ID: 1190710310

View in Genome Browser
Species Human (GRCh38)
Location X:53063294-53063316
Sequence GCCCCTGCTGTGGCTCAAGC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 533
Summary {0: 1, 1: 2, 2: 15, 3: 93, 4: 422}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1190710310_1190710318 22 Left 1190710310 X:53063294-53063316 CCTGCTTGAGCCACAGCAGGGGC 0: 1
1: 2
2: 15
3: 93
4: 422
Right 1190710318 X:53063339-53063361 ATTGAAGGAGCAGAGTCCCAAGG 0: 1
1: 0
2: 5
3: 27
4: 288
1190710310_1190710319 25 Left 1190710310 X:53063294-53063316 CCTGCTTGAGCCACAGCAGGGGC 0: 1
1: 2
2: 15
3: 93
4: 422
Right 1190710319 X:53063342-53063364 GAAGGAGCAGAGTCCCAAGGTGG 0: 1
1: 1
2: 4
3: 47
4: 386
1190710310_1190710316 7 Left 1190710310 X:53063294-53063316 CCTGCTTGAGCCACAGCAGGGGC 0: 1
1: 2
2: 15
3: 93
4: 422
Right 1190710316 X:53063324-53063346 GGGTACTGCTCCAGAATTGAAGG 0: 1
1: 0
2: 1
3: 12
4: 87

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1190710310 Original CRISPR GCCCCTGCTGTGGCTCAAGC AGG (reversed) Intronic
900634896 1:3658116-3658138 GCCCTTGCTCTGGCCCCAGCAGG - Intronic
900898377 1:5500067-5500089 GGCCCTGCTGTGGCTCCCACAGG - Intergenic
902326823 1:15706309-15706331 GCCCCTGCTGTTCCTCTAACCGG + Intronic
902943188 1:19815007-19815029 GCCCCTGCTGGGGGTCATTCTGG - Exonic
903141879 1:21344198-21344220 GCCCCTGCTGTGCCCAGAGCTGG - Intronic
903345906 1:22684258-22684280 GGCCCTGCTGCGGCTCCAGCTGG - Intergenic
903752678 1:25636813-25636835 TCCTCTGCTGTGGCTCCAGCTGG + Intronic
904802396 1:33103074-33103096 GCTACTGCAGTAGCTCAAGCAGG - Intronic
905020615 1:34808442-34808464 ACCCGAGCTGTGGCTCAAGTGGG - Intronic
905307841 1:37031832-37031854 GCTCCAGCTGGGGTTCAAGCAGG + Intronic
905310802 1:37047545-37047567 GCACCTGCTCTGGCTGAATCAGG + Intergenic
905848506 1:41255532-41255554 GGAGCTGCTGTGGCTCAGGCTGG - Intergenic
907315400 1:53567709-53567731 GCCCCAGCTGTGGCTAAAAGGGG + Intronic
907437125 1:54457107-54457129 GGCCTTTCTGTGCCTCAAGCAGG + Intergenic
908032881 1:60020239-60020261 GCTCCAGCTGTGGCTAAAACAGG + Intronic
908942686 1:69454790-69454812 CCCCCAGCCATGGCTCAAGCAGG + Intergenic
909861091 1:80606860-80606882 ACCCCAGCCATGGCTCAAGCTGG + Intergenic
910001781 1:82350377-82350399 GTCCCAGCTGTGGCTAAAGTGGG - Intergenic
911339263 1:96617548-96617570 GCCATTGCTGAGGCTTAAGCAGG - Intergenic
911638582 1:100263802-100263824 TCCTCTGCCGTGGCTCCAGCCGG - Intergenic
912241684 1:107917146-107917168 GCCTCTGCTCTGGCCCATGCAGG - Intronic
912398534 1:109368565-109368587 GCCCCTGCTCTTGTTCAAGCAGG + Intronic
912490637 1:110060878-110060900 GCCCCTTCTGCGGCTCACCCTGG - Exonic
912834790 1:112986525-112986547 GCCCCAGCTGTGGTTCAAGTGGG - Intergenic
913317624 1:117566032-117566054 CTCCCTGCTGGGGCTCAGGCAGG + Intergenic
915097242 1:153471725-153471747 TCCTCTGCCGTGGCTCCAGCTGG - Intergenic
915227825 1:154423931-154423953 GCCCCTGCTATTGTTCAGGCTGG + Intronic
915366910 1:155321857-155321879 GCCCCTCCTGTAGCTCAGGACGG - Exonic
915679069 1:157562557-157562579 GCCCCTGCTGCTGCTACAGCTGG - Intergenic
917002506 1:170375177-170375199 GCTCCAGCTGTGGCTCAAAGGGG - Intergenic
917281985 1:173386235-173386257 GCCCTACCTGTGGCTCAAGTGGG + Intergenic
917698567 1:177555885-177555907 GCCCCAGCTGTGGCAAAAGTAGG - Intergenic
918848091 1:189644923-189644945 TCCTCTGCTGCGGCTCTAGCCGG + Intergenic
919529711 1:198701842-198701864 GCTCATGCTGTGGCCCAGGCAGG + Intronic
919777150 1:201201735-201201757 GACCCTGATGTGTCTTAAGCTGG - Exonic
920049937 1:203157793-203157815 GCCCCAGCCATGGCTCAAGCAGG - Intronic
920431506 1:205921898-205921920 GACCTTGCTGTGACTGAAGCAGG + Intronic
920890378 1:209979170-209979192 CGCCCTGCTTTGGCTCACGCTGG + Intronic
921887017 1:220317259-220317281 GTGCCAGCTGTGGCTCATGCTGG - Intergenic
922485903 1:225972783-225972805 GACCCTGCTCTGGTCCAAGCTGG - Intergenic
923171402 1:231421309-231421331 GCCCCTGCCGGCGCTGAAGCTGG - Exonic
924296871 1:242596581-242596603 TCCTCTGCCGTGGCTCCAGCCGG - Intergenic
924728857 1:246693914-246693936 TCCTCTGCTGCGGCTCCAGCCGG - Intergenic
1063455229 10:6178298-6178320 GCCCCTGCTGTGGGCCAGGCTGG + Intronic
1064523033 10:16223524-16223546 TCCTCTGCTGTGGCTCCAGCTGG + Intergenic
1067781670 10:49212109-49212131 CCACTTGCTGTGGCTCAAACTGG - Intergenic
1069570085 10:69489526-69489548 TCCTCTGCTGTGGCTGCAGCTGG + Intronic
1069710235 10:70483329-70483351 GCCCCTGCCTGGGCTGAAGCTGG + Intronic
1070463382 10:76692164-76692186 TCCTCTGCCGTGGCTCCAGCTGG + Intergenic
1072268119 10:93749958-93749980 GCGCCTCCTCTGGCTCATGCTGG - Intergenic
1072426386 10:95334318-95334340 TCCCCTCCTGTGGCTGGAGCAGG - Intronic
1073432283 10:103494258-103494280 GGCCCTGCTGGGGCTGCAGCCGG - Exonic
1073512286 10:104050337-104050359 GCCCCTGCTGTTGCACAAATTGG + Intronic
1075021523 10:118956059-118956081 GATCCAGCTGTGCCTCAAGCTGG + Intergenic
1075476006 10:122734504-122734526 GCCCCTGCTGAGGCCCAATTTGG + Intergenic
1075500701 10:122971265-122971287 ACCCCAGCTGTGGCTCAAGCAGG + Intronic
1076246316 10:128950180-128950202 GCACCTTCTGTGGCTCCAGTGGG - Intergenic
1076538577 10:131198951-131198973 GCCCCAGCTGTGGCTCAAGTGGG - Intronic
1076744895 10:132507918-132507940 GACCCTGCTGTGGCTCCAGACGG - Intergenic
1077337901 11:2013652-2013674 CGCCCTGCTGTGGCTCTAGCTGG + Intergenic
1077768624 11:5190334-5190356 GCACCAGCTGTGGCTCAAAGGGG + Intergenic
1077877540 11:6320559-6320581 GCTCCAGCTGTGACTCAGGCAGG + Exonic
1079618910 11:22529033-22529055 CCCCCTGCTTTGGCTCGCGCAGG + Intergenic
1082135835 11:48547868-48547890 CGCCCTGCTTTGGCTCATGCAGG + Intergenic
1083063400 11:59898229-59898251 GCGCTTGCTGTGGCTCACGCCGG + Intergenic
1083318681 11:61832064-61832086 CCCCCTGCTCTCTCTCAAGCTGG + Intronic
1083768579 11:64854008-64854030 GCCTTTGCTGTGGCTGGAGCTGG - Exonic
1084514499 11:69629145-69629167 GCTACTGCTGTGGCTCAGCCTGG + Intergenic
1085279153 11:75319139-75319161 GAGCCAGCTGTGGTTCAAGCAGG - Intronic
1085313699 11:75531006-75531028 GCCCCGGCTGTGGCCCAAGTGGG + Intergenic
1085462078 11:76700278-76700300 GCCCCACCTGTGGCTCAGCCAGG - Intergenic
1085480660 11:76820338-76820360 GCCAATGCTGTGTCTCAAGCTGG - Intergenic
1085883918 11:80500099-80500121 GCCCCAACTGTGGCTGAAGTGGG + Intergenic
1085947106 11:81284981-81285003 TCCTCTGCCGTGGCTCCAGCCGG - Intergenic
1086529247 11:87764354-87764376 CGCCCTGCTTTGGCTCACGCTGG + Intergenic
1087239747 11:95761527-95761549 CCCCCTGCTTTGGCACTAGCTGG - Intergenic
1087513493 11:99128266-99128288 GCCACTACTGTGGCTCTAGTAGG + Intronic
1087675603 11:101158113-101158135 GCTCCAGCTGTGGCTAAAGTGGG + Intergenic
1087681350 11:101221326-101221348 TCCTCTGCTGTGGCTCCAGCCGG + Intergenic
1089032324 11:115345115-115345137 GCCCCTGCTGTGGGACAAAGGGG - Intronic
1089480858 11:118803957-118803979 GGCCTCACTGTGGCTCAAGCTGG + Intergenic
1089766554 11:120771760-120771782 GCCCCAGGTGTGGCTCCAGTGGG + Intronic
1090423318 11:126590529-126590551 GGCCCTGCTGTGGCTCACTGTGG + Intronic
1090762513 11:129849700-129849722 ACCCTAGCTGTGGCTCAAGCAGG - Intronic
1202820885 11_KI270721v1_random:68834-68856 CGCCCTGCTGTGGCTCTAGCTGG + Intergenic
1092670525 12:10856052-10856074 GCTCCAGCTGTGGCTCAAAGGGG + Intronic
1093200057 12:16175819-16175841 GCCCCTGCTGTCTCTTAAGCAGG - Intergenic
1093242635 12:16697111-16697133 ACCTCAGCTGTGGCTCAAGCAGG + Intergenic
1094002195 12:25707320-25707342 GCTCCAGCTGTGGCTCAAAGGGG + Intergenic
1095043413 12:37470442-37470464 GGCCCAGCTGTGTCTCAAGCAGG + Intergenic
1095252864 12:39998999-39999021 TCCTCTGCTGCGGCTCCAGCTGG - Intronic
1095731304 12:45509601-45509623 ACCCACGCTGTGGCTCAAGTGGG - Intergenic
1095929865 12:47614492-47614514 GCCCCAGCTGTGGCTCAGAGGGG - Intergenic
1096168913 12:49450359-49450381 GTCCCAGCTGTGGCTGAGGCAGG - Intronic
1096516783 12:52160525-52160547 GTCCCAGCCATGGCTCAAGCAGG - Intergenic
1096960258 12:55570118-55570140 GCCCAGGCTGTGGCTTAAGAAGG - Intergenic
1097368093 12:58742252-58742274 GTCCCTGCTGTGGCTAAAAGGGG + Intronic
1099318912 12:81119971-81119993 TCCTCTGCCGTGGCTCCAGCTGG + Intronic
1099724637 12:86410849-86410871 TCCTCTGCTGTGGCTCCAGTTGG + Intronic
1100087571 12:90930305-90930327 TCCTCTGCTGTGGCTCCAGCTGG + Intronic
1100840140 12:98604656-98604678 GGTCCTGCTGTTGCTCAGGCTGG + Intronic
1100970521 12:100065073-100065095 TCCTCTGCTGTGGCTCCAGCTGG - Intronic
1102045475 12:109827426-109827448 GCCCCTCCTGTGTGCCAAGCAGG + Intronic
1103531994 12:121608867-121608889 GCCCCTTCTGTTTCTAAAGCAGG - Intergenic
1105072677 12:133245102-133245124 GACCCTGCTTTGGCTCATGCTGG - Intergenic
1105244353 13:18635209-18635231 TCCTCTGCTGCGGCTCCAGCTGG - Intergenic
1105418101 13:20230925-20230947 GCCACTGCAGTGACTAAAGCTGG - Intronic
1105897809 13:24732203-24732225 TCCTCTGCTGTGGCTCCAGCCGG + Intergenic
1106025225 13:25949682-25949704 GCCCTTCCCGTGGCTCCAGCTGG + Intronic
1106036065 13:26046680-26046702 GCCCTTGATGTGGCACAATCTGG + Exonic
1106754805 13:32811809-32811831 ACCCTTCCTGTGGCTAAAGCAGG - Intergenic
1107435353 13:40376572-40376594 GGCCAAGCTGTGGCTCCAGCAGG + Intergenic
1108885656 13:55178326-55178348 GCTCCAGCTGTGGCTAAATCGGG + Intergenic
1108960574 13:56222607-56222629 TCCCCTGCAGTGGCTCCAGCTGG + Intergenic
1110023562 13:70507470-70507492 CCCAGTACTGTGGCTCAAGCTGG + Intergenic
1110408941 13:75183196-75183218 TCCTCTGCTGCGGCTCCAGCCGG - Intergenic
1110843748 13:80171028-80171050 GCCCCTCCTCTGGCACAATCAGG + Intergenic
1110912065 13:80977510-80977532 GCTCCAGCTGTGGCTCACGCAGG - Intergenic
1110953621 13:81524628-81524650 TCCTCTGCTGTGGCTCCAGCTGG - Intergenic
1111219064 13:85180622-85180644 GCTCCAGCTGTGGCTAAAGGGGG + Intergenic
1112051764 13:95649834-95649856 TTCCCAGCTGTAGCTCAAGCAGG - Intergenic
1112671431 13:101643716-101643738 GCCCCTACAGTGGATCCAGCTGG - Intronic
1113149304 13:107243799-107243821 GCCTCTGCTGTGGCTACAGGAGG + Intronic
1113450098 13:110402953-110402975 GCCCCAGCTGTGGCTCCAGTGGG - Intronic
1115280263 14:31653895-31653917 TCCTCTGCTGCGGCTCCAGCTGG + Intronic
1115936614 14:38559815-38559837 GCTCCAGCTTTGGCTCAAGTGGG - Intergenic
1115940912 14:38608763-38608785 GCCCCAGCTATGGCTCAAGAAGG - Intergenic
1116439864 14:44939135-44939157 TCCCCAGCTGTGGCTCAAATAGG - Intronic
1116500653 14:45617177-45617199 ACCTCAGCTGTGGCTCAAGCAGG - Intergenic
1116931365 14:50694375-50694397 GCTCCTGCTGTGGCTGAAAGTGG - Intergenic
1117211569 14:53506335-53506357 GCCACTGCTGTGTCCTAAGCAGG + Intergenic
1118106002 14:62660260-62660282 GCCTCAGCTGTGGCCCAAGAAGG + Intergenic
1118216403 14:63812704-63812726 TCCTCTGCTGTGGCTCCAGCTGG + Intergenic
1118483352 14:66189407-66189429 GCCATTGCTGAGGCTTAAGCAGG - Intergenic
1118756051 14:68844382-68844404 TCCCCATCTGTGGCCCAAGCTGG + Intergenic
1119308694 14:73628772-73628794 GCCACAGCAGTGGCTCATGCCGG + Intergenic
1119387078 14:74264142-74264164 GGTCCTGCTGTTGCTCAGGCTGG + Intergenic
1119508261 14:75191335-75191357 GCCCCAGCCATGGCTCATGCAGG + Intergenic
1119547468 14:75482680-75482702 GCCCCAGCTGTTGCTCAGGTGGG - Intergenic
1121433755 14:93905519-93905541 GCCCCTTCTGTGGGCCCAGCAGG - Intergenic
1121985656 14:98502851-98502873 GCCCCTGCTGTCTCTCCAGTTGG - Intergenic
1122104476 14:99441734-99441756 GCCCCTGCTGTGGCCTCATCAGG - Intronic
1122394050 14:101410165-101410187 TCTCCTGCTATGGCTCAGGCTGG - Intergenic
1122761701 14:104033527-104033549 GCCCTTGCTGGGGCTGCAGCAGG + Intronic
1123028034 14:105437819-105437841 GCCCCTGCGGTGGCCCCAGGAGG + Intronic
1202941958 14_KI270725v1_random:158054-158076 GGCCCAGCTGTGTCTCAAGCAGG + Intergenic
1123997583 15:25729620-25729642 ACCCCTTCTGTGGGCCAAGCAGG - Intronic
1124149165 15:27161415-27161437 TCCTCTGCTGTGGCACAAACTGG - Intronic
1124556086 15:30727225-30727247 GTCCCAGCTGTGGCTAAAACGGG - Intronic
1124675187 15:31678545-31678567 GTCCCAGCTGTGGCTAAAACGGG + Intronic
1124705424 15:31960069-31960091 GCACCAGCTGTGGCTCAAGGAGG + Intergenic
1125217304 15:37289955-37289977 GCCCCAGCTGTGGCTCAAACAGG - Intergenic
1126291494 15:47085410-47085432 GGCCCAGCTGTGTCTCAAGCAGG - Intergenic
1126621946 15:50649159-50649181 ACACCGGCTGTGGCTCACGCGGG + Intronic
1128638470 15:69318162-69318184 GCCCCTGCTGCAGCTCAGGCTGG - Intronic
1128744528 15:70104066-70104088 GCCCTTGCTGTGGCTCAGAGGGG + Intergenic
1129394520 15:75236620-75236642 CCCCCAGCTTTGGCTCCAGCCGG - Intergenic
1130792405 15:87169550-87169572 GCACCTGCTGTGTCCTAAGCAGG + Intergenic
1131822464 15:96286757-96286779 GTCCCGGAGGTGGCTCAAGCAGG - Intergenic
1132076971 15:98830070-98830092 GTCCCTGCTGTGTCCCAACCTGG + Intronic
1132390674 15:101436159-101436181 GGCCCTGCTGTGGCTCAGGAAGG + Intronic
1132747131 16:1441502-1441524 GCCCCTGCTGAGGCCACAGCAGG + Intronic
1132807375 16:1781392-1781414 GCCCGGGCCGTGGCTCTAGCAGG - Exonic
1133045190 16:3084038-3084060 GCTCCAGCTGTGGCTAAAGAAGG - Intergenic
1134055913 16:11169800-11169822 GGCCCTGCCGTGGCTACAGCAGG - Intronic
1135627640 16:24010130-24010152 GCCCCTGCTGGCTCTGAAGCTGG - Intronic
1136316609 16:29458163-29458185 CCACCTGCTGTGGGTCCAGCAGG + Exonic
1136431185 16:30197505-30197527 CCACCTGCTGTGGGTCCAGCAGG + Exonic
1136768139 16:32810028-32810050 GCTACTACTGTGGCTCAGGCGGG - Intergenic
1137068586 16:35877634-35877656 GGACTTGCTGTGGCTCAGGCAGG + Intergenic
1137269409 16:46893691-46893713 CCCGCCGCTTTGGCTCAAGCAGG - Intronic
1137677002 16:50308723-50308745 GCCCCTGCTGAGGCTGACCCTGG + Exonic
1138575260 16:57903629-57903651 GCCCCTGAAGTGCCTCTAGCAGG - Intronic
1139128293 16:64108825-64108847 GTCCCAGTTGTGGCTCAAGTGGG + Intergenic
1139673308 16:68506346-68506368 GCCCCAGCTGAGGTTCAGGCGGG - Intergenic
1140587996 16:76317143-76317165 GTCCCAGCTATGGCTGAAGCAGG + Intronic
1141072988 16:80975046-80975068 GCCCCTGCTGTGACTGCAGCTGG + Exonic
1141158235 16:81611612-81611634 GTCCTTGCTGTGGCTCACTCTGG + Intronic
1141214186 16:82008967-82008989 GCTCCAGCTGTGGCTAAAACGGG + Intronic
1142591087 17:1006415-1006437 GCCCCTGCTCTGGGTCTTGCAGG + Intronic
1143401629 17:6649164-6649186 ACCCCTGCTTTGTCTTAAGCAGG - Intronic
1143591169 17:7886358-7886380 CCCCCTGCTGTTCCCCAAGCAGG - Intronic
1144221778 17:13106377-13106399 GCCCCTCCCTTGGGTCAAGCAGG + Intergenic
1144512111 17:15886313-15886335 ACCCATGCTGTGGCACAGGCAGG - Intergenic
1144647664 17:16986667-16986689 ACCCCAGCTGTGGCTCAAATGGG + Intergenic
1145057890 17:19715085-19715107 GTCCCTGCTCTGGGCCAAGCTGG + Intronic
1145168359 17:20633844-20633866 GCCTCTGCCTTGGCCCAAGCCGG - Intergenic
1145370501 17:22303003-22303025 GCCATTGCTGTGGCTGCAGCAGG + Intergenic
1146258569 17:31406084-31406106 GCTCCTGCTCTGGTGCAAGCAGG + Intronic
1146476775 17:33169132-33169154 GCCCCAGCTATGGCTCAAGTGGG + Intronic
