ID: 1190719995

View in Genome Browser
Species Human (GRCh38)
Location X:53139836-53139858
Sequence CAAAAGAAGGAGGAGGAGGC AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 2174
Summary {0: 1, 1: 0, 2: 28, 3: 284, 4: 1861}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1190719987_1190719995 29 Left 1190719987 X:53139784-53139806 CCACTGCACTGCAGCCTGGGTGA 0: 1935
1: 88978
2: 178105
3: 206642
4: 177140
Right 1190719995 X:53139836-53139858 CAAAAGAAGGAGGAGGAGGCAGG 0: 1
1: 0
2: 28
3: 284
4: 1861
1190719990_1190719995 -4 Left 1190719990 X:53139817-53139839 CCTGTTTTTAAAAACAAAACAAA 0: 3
1: 20
2: 226
3: 1987
4: 11310
Right 1190719995 X:53139836-53139858 CAAAAGAAGGAGGAGGAGGCAGG 0: 1
1: 0
2: 28
3: 284
4: 1861
1190719988_1190719995 15 Left 1190719988 X:53139798-53139820 CCTGGGTGACAAGCAAGACCCTG 0: 8
1: 31
2: 154
3: 439
4: 1138
Right 1190719995 X:53139836-53139858 CAAAAGAAGGAGGAGGAGGCAGG 0: 1
1: 0
2: 28
3: 284
4: 1861
1190719989_1190719995 -3 Left 1190719989 X:53139816-53139838 CCCTGTTTTTAAAAACAAAACAA 0: 2
1: 21
2: 202
3: 1813
4: 9940
Right 1190719995 X:53139836-53139858 CAAAAGAAGGAGGAGGAGGCAGG 0: 1
1: 0
2: 28
3: 284
4: 1861

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1190719995 Original CRISPR CAAAAGAAGGAGGAGGAGGC AGG Intergenic
Too many off-targets to display for this crispr