ID: 1190726408

View in Genome Browser
Species Human (GRCh38)
Location X:53193291-53193313
Sequence ACGGGAGTCGGGCTCGGGGC CGG (reversed)
Strand -
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 774
Summary {0: 1, 1: 0, 2: 4, 3: 294, 4: 475}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1190726408_1190726419 25 Left 1190726408 X:53193291-53193313 CCGGCCCCGAGCCCGACTCCCGT 0: 1
1: 0
2: 4
3: 294
4: 475
Right 1190726419 X:53193339-53193361 TTACAGACAGGCAGAAAGACAGG 0: 1
1: 0
2: 2
3: 40
4: 541
1190726408_1190726417 13 Left 1190726408 X:53193291-53193313 CCGGCCCCGAGCCCGACTCCCGT 0: 1
1: 0
2: 4
3: 294
4: 475
Right 1190726417 X:53193327-53193349 CTCCAGCTGTGATTACAGACAGG 0: 1
1: 0
2: 2
3: 21
4: 171

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1190726408 Original CRISPR ACGGGAGTCGGGCTCGGGGC CGG (reversed) Exonic
900171863 1:1273339-1273361 ACGGGAGTCTGTGTCGGGGGAGG - Intronic
900201623 1:1410203-1410225 ACGGGTGTCGGGCTGGGGGACGG - Intergenic
900234435 1:1580739-1580761 ACGGGTGTCGGGCTGGGGGACGG - Intergenic
900243220 1:1626514-1626536 CCTGGGGTCGGGGTCGGGGCCGG + Intronic
900382348 1:2391244-2391266 GCGGGAGGAGGGCTCGGGGAAGG + Intronic
900587855 1:3442065-3442087 ATGGCAGGCAGGCTCGGGGCTGG - Intergenic
900678179 1:3901238-3901260 TCCGGCGTCGGGCTGGGGGCCGG + Intergenic
901398841 1:9002218-9002240 ACGGGTGTCGGGCTGGGGGACGG - Intergenic
901601583 1:10427058-10427080 ACGGGTGTCGGGCTGGGGGACGG - Intergenic
901930965 1:12595869-12595891 AGGGGAGCCGGGCTGGGGGCCGG + Intronic
901978345 1:13013026-13013048 ACGGGTGTCGGGCTTGGGGACGG + Intronic
901991000 1:13113915-13113937 ACGGGAGTTGGGCTGGGGGATGG - Intergenic
902003739 1:13215912-13215934 ACGGGTGTCAGGCTTGGGGACGG - Intergenic
902022963 1:13361656-13361678 ACGGGTGTCGGGCTTGGGGACGG - Intergenic
902248215 1:15135877-15135899 ATGGGTGTCGGGCTGGGGGACGG + Intergenic
902281724 1:15379566-15379588 ACGGGTGTCTGGCTGGGGGACGG + Intronic
902289236 1:15426025-15426047 AGGGGAGTGGGGCTGGGGGCCGG - Intronic
902839761 1:19067416-19067438 CTGGGAGCCGTGCTCGGGGCTGG - Intergenic
904269261 1:29338628-29338650 ACGGGTGTCGGGCTGGGGGATGG + Intergenic
904272522 1:29359722-29359744 ACGGGTGTCGGGCTGGGGGACGG - Intergenic
906102196 1:43270870-43270892 ACGGGTGTCAGGCTGGGGGCGGG - Intronic
906404176 1:45528497-45528519 ACGGGTGTCGGGCTGGGGGACGG - Intergenic
906423018 1:45686733-45686755 AAGGGAGCCGGGGGCGGGGCAGG - Intronic
906498215 1:46320688-46320710 ACGGGTGTCGGGCTGGGGGATGG - Intergenic
906499338 1:46329940-46329962 ACGGGTGTCGGGCTGGGGGATGG - Intergenic
906564485 1:46788947-46788969 ACAGGTGTCGGGCTGGGGGATGG - Intronic
907120824 1:52006640-52006662 ACGGGTGTCGGGCTGGGGGACGG - Intergenic
907465908 1:54636665-54636687 ATGGGTGTCGGGCTGGGGGATGG + Exonic
908022682 1:59914766-59914788 ACGGGTGTCAGGCTGGGGGTCGG - Intronic
908024738 1:59938734-59938756 ACGGGTGTCAGGCTGGGGGACGG + Intergenic
908238762 1:62171555-62171577 ACGAGTGTCGGGCTGGGGGATGG + Intergenic
908660022 1:66425364-66425386 ACGGATGTCGGGCTGGGGGACGG + Intergenic
909023805 1:70460980-70461002 ACGGGTGTCGGGCTGGGGGATGG + Intergenic
909234111 1:73129846-73129868 ACGGGTGTCGGGCTGGGGGACGG + Intergenic
909413188 1:75377482-75377504 ACGGGTGTCGGGCTGGGGGATGG - Intronic
909413839 1:75382887-75382909 ACGGGTGTCGGGCTGGGGGATGG - Intronic
909450938 1:75797197-75797219 CCGGGAGTTTGGCGCGGGGCAGG - Exonic