1146530117 17:33601434-33601456 GCCCCAGCTGTGGCTCAGGCAGG + Intronic
1146721803 17:35129299-35129321 GCTCCTGCTGGGGCCCAGGCAGG - Intronic
1147278705 17:39339435-39339457 TCTCCTGCTGTCACTCAAGCTGG - Intronic
1147512282 17:41081364-41081386 GCTCCAGTTGTGGCTCAAGTGGG + Intergenic
1147514454 17:41102535-41102557 GCTCCAGTTGTGGCTCAAGTGGG + Intronic
1147900164 17:43778663-43778685 GCCCCCGCTGTGGCTCCCGGAGG + Intronic
1148051291 17:44771268-44771290 GGTCTTGCTGTCGCTCAAGCTGG - Intronic
1149411912 17:56417433-56417455 GTCCCTGCTGTTTCTCAAGCAGG + Intronic
1149594262 17:57854807-57854829 GCCAGTGCAGTGGCACAAGCTGG + Intergenic
1150470386 17:65432252-65432274 GCACCTGCTGTGTTTCAGGCAGG + Intergenic
1151082641 17:71346364-71346386 GCCCCAGCAGTTGCTCAAACAGG + Intergenic
1152381567 17:79944964-79944986 GCTCCTTCTGTGCTTCAAGCGGG - Exonic
1152690597 17:81716130-81716152 GACCCAGCTGAGGCTCCAGCAGG + Intronic
1153831758 18:8930053-8930075 GGCCACACTGTGGCTCAAGCTGG - Intergenic
1154010169 18:10567545-10567567 GGCCCTGCTGTGACATAAGCAGG + Intergenic
1154444584 18:14424695-14424717 TCCTCTGCTGTGGCTCCAGCTGG + Intergenic
1155033621 18:22005283-22005305 GCACTAGCTGTGCCTCAAGCTGG + Intergenic
1156360532 18:36380899-36380921 GCCCCTGCTGTGGCTCAGGAGGG - Intronic
1156386213 18:36607306-36607328 ACCCCAGCTGTGACTCAAGCAGG - Intronic
1159815660 18:73071211-73071233 TCCTCTGCTGCGGCTCCAGCCGG - Intergenic
1160908951 19:1466031-1466053 CCCGCTGCTGCGGCTCAAGGCGG + Exonic
1160919191 19:1511956-1511978 GCCACTGCTGAGGCTGGAGCAGG + Intronic
1161210486 19:3062773-3062795 GGCCCTGCTGTGGCACGACCTGG + Exonic
1161444760 19:4311897-4311919 GACCCTGGTGTGGCGCATGCCGG + Exonic
1161837899 19:6660146-6660168 GCCCCTGCTGTGGGGGAAGGAGG + Intergenic
1161977623 19:7615227-7615249 GCCGCTGCTGCCGCTCCAGCAGG - Exonic
1162002724 19:7757638-7757660 GCCCCAGCTGTGGCTAAAAGGGG + Intergenic
1163845404 19:19635628-19635650 GACCCTGGTGAGGCTGAAGCAGG - Exonic
1164288746 19:23848228-23848250 TCCTCTGCCGTGGCTCCAGCCGG + Intergenic
1164525248 19:29008734-29008756 ACCTGTGCTGTGGCTCCAGCAGG - Intergenic
1165642136 19:37398668-37398690 GCCTCTGCTGTGGCTCAAGCTGG - Intergenic
1166963443 19:46513728-46513750 GCCCCTCCGGCGGTTCAAGCAGG - Intronic
1167468521 19:49662890-49662912 GATCCTGCTGAGGCCCAAGCTGG - Intronic
1167636841 19:50660147-50660169 TCCCCTGCTGTGGGTAAAGGGGG - Intronic
1167788105 19:51652319-51652341 GAACCTGCTGTGCCTGAAGCCGG + Intergenic
1168712124 19:58507325-58507347 TCCTCTGCCGTGGCTCCAGCCGG - Intronic
925061756 2:896968-896990 ACTCCAGCTATGGCTCAAGCAGG + Intergenic
925693690 2:6551798-6551820 ACCCCAGCTCTGGCTCAAGCAGG + Intergenic
927079788 2:19616193-19616215 TCCTCTGCCGTGGCTCCAGCTGG + Intergenic
928170686 2:29001141-29001163 GACCCAGCTGGGGCTCAAGGTGG + Intronic
928396874 2:30949454-30949476 GTCCATGCTTAGGCTCAAGCAGG + Intronic
929699618 2:44150751-44150773 GCCCCAGCTACGGCTCAAGTGGG + Intergenic
930030545 2:47055833-47055855 GCCAGCGCTGTGGCTGAAGCGGG + Intronic
930076134 2:47407159-47407181 GCCCCAGCTGTGGCTGAAAGGGG + Intronic
930300616 2:49611278-49611300 TCTTCTGCTGTGGCTCCAGCTGG - Intergenic
931496502 2:62813199-62813221 GCCATGGCTGTGGTTCAAGCAGG + Intronic
932071997 2:68629828-68629850 TCCTCTGCCGTGGCTCCAGCTGG + Intronic
932395518 2:71444468-71444490 TCCTCTGCTGTGGCTCCAGCTGG - Intergenic
932570082 2:72934006-72934028 GCCCCTGCGTGGGCCCAAGCTGG + Exonic
932986231 2:76728850-76728872 CGCCCTGCTTTGGCTCATGCAGG + Intergenic
933086246 2:78058202-78058224 GCACCTGTTGTGGCTAAGGCAGG + Intergenic
934068745 2:88364396-88364418 GCCCCTGCTGTGGGAAAAACTGG + Intergenic
934485250 2:94701890-94701912 GCTACTGCGGAGGCTCAAGCAGG + Intergenic
934569486 2:95359821-95359843 GCCCCAGCTGTGGCTCAAGTGGG - Intronic
934992774 2:98933147-98933169 GTCCCCGCTGTGGCTCACCCTGG + Intronic
936064545 2:109320415-109320437 GCGCCTGCGGTGGTTCCAGCAGG - Intronic
936111859 2:109671283-109671305 GCCCCTGCCCTGGCTGCAGCTGG - Intergenic
936644140 2:114349240-114349262 GCCCCAGCTGTGGCTCAAGTAGG - Intergenic
937112144 2:119374782-119374804 TCCTCTGCTGCGGCTCTAGCCGG + Intergenic
937292950 2:120793121-120793143 GCCCCTGCTGAGGCCCCAGAGGG + Intronic
937606414 2:123806750-123806772 TCCTCTGCCGTGGCTCCAGCTGG + Intergenic
939310371 2:140468189-140468211 AGCCCAGCTGTGGCCCAAGCAGG + Intronic
939667570 2:144969683-144969705 GCTCCAGCTGTGGCTGAAGGGGG - Intergenic
939961062 2:148566513-148566535 CCTACTGCAGTGGCTCAAGCAGG - Intergenic
943936065 2:193918729-193918751 GCCCCAGCTGTGGCTAAAAGAGG + Intergenic
945611589 2:212011253-212011275 CCCTCTGCCGTGGCTCCAGCTGG + Intronic
945794115 2:214340579-214340601 GCACCTGCTGCTGCTCCAGCAGG + Intronic
946898141 2:224345600-224345622 GCTCCAGCTGTGGCTCAAAGGGG - Intergenic
948802527 2:240439356-240439378 GCCCCTCCTCTGCCTCAGGCTGG - Intronic
948874016 2:240817996-240818018 GCCCCATCTGGGGCTCCAGCCGG - Intronic
1171537870 20:25913200-25913222 GGCCCAGCTGTGTCTCAAGTAGG + Intergenic
1171803318 20:29648603-29648625 GGCCCAGCTGTGTCTCAAGCAGG - Intergenic
1171840803 20:30208511-30208533 GGCCCAGCTGTGTCTCAAGCAGG + Intergenic
1173281481 20:41632058-41632080 GACCCAGCTGTGGCTAAATCTGG + Intergenic
1174335738 20:49859147-49859169 GCCACTGCTGAGACCCAAGCTGG + Intronic
1175892671 20:62322443-62322465 GTCCCTCCTGTGGCACAGGCTGG + Exonic
1176030532 20:63009153-63009175 GCCCCTGCTGCGGCCCCTGCGGG + Intergenic
1176451399 21:6865166-6865188 TCCTCTGCTGCGGCTCCAGCCGG - Intergenic
1176581210 21:8528880-8528902 GGCCCAGCTGTGTCTCAAGCAGG - Intergenic
1176879903 21:14179613-14179635 TCCTCTGCTGCGGCTCCAGCCGG - Intronic
1177306069 21:19317472-19317494 GCTCCAGCTGTGGCTAAAGAGGG - Intergenic
1177367389 21:20155245-20155267 AAACCTGCTGTGGCTAAAGCAGG - Intergenic
1177402459 21:20623546-20623568 GCTCCTGCTGTGGCTAAAAGGGG - Intergenic
1177516504 21:22158586-22158608 ACCCCAGCTGTGGCTCAAGCAGG - Intergenic
1178804016 21:35823700-35823722 GCCCCTGCTGAGGCTGGAGACGG - Intronic
1179022601 21:37653956-37653978 GACCCTACGGTGGCTCAAGAAGG + Intronic
1181158581 22:20941924-20941946 GGCCCTGGTGTGGTTCAGGCAGG + Intronic
1181688522 22:24545193-24545215 GACTCAGCTGTGGCTGAAGCTGG - Intronic
1182148913 22:28014857-28014879 GCCCGTGCTGGGGCTCAGGTGGG - Intronic
1182560762 22:31157168-31157190 GGTCCTGCTGTTGCCCAAGCTGG - Intergenic
1183174139 22:36210295-36210317 TCCTCTGCTGCGGCTCCAGCCGG + Intergenic
1183461562 22:37953979-37954001 GGCCCTCCTGTGCCTCCAGCCGG - Intronic
1184408978 22:44315815-44315837 TCCCCAGCAGTGGCTCAGGCAGG - Intergenic
1184449058 22:44572159-44572181 GCCACTGCTGTGGTTCCAGCCGG - Intergenic
1184652586 22:45925914-45925936 GCTCCTGCTGTGGCCCAGGATGG + Intronic
1184838050 22:47035676-47035698 GACCCTGCTGTGGCGGGAGCTGG - Intronic
1184904668 22:47472898-47472920 TCCCCAGCTGTGGCTCAGCCAGG - Intronic
1184951973 22:47849605-47849627 ACCCCTGCTGTGGCTGAACTTGG + Intergenic
1185038241 22:48490474-48490496 GCCCCTGCCGAGGCTCCAGGCGG + Intronic
1185145838 22:49136206-49136228 GGCCCAGCTGTGGCTCATGGGGG + Intergenic
949188324 3:1220158-1220180 TCACCTTCTGTTGCTCAAGCTGG - Intronic
950931110 3:16789698-16789720 GCCCCAGCTGTGGCTCAGATGGG - Intergenic
951522966 3:23626419-23626441 ACCCCAGCCATGGCTCAAGCAGG - Intergenic
951859628 3:27237508-27237530 TCCTCTGCCGTGGCTCCAGCCGG + Intronic
951978556 3:28541476-28541498 TCCTCTGCTGCGGCTCCAGCTGG + Intergenic
952288848 3:31995750-31995772 TCCTCTGCTGAGGCTCCAGCCGG + Intronic
952724953 3:36573892-36573914 ACCCCAGGTGTGGCTCAAGCAGG - Intergenic
952735058 3:36681068-36681090 GCTCCAGCTGTGGCTCAAGGGGG - Intergenic
952866096 3:37856097-37856119 GCCCCCACTGTTGCTTAAGCTGG + Intergenic
953381866 3:42478139-42478161 GCCCCTGCTGAGGCTCTGTCTGG - Intergenic
953846519 3:46431576-46431598 TCCTCTGCTGTGGCTCCAGCTGG - Intergenic
954701416 3:52452793-52452815 GCCCCTGATGAAACTCAAGCTGG + Intronic
955301456 3:57783917-57783939 GCCCTAGCTGTGGCTCAAGTGGG + Intronic
955627535 3:60934487-60934509 GCCACTGCTGTAGCTCACTCTGG - Intronic
956304068 3:67804999-67805021 GCCACTGCTGCTGCTCAAGGAGG - Intergenic
956868438 3:73392165-73392187 GCACCTGCTGTTGCTCCACCTGG - Intronic
957576466 3:82014678-82014700 GCTCCTGCCGTGGCTCAAAGGGG + Intergenic
958424336 3:93963947-93963969 TCCTCTGCTGTGGCTCCAGCCGG - Intronic
958497504 3:94864019-94864041 TCCTCTGCTGTGGCTCCAGCCGG + Intergenic
958621952 3:96573692-96573714 TCCTCTGCCGTGGCTCCAGCCGG + Intergenic
958893462 3:99805265-99805287 GCTCCAGCTGTGGCTCAAAGGGG - Intergenic
959460829 3:106623466-106623488 ACCCCAGCTGTGTTTCAAGCAGG - Intergenic
959849675 3:111071808-111071830 GCCACTGCCGAGGCTGAAGCGGG - Exonic
959973042 3:112428471-112428493 GCCCCAGTCATGGCTCAAGCTGG + Intergenic
960503985 3:118470929-118470951 GCCCCAGTTGTGGCTCAGACAGG - Intergenic
960581434 3:119282580-119282602 GCCCCAGCTGTGGCTAAAAGGGG + Intergenic
960646307 3:119888275-119888297 TCCTCTGCCGTGGCTCCAGCTGG - Intronic
961446874 3:126985076-126985098 GATCCTGCTATGGCTCAGGCAGG - Intergenic
961667792 3:128504404-128504426 GCCCCTGCTGTGTCCCATGCAGG - Intergenic
963009525 3:140756151-140756173 GCCACTGCTGTGGCTCTGGATGG + Intergenic
963538958 3:146562513-146562535 GTCCCAGCTGTGGCTAAAACGGG - Intergenic
964310416 3:155386136-155386158 GCCCATGCTGTGCCACAGGCTGG - Intronic
965083647 3:164066723-164066745 GCCCCAGGGGTGGCTCCAGCAGG - Intergenic
966393468 3:179476798-179476820 GCCCTGGCTGTAACTCAAGCAGG - Intergenic
966712908 3:182987604-182987626 GCCACTGCTGAGGCACATGCTGG - Intergenic
967260249 3:187634750-187634772 GCTCCAGCTGTGGCTCAAAGGGG - Intergenic
968108314 3:196019910-196019932 GCCCCTGGTGTGTCACATGCCGG - Intergenic
968546766 4:1202888-1202910 GCCCCAGCCATGGCTCAGGCAGG - Intronic
968695866 4:2026187-2026209 GCCCCAGCTGTGGCTAAAATGGG - Intronic
969651544 4:8471127-8471149 GACCCTGCGGAGGCTGAAGCGGG + Exonic
970448565 4:16144688-16144710 TCCTCTGCTGCGGCTCCAGCCGG - Intergenic
970894251 4:21084071-21084093 GCTTCTGCTGTGGCTCCAGCAGG + Intronic
971319973 4:25597777-25597799 TCCTCTGCTGAGGCTCCAGCTGG + Intergenic
971480248 4:27108591-27108613 GCACCTGCTGGGGCCCACGCAGG - Intergenic
971546593 4:27894100-27894122 GCCCCAGCCTTGGCTCAAGCAGG - Intergenic
972615370 4:40693144-40693166 GAGTCTACTGTGGCTCAAGCTGG + Intergenic
972629021 4:40827555-40827577 GCCACTGCTGTGGCTGCCGCTGG - Intronic
973659159 4:53084633-53084655 TCCTCTGCTGTGGCTCCAGCTGG + Intronic
973799853 4:54466688-54466710 TCCTCTGCTGCGGCTCCAGCTGG - Intergenic
974198703 4:58611187-58611209 GCCCCAGCTGTGACTCATGTGGG + Intergenic
974605814 4:64148040-64148062 TCCTCTGCCGTGGCTCCAGCTGG + Intergenic
975736134 4:77382935-77382957 GCAACTGCTGTGGCTGAAGTGGG + Intronic
975954420 4:79820847-79820869 GCCTCAGCCATGGCTCAAGCAGG - Intergenic
976000795 4:80371162-80371184 GCTCCAGCTGTGGCTCAAAGGGG - Intronic
976741869 4:88364971-88364993 TCTTCTGCTGTGGCTCCAGCGGG + Intergenic
977630183 4:99234267-99234289 GCCGGTGCGGTGGCTCATGCCGG + Intergenic
977954550 4:103011727-103011749 ACACCAGCTGTGGCTCAAGCAGG - Intronic
978074607 4:104513129-104513151 GCCCCAGGTGTGGCTCACGGTGG + Intergenic
978267081 4:106839535-106839557 GCTCCAGCTGTGGCTCAAAGGGG - Intergenic
978591304 4:110327772-110327794 CGCCCTGCTTTGGCTCATGCTGG + Intergenic
980158103 4:129131044-129131066 TCCTCTGCCGTGGCTCCAGCCGG - Intergenic
980971562 4:139572236-139572258 GTCGCTGCTGTCGCTCAGGCTGG + Intronic
981516216 4:145612884-145612906 ACCCCAGCAGTGGTTCAAGCAGG + Intergenic
982513709 4:156317844-156317866 TCCTCTGCTGCGGCTCCAGCTGG + Intergenic
983015516 4:162607821-162607843 GCTCCAGCTGTGGCTCAAAGGGG + Intergenic
983075196 4:163317170-163317192 GCTCCAGCTGTGGCTCAAAGGGG - Intergenic
983303471 4:165956831-165956853 TCCTCTGCTGTGGCTCCAGCCGG + Intronic
983788077 4:171759457-171759479 GCCACTGCTGAGGCTCAAGTAGG + Intergenic
984102018 4:175498715-175498737 GCTCATGCTGTGGCAGAAGCTGG - Intergenic
985114986 4:186581794-186581816 TTCTCTGCTGTGGCTCCAGCTGG - Intergenic
985362441 4:189190026-189190048 TCCTCTGCTGTGGCTCCAGCTGG + Intergenic
988068209 5:26250753-26250775 ACTCCAGCTGTGGCTCAACCAGG - Intergenic
988078320 5:26382184-26382206 GCCCCAGTTATGGCTAAAGCAGG + Intergenic
989719265 5:44504904-44504926 GCCCCAGCTGTGGTTCAAGCAGG + Intergenic
990704514 5:58513444-58513466 TCCTCTGCTGTGGCTCCAACCGG - Intergenic
991137092 5:63194419-63194441 GAACCTGCTGTGGCTAAAGCAGG - Intergenic
991264045 5:64696039-64696061 TCCTCTGCTGTGGCTCCAGCCGG - Intronic
994688104 5:102982224-102982246 GGCCCCCCTGTGGCTCATGCAGG - Intronic
994875859 5:105419986-105420008 TCCTCTGCCGTGGCTCCAGCTGG + Intergenic
995187466 5:109287269-109287291 TCCTCTGCTGTGGCTCCAGCTGG + Intergenic
995199246 5:109409253-109409275 GCGACTGCTGCGGCTCGAGCGGG + Intronic
995277559 5:110294420-110294442 ACCCCAGCTGTAGCTCAAGTGGG + Intronic
996101705 5:119451486-119451508 TCCTCTGCTGCGGCTCTAGCAGG + Intergenic
997115671 5:131123255-131123277 TCCTCTGCCGTGGCTCCAGCCGG - Intergenic
999107536 5:149086940-149086962 GTCCCTGCTGTGTTTCAAGACGG - Intergenic
999259260 5:150227980-150228002 GCCCCTCCTGTGGTTGAAGATGG - Intronic
999499498 5:152132515-152132537 ACCCCAGCTGTGGCTCAAGTGGG - Intergenic
1001450472 5:171820689-171820711 GGACCTGCTGTTGCTCAATCTGG - Intergenic
1001456268 5:171862690-171862712 GCTGCTGCTGTGGCCCCAGCAGG - Exonic
1002476062 5:179466989-179467011 TCCACTGCTGTGGCCCAGGCTGG + Intergenic
1002762921 6:215720-215742 GCTTCTGCTGTGGCACAGGCTGG + Intergenic
1003923251 6:10853463-10853485 TCCTCTGCCGTGGCTCCAGCTGG - Intronic
1004695647 6:18030391-18030413 TCCACTCCTGTTGCTCAAGCTGG + Intergenic
1005950671 6:30628929-30628951 TCTCCTGCTGTTGCCCAAGCTGG + Intronic
1006241146 6:32679968-32679990 GCCGTTGCTGTGGCTCCAGTTGG - Intergenic
1007159292 6:39775679-39775701 GCCCTTGCTGAGGCAGAAGCAGG + Intergenic
1007223019 6:40293934-40293956 CCCACTGCTGTGGCTGAATCAGG - Intergenic
1007259947 6:40556331-40556353 GCCCCTGCTGTAGGGCAAGAGGG - Intronic
1009695261 6:67095574-67095596 CGCCCTGCTTTGGCTCACGCAGG - Intergenic
1010476961 6:76299502-76299524 TGCCCTGCTGTGGCTCATGCTGG + Intergenic
1010520320 6:76824362-76824384 TCCTCTGCCGTGGCTCCAGCTGG + Intergenic
1010776455 6:79891721-79891743 TCCTCTGCTGTGGCTCCAGCTGG + Intergenic
1010816663 6:80365833-80365855 TCCTCTGCTGTGGCTCCAGCCGG + Intergenic
1010837905 6:80612539-80612561 GCCACTGCTGAGGCTTGAGCAGG + Intergenic
1011455138 6:87540546-87540568 GCACCCTCTGTGGCTTAAGCTGG + Intronic
1011608501 6:89127825-89127847 TCCTCTGCTGCGGCTCCAGCCGG - Intergenic
1011680957 6:89782843-89782865 TCCTCTGCCGTGGCTCCAGCTGG - Intronic
1012168524 6:95989489-95989511 TCCTCTGCTGTGGCCCTAGCTGG - Intergenic
1012964406 6:105657699-105657721 GCTCCTGCTGTGGCTCAAGCAGG + Intergenic
1013500218 6:110742134-110742156 TCCTCTGCTGCGGCTCCAGCCGG - Intronic
1013970832 6:116016242-116016264 GCTCCAGCTGTGGCTAAAGGAGG + Intronic
1014022827 6:116610575-116610597 GCCCCTTCTGTTGCCCAGGCTGG + Intergenic
1014317936 6:119890712-119890734 GCCTCAGCTATGGCTCATGCAGG + Intergenic
1014450067 6:121572133-121572155 GCTCCAGCTGTGGCTCAAAGGGG + Intergenic
1015662336 6:135589391-135589413 GCTCCAGCTGTGGCTCAAAGAGG - Intergenic
1015811756 6:137167799-137167821 GCCTCTGGTGTGGTTGAAGCAGG - Intronic
1016295970 6:142574023-142574045 GCTCCAGCTGTGGCTAAAACGGG + Intergenic
1018043431 6:159945213-159945235 GTCCCAGCTGTGGCTCAAGCAGG + Intergenic
1018102209 6:160450759-160450781 TCCTCTGCTGTGGCTCCAGCTGG + Intronic
1019154236 6:170028659-170028681 GGCCCTGGAGTGGCACAAGCTGG - Intergenic
1019180490 6:170184540-170184562 GCCCCTCCTGTGGCTCCGGCGGG - Intergenic
1019727928 7:2613217-2613239 GACACTGCTGAGGCTGAAGCTGG + Exonic
1021176858 7:17459536-17459558 ACCTCTGCTGTGGCTCCAGCCGG + Intergenic
1021265812 7:18520867-18520889 GACCCAGCTATGGCTAAAGCAGG - Intronic
1022424334 7:30253667-30253689 GCCCCTGCTGTGTACCAGGCAGG - Intergenic
1022601902 7:31768823-31768845 GCCCAGGCTGTGGCCCAGGCTGG + Intronic
1023964154 7:44953346-44953368 ACCCCAGCTGTGGCTCAGGTGGG - Intergenic
1023988013 7:45109158-45109180 GCCCCTGCCATGGCTCCAGTTGG - Exonic
1024151023 7:46571418-46571440 GCCCCTGTTGTAGCTGAAGAGGG - Intergenic
1024667247 7:51559273-51559295 GCCACTGCTGGGACTGAAGCAGG - Intergenic
1025289321 7:57700029-57700051 GGTCCAGCTGTGTCTCAAGCAGG + Intergenic
1025819141 7:64946957-64946979 CCCCCTGCTGGGCCTCTAGCCGG + Intergenic
1026164361 7:67896821-67896843 GCACTATCTGTGGCTCAAGCAGG + Intergenic
1026164823 7:67900495-67900517 CCCATTGCTGTGGCCCAAGCAGG - Intergenic
1027789441 7:82620611-82620633 ACCCCAACTGTGGCTCAAGCAGG + Intergenic
1027859048 7:83552207-83552229 TCCTCTGCCGTGGCTCCAGCCGG - Intronic
1029310606 7:99660030-99660052 CGCCCTGCTTTGGCTCAGGCTGG + Intronic
1030533255 7:110736082-110736104 GCACCAGCTGTGGCTCAAGTAGG + Intronic
1032004660 7:128291370-128291392 TCCTTTGCTGTGGCTCCAGCCGG - Intergenic
1032053144 7:128662349-128662371 GCCCCAGCTGTGGCTGAAAGGGG + Intergenic
1033542277 7:142368001-142368023 GCTCCAGCTGTGGCTCAAAGGGG - Intergenic
1034055982 7:148035461-148035483 ACTCCAGCTGTGGCTCAAGTGGG + Intronic
1034335612 7:150321810-150321832 GTCCCAGCTGTAGCCCAAGCTGG + Intronic
1035167484 7:157000174-157000196 GCGCCAGGTGTGTCTCAAGCTGG - Intronic
1036576498 8:10032182-10032204 GCCCCAGGTGTGGCTCCAGTGGG - Intergenic
1036827416 8:11988001-11988023 GAACCAGCTGTGGCTAAAGCAGG - Intergenic
1037327040 8:17702857-17702879 TCCTCTGCCGTGGCTCCAGCCGG - Intronic
1037784850 8:21896467-21896489 GCCCCTGATGTGATTCAGGCAGG - Intergenic
1038928921 8:32171522-32171544 CTCCCTGCTTTGGCTCATGCTGG - Intronic
1039465004 8:37778760-37778782 GCTCCTGCTGTTGCTGAGGCTGG - Exonic
1040543875 8:48381932-48381954 TCACCGGCTGTGGCTCAGGCAGG - Intergenic
1040842609 8:51800592-51800614 TCCTCTGCCGTGGCTCCAGCTGG - Intronic
1040926351 8:52687947-52687969 TCCTCTGCTGTGGCTCCAGCTGG - Intronic
1041263590 8:56043018-56043040 GGTCTTGCTGTGGCTCAGGCTGG + Intergenic
1041300358 8:56405074-56405096 GCCCCAGCTGTGTCTCAAGCAGG + Intergenic
1041403813 8:57473909-57473931 CACCCAGCTGTGGCTCAAACAGG - Intergenic
1042169132 8:65975405-65975427 GCCCCAGTTGTGGTTTAAGCAGG + Intergenic
1042191440 8:66191632-66191654 TCCTCTGCTGTGGCTCCAGCTGG + Intergenic
1042428920 8:68681367-68681389 TCCTCTGCCGTGGCTCCAGCCGG + Intronic
1043946005 8:86253391-86253413 GCCTCAGCTGTGGCTCAAGTGGG - Intronic
1044443093 8:92243560-92243582 GCCCCAGCTGTGGCTGAAAGTGG - Intergenic
1044527960 8:93273516-93273538 GCCCCAGCCGTGGCTCCAACAGG - Intergenic
1044839205 8:96323533-96323555 GCCTTAGCTGTGGCTCAAGTGGG - Intronic
1044946728 8:97396524-97396546 GCCTCTGCTCTGGCTGAAGTAGG - Intergenic
1045115784 8:98978412-98978434 ACCCCAGCTGTGGCTCAAGCAGG - Intergenic
1046065711 8:109194772-109194794 GCCCCAGCTGTGGCTTAAAGGGG - Intergenic
1046253615 8:111666802-111666824 TCCTCTGCCGTGGCTCCAGCCGG + Intergenic
1046668863 8:117035863-117035885 GCTCCAGCTGTGGCTAAAGGGGG - Intronic
1047249137 8:123168511-123168533 GCCCCTTCTGTGGACCAAGTGGG - Intergenic
1048708597 8:137182911-137182933 GCCCCTTCTCTGGCTGAAGAAGG - Intergenic
1049214572 8:141401876-141401898 TCCCCCGCTGTGGCCCCAGCAGG + Intronic
1049490129 8:142893890-142893912 TATCCTGCTGTGGCTGAAGCTGG + Intronic
1049589299 8:143449007-143449029 GCTCCAGCTGTGGCTCAAAGGGG - Intronic
1051218868 9:14827848-14827870 ATCCCAGCTGTGGCTCAAGCAGG + Intronic
1053116785 9:35511331-35511353 TCCCCTGCTGTGGCTCCCACTGG + Intronic
1053369851 9:37551552-37551574 ACCCCACCTGTGGCTCAAGCAGG - Intronic
1053604207 9:39640444-39640466 GTCCCAGCTATGGCTCAAGCAGG - Intergenic
1053862025 9:42396495-42396517 GCCCCAGCTATGGCTCAAGCAGG - Intergenic
1054249333 9:62701970-62701992 GTCCCAGCTATGGCTCAAGCAGG + Intergenic
1054563444 9:66736502-66736524 GTCCCAGCTATGGCTCAAGCAGG + Intergenic
1054798553 9:69325123-69325145 GCCGCTGCCCTGGCTCCAGCCGG - Intronic
1055348728 9:75363128-75363150 TCCTCTGCCGTGGCTCCAGCCGG + Intergenic
1055525392 9:77128509-77128531 GCTCCTGCTGTGGCTCAAAGGGG - Intergenic
1055669992 9:78595138-78595160 GCCCCAGCTATGGCTCAAGTGGG + Intergenic
1056527335 9:87455520-87455542 GCTCCAGCTGTGGCTCAAAGGGG - Intergenic
1058137971 9:101328288-101328310 TCCTCTGCTGTGGTTCCAGCTGG + Intergenic
1058215193 9:102223752-102223774 CTCCCTGCTGTGGCTCGAGCAGG + Intergenic
1058542822 9:106029778-106029800 TCCTCTGCCGTGGCTCCAGCCGG - Intergenic
1059071424 9:111141426-111141448 GGTCTTGCTGTCGCTCAAGCTGG - Intergenic
1059231626 9:112726164-112726186 GCCCCAGCTGTAGCTCAAGTGGG - Intergenic
1059523220 9:114963505-114963527 TCCTCTGCTGCGGCTCTAGCCGG + Intergenic
1059785479 9:117578370-117578392 ATCCTAGCTGTGGCTCAAGCAGG + Intergenic
1060658725 9:125390075-125390097 TCTCCTACTGTTGCTCAAGCTGG + Intergenic
1060736578 9:126070131-126070153 GCCACTGATGAGGCTCAGGCAGG + Intergenic
1061660854 9:132129464-132129486 TCCACTGCTGTGGCTAGAGCTGG + Intergenic
1061932808 9:133841984-133842006 GGCCCTGCCATGGCTCAGGCAGG + Intronic
1062161364 9:135082040-135082062 GCCCCTGCCTGGGCTCCAGCTGG + Intronic
1062177482 9:135171942-135171964 GCCTCAGCAGTGGCTCAAGCAGG - Intergenic
1062238413 9:135523541-135523563 GCCCTGGCTGTGGCTCTGGCAGG + Intronic
1062512483 9:136914430-136914452 GGCCCTGCTGTGGCTCAAGATGG + Intronic
1062547772 9:137071293-137071315 GCCTCTGCTGTGTTTCCAGCTGG + Intergenic
1062567083 9:137168187-137168209 GGCCCCACTGTGGCTCAGGCTGG - Exonic
1203517782 Un_GL000213v1:19351-19373 TCCTCTGCTGCGGCTCCAGCCGG + Intergenic
1203611228 Un_KI270749v1:6925-6947 GGCCCAGCTGTGTCTCAAGCAGG - Intergenic
1187576498 X:20561969-20561991 GCCCTAGTTGTGACTCAAGCTGG + Intergenic
1187829153 X:23363338-23363360 GCCACTGCTGAGGCTTGAGCAGG - Intronic
1188105631 X:26144203-26144225 GCACCAGCTGTGGCTCAAAGGGG - Intergenic
1188115620 X:26238992-26239014 GCCCCAGCTGTAGCTAAAGGGGG - Intergenic
1189017669 X:37301263-37301285 GCCATTGCTGTGGCTTAAGTAGG - Intergenic
1189666244 X:43357815-43357837 ACCTCAGCTGTGGCTCAAGTGGG - Intergenic
1189890495 X:45597210-45597232 GCACCTGCTGTGGCCATAGCAGG - Intergenic
1189908809 X:45789104-45789126 GCCCCTGCTCTGGATCCAGCTGG + Intergenic
1190068909 X:47263211-47263233 TCTCCTTCTGTTGCTCAAGCTGG + Intergenic
1190621525 X:52291945-52291967 CACCCTGCTTTGGCTCAAGCTGG - Intergenic
1190710310 X:53063294-53063316 GCCCCTGCTGTGGCTCAAGCAGG - Intronic
1192174385 X:68876787-68876809 GCCCCTGCTGTAGCTCCACAAGG + Intergenic
1193272358 X:79544307-79544329 GCCCCAGCTGTAGTTCAAGCAGG - Intergenic
1193456931 X:81743325-81743347 CACCCTGCTTTGGCTCACGCAGG - Intergenic
1193623155 X:83782414-83782436 TCCTCTGCCGTGGCTCCAGCTGG - Intergenic
1194042221 X:88955822-88955844 TCCTCTGCTGCGGCTCCAGCTGG - Intergenic
1194064165 X:89241492-89241514 GCTCCAGCTGTGGCTCAAAGGGG + Intergenic
1194071048 X:89326895-89326917 TCCTCTGCTGTGGCTCTAGCCGG - Intergenic
1194190932 X:90836392-90836414 CGCCCTGCTTTGGCTCATGCAGG - Intergenic
1194334621 X:92629944-92629966 ACCCCATCTGTGGCTCAAGCAGG - Intergenic
1194377310 X:93151939-93151961 GCTCGTGCTGTGGCTCCAGAAGG - Intergenic
1194879538 X:99234775-99234797 CGCCCTGCTTTGGCTCACGCAGG - Intergenic
1195128865 X:101835868-101835890 TCCTCTGCCGTGGCTCCAGCTGG + Intronic
1195532300 X:105970378-105970400 GCCCCAGCTGGGGCTCAGGAGGG - Intergenic
1195805805 X:108763744-108763766 ACCCCAGCTGTGGCTCAAGCAGG - Intergenic
1196703133 X:118693234-118693256 TTCGCTGCTGTGGCCCAAGCTGG + Intergenic
1196970237 X:121100148-121100170 GCTCCAGCTGTGGCTCAAAGGGG - Intergenic
1197829204 X:130623706-130623728 CACCCTGCTGTGGCACCAGCAGG - Exonic
1197981258 X:132219437-132219459 TCCCCAGCTCTGGCTCCAGCTGG + Intronic
1198061146 X:133046142-133046164 TCCACTGCTGTGGATCAATCAGG + Intronic
1198304666 X:135368660-135368682 GCTCCAGCTGTGGCTAAAGGGGG - Intergenic
1198865787 X:141121445-141121467 GTCTCAGCTGTGGCTCAAGTGGG - Intergenic
1199656942 X:150005737-150005759 CCCCCGGCTGTGGCTCTAGGGGG + Intergenic
1200021342 X:153212589-153212611 TCCTCTGCCGTGGCTCCAGCTGG + Intergenic
1200643101 Y:5746998-5747020 ACCCCATCTGTGGCTCAAGCAGG - Intergenic
1200725277 Y:6662640-6662662 TCCTCTGCTGTGGCTCCAGCCGG - Intergenic
1201706594 Y:16944276-16944298 TCCTCTGCTGCGGCTCCAGCTGG + Intergenic
1201942633 Y:19476394-19476416 GCCCCAGCAATGGCTCAAGCTGG + Intergenic
1202071318 Y:20994411-20994433 GCCTCTGATGTGGCCCTAGCAGG - Intergenic