ID: 1190722071

View in Genome Browser
Species Human (GRCh38)
Location X:53157473-53157495
Sequence CTTGACACACTCTGCAATCT TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 177
Summary {0: 1, 1: 0, 2: 2, 3: 9, 4: 165}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1190722069_1190722071 -1 Left 1190722069 X:53157451-53157473 CCATTAAGAAAGTGTATTTTTCC 0: 1
1: 0
2: 5
3: 51
4: 442
Right 1190722071 X:53157473-53157495 CTTGACACACTCTGCAATCTTGG 0: 1
1: 0
2: 2
3: 9
4: 165

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1190722071 Original CRISPR CTTGACACACTCTGCAATCT TGG Intergenic
901389194 1:8932248-8932270 CTTGGCTCACTGTGCCATCTTGG + Intergenic
905230356 1:36511344-36511366 CTTGACATTCTCTGCCACCTGGG - Intergenic
911571701 1:99525278-99525300 CTTGCTACACTCTGCATTTTTGG + Intergenic
912068659 1:105779668-105779690 CTTTACATCCTCTGAAATCTAGG - Intergenic
913368518 1:118069848-118069870 CATGAAACACTCTGCACTCTTGG - Intronic
913429656 1:118776659-118776681 CTTGACACACTCATAAGTCTGGG - Intergenic
914932118 1:151944307-151944329 TTTGCCACACACTTCAATCTTGG - Intergenic
918451738 1:184665052-184665074 ATTGACCCACTCTGCAACCTCGG + Intergenic
923546950 1:234930164-234930186 TTTGACAGACTTTGCATTCTAGG + Intergenic
923656298 1:235920231-235920253 CTTGGCACACTCAGCAGTCTAGG - Intergenic
924099127 1:240585405-240585427 CTTAACACAGACTGCAGTCTCGG + Intronic
924423559 1:243931242-243931264 CTTCCCACACTCTCCAGTCTGGG - Intergenic
1064046447 10:12020793-12020815 ATTTGCACATTCTGCAATCTTGG - Intronic
1066166181 10:32790297-32790319 CATGACATTCTCTGAAATCTAGG + Intronic
1071289634 10:84179514-84179536 CCTGGCACACTCAGCAATCCTGG - Intronic
1071591168 10:86874773-86874795 AGTGGCACAATCTGCAATCTTGG + Intronic
1073842619 10:107515242-107515264 CTTGAGACACTCTGGAAAGTGGG + Intergenic
1075190797 10:120306579-120306601 TTTGAGAGACTCTGAAATCTGGG + Intergenic
1075988979 10:126816644-126816666 CTTGATTGACTCTGCCATCTAGG - Intergenic
1078938446 11:15973831-15973853 CTTGCCACCCTCTGGGATCTAGG - Intronic
1079062360 11:17260436-17260458 CTTCCCACTCACTGCAATCTTGG - Intronic
1079873524 11:25829621-25829643 CTTGACATCCTTTGAAATCTAGG + Intergenic
1083827477 11:65211681-65211703 CTCGACACAGTCTGCAGTCCAGG + Exonic
1087139758 11:94753841-94753863 CTTGCCACACACTGCAAGCTAGG + Intronic
1089167873 11:116491118-116491140 TTTAATACACTCTGCAAACTAGG + Intergenic
1090360364 11:126168078-126168100 CTTGACACACAATGGATTCTGGG - Intergenic
1096115659 12:49053483-49053505 CTTGGCACACTTTGCATTCAGGG + Exonic
1097107365 12:56633645-56633667 CTTCACCCCCTCTACAATCTGGG + Intronic
1097434232 12:59540246-59540268 GTATACACACTCTGCAATATTGG - Intergenic
1101528013 12:105549226-105549248 AATGACACACTATGCAATCAGGG - Intergenic
1104414758 12:128589071-128589093 CCTGACACACCCTGCAATCTGGG - Intronic
1107817469 13:44256744-44256766 TCTGACACTCTCTGGAATCTTGG + Intergenic
1109346937 13:61125845-61125867 CCAAACACCCTCTGCAATCTAGG + Intergenic
1111898214 13:94168274-94168296 CTTATCACTCTCTGCTATCTCGG + Intronic
1112400460 13:99073047-99073069 GGTGAGACACTCTGCAACCTTGG - Intronic
1118239089 14:64038445-64038467 CTTGGCAGAGGCTGCAATCTTGG + Intronic
1121578238 14:95006522-95006544 CTTAACTCACTCTGCAACCCTGG + Intergenic
1124991390 15:34677437-34677459 CTTGAGACACTCTTTGATCTTGG - Intergenic
1125424903 15:39538885-39538907 ATTTCCACACTCTTCAATCTAGG - Intergenic
1126490648 15:49232137-49232159 CTACACATACTCTGAAATCTAGG + Intronic
1126789798 15:52210639-52210661 CTTGGCGCATTCTGGAATCTTGG - Intronic
1126974693 15:54162349-54162371 CTTGTGACACTATGCAATCATGG + Intronic
1127139251 15:55957471-55957493 ATAGACACTCTCTGCAAACTAGG - Intronic
1129766297 15:78170990-78171012 CCTGACTTACTCTGGAATCTTGG - Exonic
1130439165 15:83933921-83933943 CTGGACATCCTCTGAAATCTAGG - Intronic
1132920425 16:2387004-2387026 CTTGAAACACTCTTCTCTCTTGG + Intergenic
1133556239 16:6908745-6908767 ATTGACTCACTGTGCAATCTGGG + Intronic
1136187371 16:28596217-28596239 CTTCACACACCCTGACATCTGGG - Exonic
1136189850 16:28609142-28609164 CTTCACACACCCTGACATCTGGG - Intronic
1136317099 16:29460774-29460796 CTTCACACACCCTGATATCTGGG + Intronic
1136431674 16:30200116-30200138 CTTCACACACCCTGATATCTGGG + Intronic
1136919139 16:34246469-34246491 CTTGGCAGAGGCTGCAATCTTGG + Intergenic
1139142164 16:64279648-64279670 CTTGAGACCCTTTTCAATCTGGG + Intergenic
1139243466 16:65418114-65418136 CCTTACTAACTCTGCAATCTTGG + Intergenic
1140124593 16:72108883-72108905 CGTGATACACTATGTAATCTGGG - Exonic
1140727327 16:77825241-77825263 CATGACACGGTCTCCAATCTGGG - Exonic
1144803454 17:17948262-17948284 CTTGACACTCTCTCCAAGGTAGG - Intronic
1148403307 17:47386828-47386850 CTTGAGAGACTGTGCTATCTGGG - Intronic
1150209729 17:63435442-63435464 CTTGGCACACTCAGAAAGCTGGG + Intronic
1150495765 17:65606864-65606886 ATTGACTAACTCTGCAACCTTGG - Intronic
1150646051 17:66978125-66978147 CCTGACTCACTCTGGGATCTGGG - Intronic
1151379478 17:73715557-73715579 CTTACCTCACTGTGCAATCTGGG - Intergenic
1154383974 18:13877016-13877038 GCTGACACACTCTGCAACGTGGG - Intergenic
1158650961 18:59285360-59285382 CTTGACAAAGTCTGCAAAATAGG - Intronic
1161864336 19:6822420-6822442 CTTGTCATACTCTGTCATCTTGG - Exonic
1163707937 19:18827281-18827303 TCTGACACACTCTGCATTTTAGG + Intergenic
1167704714 19:51074057-51074079 CATGAAAGACCCTGCAATCTTGG + Intergenic
925258037 2:2506688-2506710 TTGGACACACACTGCCATCTTGG - Intergenic
926066841 2:9847566-9847588 CCAGACACGCTCTGCAATCTGGG + Intronic
928352572 2:30573576-30573598 CTCAGCACACTGTGCAATCTGGG - Intronic
929627563 2:43425131-43425153 CTTGACAAGCCCTGCACTCTTGG + Intronic
929627618 2:43425871-43425893 CTTGACAAGCCCTGCACTCTTGG - Intronic
930940926 2:57013618-57013640 CCTTACATACTCTGAAATCTAGG - Intergenic
931298467 2:60953495-60953517 CCTGACACATGCTGCAAGCTGGG - Intronic
931945456 2:67301481-67301503 TTTGACAGACTCTGCAAAGTTGG + Intergenic
937922049 2:127137714-127137736 CTTGTCACACCCTGCCATCTAGG - Intergenic
939082243 2:137676068-137676090 CCTGACACACTCTGGCATCTTGG + Intronic
939092055 2:137791093-137791115 CTATACATCCTCTGCAATCTAGG + Intergenic
939527375 2:143313813-143313835 CTTGATGAACTCTGCTATCTGGG - Intronic
940837024 2:158533574-158533596 ATGCACACACTCTGCAATGTGGG - Intronic
940874835 2:158888104-158888126 GTTTACACACTCTGCGATATTGG + Intergenic
941020330 2:160401500-160401522 CTTAACACATTCTAAAATCTTGG - Intronic
948193013 2:236074401-236074423 CTGTGCACACTCTGCACTCTGGG + Intronic
1169268724 20:4183032-4183054 CTTGACACACTCAGAATTATGGG + Intronic
1169693582 20:8361155-8361177 CTTGACACAGTCTGGCCTCTAGG + Intronic
1169783537 20:9334191-9334213 CTTGAAACACTCTCCAATCCTGG - Intronic
1172343144 20:34175241-34175263 CTTTTCACTCTCTCCAATCTCGG + Intergenic
1177223006 21:18218248-18218270 CTGGACATCCTCTGAAATCTAGG + Intronic
1180723218 22:17924956-17924978 CCTAACACACCCTGCAAACTGGG + Intronic
952147636 3:30550508-30550530 GGTGAGACACTCTGCAACCTAGG - Intergenic
959759898 3:109948662-109948684 CTTTACAAACTTTGCAATTTCGG - Intergenic
960145250 3:114193951-114193973 CATTACACATTCTGCACTCTTGG + Intronic
960583146 3:119297385-119297407 CTTGTCACCCTCAGCATTCTGGG - Intronic
961833302 3:129636248-129636270 CTTGACATACTCTACAACATGGG + Intergenic
962325380 3:134427986-134428008 CTTCACACACCCTGTAGTCTGGG + Intergenic
962339492 3:134569865-134569887 CTATACACCCTCTGAAATCTAGG + Intronic
966933426 3:184690539-184690561 CTTGACACCCTCTGTCACCTGGG + Intergenic
967751677 3:193122593-193122615 CCTGACACATTCTGTAAACTGGG - Intergenic
979428797 4:120601514-120601536 CTTTACACATTCTGGAATATTGG + Intergenic
979451337 4:120874796-120874818 ATAGACAAAATCTGCAATCTGGG - Intronic
980671095 4:136008452-136008474 CTTGACCCCCTCTGGACTCTGGG + Intergenic
980883111 4:138733348-138733370 CTTGACAGCCTCTGCCAACTAGG - Intergenic
983719825 4:170836612-170836634 CTTGAAATACTCTTTAATCTAGG - Intergenic
987541435 5:19261143-19261165 CCATACACACTCTGAAATCTAGG - Intergenic
988087233 5:26487652-26487674 AGTGAAACACTCTGCAAACTTGG - Intergenic
989731340 5:44653926-44653948 CTATACATACTCTGAAATCTGGG + Intergenic
991977259 5:72195634-72195656 CTTGACAGACTCTTCCTTCTTGG - Exonic
994562271 5:101390205-101390227 CATGACAGAATCTACAATCTAGG - Intergenic
996086282 5:119308784-119308806 CTTGGCTCACTCTGCCACCTGGG - Intronic
996807289 5:127470192-127470214 CTTGACAGGCTCTGAAATGTTGG + Intergenic
997024635 5:130044272-130044294 CTTGAAACACTCCGCTCTCTTGG - Intronic
1001723397 5:173875425-173875447 CTTTACACAGCCTGCACTCTAGG - Intergenic
1001779347 5:174354444-174354466 CTTGACACAGTCAGAACTCTAGG + Intergenic
1004770073 6:18771450-18771472 CTTGGCAATCTCGGCAATCTCGG - Intergenic
1007407469 6:41643291-41643313 CTTGACACACTCAGCCATCTGGG + Intronic
1009046498 6:58242053-58242075 GTTTACACTCTCTGCGATCTTGG - Intergenic
1009222312 6:60996369-60996391 GTTTACACTCTCTGCGATCTTGG - Intergenic
1009460487 6:63907027-63907049 GTGTACACACTATGCAATCTTGG - Intronic
1013709672 6:112881942-112881964 CTTGAGACACTGTACAATATTGG + Intergenic
1013818251 6:114124316-114124338 CTTGGCACACCCTGCATTCCAGG - Intronic
1015827728 6:137332937-137332959 CTTCACACACTCCACAATGTTGG + Intergenic
1016101827 6:140111987-140112009 CTTTACTAACTTTGCAATCTTGG + Intergenic
1016583264 6:145653623-145653645 CTTGTCAGACTCTGTAATCATGG - Intronic
1023317228 7:38951939-38951961 CTTGACACACATTTGAATCTTGG - Intergenic
1023638368 7:42236160-42236182 CTTCACAAACTCTGCAAGTTTGG + Intronic
1023795057 7:43784991-43785013 CCTGACACACTGTGCAAGCCAGG + Intronic
1026768225 7:73173906-73173928 CCTGACCCCCTCTGCAAGCTTGG + Intergenic
1027044689 7:74983614-74983636 CCTGACCCCCTCTGCAAGCTTGG + Intronic
1027078949 7:75218745-75218767 CCTGACCCCCTCTGCAAGCTTGG - Intergenic
1029388166 7:100257305-100257327 CCTGACCCCCTCTGCAAACTTGG - Intronic
1029932449 7:104386793-104386815 CTTGAAATAATCTGCATTCTAGG - Intronic
1030151274 7:106407686-106407708 CTTTACACGATCTGCAGTCTTGG - Intergenic
1030288194 7:107847821-107847843 CTAGACTCCCTCTGCAATCCCGG - Intergenic
1032700154 7:134372252-134372274 CATGCTACACTCTGCATTCTCGG + Intergenic
1035673311 8:1436650-1436672 CTCTACACACACTGCAAACTTGG - Intergenic
1037321625 8:17648895-17648917 CTTGCCAAACTCTGCCAACTTGG + Intronic
1037975083 8:23203456-23203478 CTGGAGACCCTCTGCAATCCAGG - Intronic
1038637841 8:29301777-29301799 CTGTACACCCTCTGCAATATTGG + Intergenic
1039106238 8:33993016-33993038 CCCAACACACTCTGCAATATTGG - Intergenic
1039417495 8:37408301-37408323 CCTGACACACTCTTCTTTCTAGG - Intergenic
1040661737 8:49582833-49582855 CTTGAGCCTCTCTGCACTCTTGG + Intergenic
1042734565 8:71973825-71973847 AATGACACACTCTGCCAACTAGG + Intronic
1043749869 8:83921921-83921943 CTGGACATTCTCTGAAATCTAGG + Intergenic
1043750366 8:83926649-83926671 CTTGACTCCCTCTGGAATTTGGG - Intergenic
1043958636 8:86390298-86390320 CTGGGCACAGGCTGCAATCTCGG + Intronic
1045926907 8:107585540-107585562 GTTTACACACTCTGCGATATTGG + Intergenic
1046012205 8:108562898-108562920 CTAGACTCACTCTGTAGTCTGGG - Intergenic
1046191031 8:110794065-110794087 CTGGACGCACTCTGGAATCAAGG - Intergenic
1046803100 8:118450335-118450357 CTTGACAGGCTGTGCATTCTGGG - Intronic
1048404588 8:134106899-134106921 CTATACACCCTCTGAAATCTAGG - Intergenic
1049956930 9:702144-702166 GTTTGCACACTCTGCAATTTGGG - Intronic
1050974184 9:11915772-11915794 CTTGCCACACTGTGCAGTCAAGG - Intergenic
1058468971 9:105257530-105257552 CTAGACACAGTTTACAATCTGGG - Intronic
1062173502 9:135148295-135148317 CTGGACACAACCTGCAAACTGGG + Intergenic
1185619212 X:1443074-1443096 GTGGACACACACTGCCATCTGGG + Intronic
1185619229 X:1443188-1443210 GTGGACACACACTGCCATCTGGG + Intronic
1185619304 X:1443689-1443711 GTGGACACACACTGCCATCTTGG + Intronic
1185619314 X:1443752-1443774 GTGGACACACACTGCCATCTTGG + Intronic
1185619870 X:1447270-1447292 TTCGACACACACTGCCATCTTGG + Intronic
1185619889 X:1447400-1447422 TTGGACACACACTGCCATCTTGG + Intronic
1185620008 X:1448223-1448245 TTGGACACACACTGCCATCTTGG + Intronic
1185620045 X:1448476-1448498 TTGGACACACACTGCCATCTTGG + Intronic
1185620053 X:1448533-1448555 TTGGACACACACTGCCATCTTGG + Intronic
1185620074 X:1448679-1448701 TTGGACACACACTGCCATCTTGG + Intronic
1187140472 X:16588312-16588334 GATGGGACACTCTGCAATCTTGG + Exonic
1190722071 X:53157473-53157495 CTTGACACACTCTGCAATCTTGG + Intergenic
1190772524 X:53527159-53527181 CTATACACTCTCTGAAATCTAGG - Intergenic
1192140973 X:68647170-68647192 CTTGACTCACTGTGGCATCTCGG - Intergenic
1192847841 X:74924653-74924675 CCTGACAGGCACTGCAATCTAGG - Intronic
1194144381 X:90244914-90244936 CCATACACACTCTGAAATCTAGG + Intergenic
1194330951 X:92582502-92582524 CCATACACACTCTGAAATCTAGG - Intronic
1195649534 X:107270689-107270711 ATTTAAACACTCAGCAATCTAGG + Intergenic
1197532876 X:127652129-127652151 CTTGACAATCTCTCCTATCTTGG - Intergenic
1198087487 X:133294498-133294520 GTTGACAAACTGTGCAATGTGGG + Intergenic
1200490141 Y:3814218-3814240 CCATACACACTCTGAAATCTAGG + Intergenic
1200639654 Y:5701568-5701590 CCATACACACTCTGAAATCTAGG - Intronic
1201510062 Y:14749296-14749318 CTGGACACACTGTGCAGCCTGGG + Intronic