522648-170522670 TTAACTACAAAGAGGCAGCCTGG + Intronic
967666161 3:192174578-192174600 TTAATGGCACTGAACCAGCTTGG + Intronic
969160309 4:5251911-5251933 TTACCTGCTGAGAAGCAGCAAGG - Intronic
969649466 4:8455658-8455680 TTAAATGAGCAGAAGCAGCCAGG - Intronic
971723598 4:30279449-30279471 TTATATGCACAGAAACAGCAGGG - Intergenic
972329694 4:38053736-38053758 TTAATTACACAGAACCAGCAAGG - Intronic
973212311 4:47630495-47630517 TTACCTGCACAGACTCAGTTAGG - Intronic
977167833 4:93723479-93723501 TTAGCTACACACAACCAGCTTGG + Intronic
979435837 4:120689057-120689079 TTTACTGCACTGATGCAACTCGG + Intronic
981550001 4:145934501-145934523 CTAACTGAACAGAAGGAGCTGGG + Intronic
982274946 4:153629086-153629108 TTGCCTGCACAGGAGCAGGTGGG - Intronic
982745570 4:159102525-159102547 TTATCGCCACAGAAGCAACTCGG + Intergenic
985187765 4:187336012-187336034 TTAACAGCACAGAATCAAATTGG - Intergenic
985525435 5:399077-399099 TTGTCTGCTCTGAAGCAGCTGGG + Intronic
986727945 5:10613607-10613629 CTAACTGCACAGAATCATATGGG + Intronic
987758961 5:22134058-22134080 TTATCTGAACTGAAGCATCTTGG - Intronic
991814397 5:70499720-70499742 TTGACTGCACAGAAGTCACTGGG - Intergenic
991893665 5:71367505-71367527 TTATCTGAACTGAAGCATCTTGG - Intergenic
992849461 5:80791819-80791841 ATAAATGCACAGAAGAAGGTTGG + Intronic
992946483 5:81816321-81816343 TTTACTGCACAGAGGCATGTAGG - Intergenic
993870474 5:93247400-93247422 TTAACATAACAGAAGCACCTTGG - Intergenic
996133857 5:119814710-119814732 TTAACTGCACATAAGCTTCCAGG - Intergenic
996582483 5:125047236-125047258 ATACCTGCACAGAAGCTGATGGG + Intergenic
999105107 5:149063611-149063633 TTTCCTGCACACCAGCAGCTGGG - Intergenic
1000172474 5:158716115-158716137 TTAATTTCACAGAAGCAGGGAGG + Intronic
1001483883 5:172106118-172106140 TCAAGTGCACAGAGGCAGCACGG + Intronic
1004497619 6:16179808-16179830 TTATCTGCAAAGAAGCCACTGGG - Intergenic
1004513916 6:16306018-16306040 CTAGCGGCACAGAAGCAGCCGGG - Exonic
1004883459 6:20031030-20031052 TTAAGTGCAAAGTAGCAGATTGG + Intergenic
1008811197 6:55501622-55501644 TTGGCTGCACAGAATCACCTTGG + Intronic
1010236429 6:73578791-73578813 CTAACTACACATAGGCAGCTAGG + Intergenic
1011772935 6:90694978-90695000 TTAAGTGCAGAAACGCAGCTAGG + Intergenic
1012233102 6:96783332-96783354 CTAATTGCAAAGAAGAAGCTAGG + Intergenic
1013614361 6:111827904-111827926 CTAACTGCACAGAGGCAGGCAGG + Intronic
1021874207 7:25033284-25033306 CTAACTGCAAAGAAGCAGGAGGG - Intergenic
1023328310 7:39084777-39084799 TGACCAGCACAGAAGCAGGTGGG - Intronic
1028122471 7:87071641-87071663 TTAAGTCAACAGAAGCAGCATGG + Intergenic
1035386524 7:158476531-158476553 TTCACAGCACAGACGCCGCTCGG + Intronic
1036210941 8:6841039-6841061 TTAACTGCACACAAGCCCGTGGG + Intergenic
1036707273 8:11055216-11055238 TTCACAGCCCAGAAGCAGCGTGG + Intronic
1041289760 8:56297570-56297592 GCAAATGCACAGAAGGAGCTTGG + Intergenic
1042776496 8:72437985-72438007 TTGACTCCATAGAAGCAACTTGG + Intergenic
1044106523 8:88214407-88214429 TTCACTGTACACAAGCAGTTGGG - Intronic
1044848519 8:96405584-96405606 TTAGCAGCACAGAAGCAGGAGGG + Intergenic
1045024792 8:98076441-98076463 TTCACTTCACAGAATTAGCTGGG - Intronic
1045995831 8:108360366-108360388 TTAACTGCACCCAACTAGCTGGG + Intronic
1052879958 9:33595685-33595707 GAAAATGCACAGATGCAGCTTGG + Intergenic
1053340757 9:37326978-37327000 TCAACTATACATAAGCAGCTTGG + Intronic
1053496015 9:38548535-38548557 GAAAATGCACAGATGCAGCTTGG - Intronic
1055817790 9:80227946-80227968 TTAAATTCACAGAAGGAGTTAGG + Intergenic
1056179525 9:84068544-84068566 TTAAGTGTCCAGAAGCAGCTTGG - Intergenic
1056586124 9:87928346-87928368 GAAAATGCACAGATGCAGCTTGG - Intergenic
1056610758 9:88124597-88124619 GAAAATGCACAGATGCAGCTTGG + Intergenic
1057675944 9:97136053-97136075 GAAAATGCACAGATGCAGCTTGG - Intergenic
1057714312 9:97478370-97478392 GTAATTGCACAGAAGCATTTTGG + Intronic
1060551069 9:124485696-124485718 TTCACTGCACAAGAGCACCTGGG - Intronic
1061518506 9:131103491-131103513 CTAATTGCACAGAAGGAGCCTGG - Intronic
1061528692 9:131192242-131192264 TGAACTGCCCAGAAGCAGATGGG - Exonic
1061762106 9:132858143-132858165 TTAAGTGCACGGAAGCAGCACGG - Intronic
1190710078 X:53061326-53061348 TTAACTGCACAGAAGCAGCTAGG - Intronic
1193537271 X:82730300-82730322 TTAACTGGACACAATCAGCAGGG - Intergenic
1195981988 X:110588949-110588971 TAAAATGCACAGAAGCATCAAGG + Intergenic
1196409522 X:115401073-115401095 TTCAGAGCACAGCAGCAGCTTGG - Intergenic
1197626385 X:128806950-128806972 TGAACTGAACTGAAACAGCTGGG + Intergenic
1197884203 X:131201055-131201077 GGAACAGCACAGAAGCAGCCTGG - Intergenic
1199609467 X:149600559-149600581 TTAACTGGACAGACACAGCAAGG - Intronic
1199629650 X:149768795-149768817 TTAACTGGACAGACACAGCAAGG + Intergenic
1202082988 Y:21104048-21104070 TCTATTGCACACAAGCAGCTTGG - Intergenic