909475053 1:76073104-76073126 ACGGGTGTCGGGCTGGGGGACGG + Intergenic
909651785 1:77983419-77983441 ACGGGTGTCGGGCTTGGGGGCGG + Intronic
910604379 1:89067412-89067434 ACGGGTGTCGGGCTGGGGGACGG + Intergenic
910935910 1:92484589-92484611 GCGGGGGTCGGGCCCGGGCCCGG + Intronic
911010652 1:93277331-93277353 ACGGGTGTCGGGCTGGGGGACGG + Intronic
911595464 1:99794135-99794157 ACGGGTGTCGGGCTGGGGGATGG + Intergenic
911599875 1:99836353-99836375 ACAGGTGTCGGGCTGGGGGATGG + Intergenic
911947844 1:104135293-104135315 ACCGGTGTCGGGCTGGGGGACGG + Intergenic
912450894 1:109767015-109767037 ACGGGCGTCGGGCTGAGGGATGG - Intronic
912642435 1:111360270-111360292 ACGGGTGTCAGGCTGGGGGACGG + Intergenic
913047855 1:115089302-115089324 CCGGGTGGCGGGCGCGGGGCCGG - Intronic
914097482 1:144556073-144556095 ACGGGTGTCGGGCTGGGAGACGG + Intergenic
914252449 1:145932829-145932851 ACGGGTGTCGGGCTGGGGGACGG - Intergenic
914301512 1:146381545-146381567 ACGGGTGTCGGGCTGGGAGACGG - Intergenic
914441325 1:147709985-147710007 ATGGGTGTCGGGCTGGGGGACGG + Intergenic
914444051 1:147734390-147734412 ACGGGTGTCAGGCTGGGGGACGG + Intergenic
914495129 1:148189229-148189251 ACGGGTGTCGGGCTGGGTGACGG - Intergenic
914755749 1:150560847-150560869 CAGGGAGTGGGGCTAGGGGCTGG - Exonic
914765599 1:150635309-150635331 ACGGGTGTTGGGCTGGGGGACGG - Intergenic
914773126 1:150709613-150709635 ATGGGTGTCGGGCTGGGGGACGG - Intronic
914924525 1:151872901-151872923 GCGGGTGTCGGGCTGGGGGATGG - Intergenic
914985744 1:152455662-152455684 ACGGGTGTTGGGCTGGGGGATGG + Intergenic
915397936 1:155600086-155600108 ACGGGTGTCGGGCTGGGGAACGG + Intergenic
915401801 1:155627215-155627237 ACGGGTGTCGGGCTGGGGGACGG + Intergenic
915480237 1:156179619-156179641 ACGGGTGTCGGGCTGGGGGACGG - Intergenic
915480568 1:156181857-156181879 ACGGGTGTCAGGCTGGGGGACGG - Intergenic
915890412 1:159768192-159768214 ACGGGTGTCGGGCTGGGGGATGG - Intergenic
916009390 1:160691182-160691204 ACGGGTGTCGGGCTGGGGGACGG - Intronic
916039149 1:160947477-160947499 ACGGGTGTCAGGCTGGGGGATGG + Intronic
916468149 1:165092980-165093002 ATGGGTGTCGGGCTGGGGGATGG - Intergenic
918003431 1:180519914-180519936 ACAGGAGCAGGGCTCAGGGCTGG + Intergenic
919484519 1:198130262-198130284 ACGGGTGACGGGCTGGGGGACGG + Intergenic
920629272 1:207635660-207635682 ACGGGTGTCAGGCTGGGGGAAGG + Intronic
920796383 1:209141579-209141601 ACGGGTGTCGGGCTGGGGGACGG - Intergenic
922084380 1:222332184-222332206 ATGGGAGTGGGGCCGGGGGCTGG - Intergenic
922305414 1:224340227-224340249 ACGGGTGTCGGGCTGGGGGACGG - Intergenic
922484896 1:225966256-225966278 ATGGGTGTCGGGCTGGGGGATGG - Intergenic
922715521 1:227868889-227868911 ATGGGTGTCGGGCTGGGGGACGG + Intergenic
923562376 1:235051022-235051044 CCAGGAGTGGGGCTTGGGGCAGG - Intergenic
924666966 1:246083081-246083103 ACGGGTGTCGGGCTGGGGGACGG - Intronic
924764174 1:247016332-247016354 ACGGGTGTCGGGCTGGGGGACGG + Intergenic
924953655 1:248907477-248907499 ACGGGTGTCGGGCTGGGGGACGG + Intronic
1063097681 10:2922593-2922615 ACGCGAGGCGAGCCCGGGGCTGG + Intergenic
1063114134 10:3061884-3061906 ACGGGTGTCGGGCTGGGGGACGG - Intergenic
1064834469 10:19510345-19510367 ACAGGTGTCGGGCTGGGGGATGG + Intronic
1065024524 10:21527277-21527299 GCGGGGGCCGGGCGCGGGGCCGG + Intergenic
1065453399 10:25881680-25881702 ACGGGTGTCAGGCTGGGGGACGG + Intergenic
1065500549 10:26377434-26377456 ACGGGTGTCGGGCTGGGGGATGG + Intergenic
1065553744 10:26893866-26893888 ACGGGTGTCGGGCTGGGGGACGG - