ID: 1190714834

View in Genome Browser
Species Human (GRCh38)
Location X:53094339-53094361
Sequence GCCCCACCCCTCGCGCGCTT CGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 85
Summary {0: 1, 1: 1, 2: 0, 3: 6, 4: 77}

Found 8 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1190714834_1190714843 24 Left 1190714834 X:53094339-53094361 CCGAAGCGCGCGAGGGGTGGGGC 0: 1
1: 1
2: 0
3: 6
4: 77
Right 1190714843 X:53094386-53094408 CCTCTCAACCCTAGGTCAGCGGG 0: 1
1: 0
2: 0
3: 11
4: 85
1190714834_1190714839 1 Left 1190714834 X:53094339-53094361 CCGAAGCGCGCGAGGGGTGGGGC 0: 1
1: 1
2: 0
3: 6
4: 77
Right 1190714839 X:53094363-53094385 TGCGCGAGCTTTTACTGGGGCGG 0: 1
1: 0
2: 0
3: 3
4: 21
1190714834_1190714841 23 Left 1190714834 X:53094339-53094361 CCGAAGCGCGCGAGGGGTGGGGC 0: 1
1: 1
2: 0
3: 6
4: 77
Right 1190714841 X:53094385-53094407 GCCTCTCAACCCTAGGTCAGCGG 0: 1
1: 0
2: 0
3: 2
4: 86
1190714834_1190714836 -3 Left 1190714834 X:53094339-53094361 CCGAAGCGCGCGAGGGGTGGGGC 0: 1
1: 1
2: 0
3: 6
4: 77
Right 1190714836 X:53094359-53094381 GGCCTGCGCGAGCTTTTACTGGG 0: 1
1: 0
2: 0
3: 1
4: 28
1190714834_1190714837 -2 Left 1190714834 X:53094339-53094361 CCGAAGCGCGCGAGGGGTGGGGC 0: 1
1: 1
2: 0
3: 6
4: 77
Right 1190714837 X:53094360-53094382 GCCTGCGCGAGCTTTTACTGGGG 0: 1
1: 0
2: 0
3: 4
4: 47
1190714834_1190714844 30 Left 1190714834 X:53094339-53094361 CCGAAGCGCGCGAGGGGTGGGGC 0: 1
1: 1
2: 0
3: 6
4: 77
Right 1190714844 X:53094392-53094414 AACCCTAGGTCAGCGGGTTGCGG 0: 1
1: 0
2: 0
3: 13
4: 72
1190714834_1190714840 16 Left 1190714834 X:53094339-53094361 CCGAAGCGCGCGAGGGGTGGGGC 0: 1
1: 1
2: 0
3: 6
4: 77
Right 1190714840 X:53094378-53094400 TGGGGCGGCCTCTCAACCCTAGG 0: 1
1: 0
2: 0
3: 12
4: 119
1190714834_1190714835 -4 Left 1190714834 X:53094339-53094361 CCGAAGCGCGCGAGGGGTGGGGC 0: 1
1: 1
2: 0
3: 6
4: 77
Right 1190714835 X:53094358-53094380 GGGCCTGCGCGAGCTTTTACTGG 0: 1
1: 0
2: 0
3: 1
4: 26

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1190714834 Original CRISPR GCCCCACCCCTCGCGCGCTT CGG (reversed) Intergenic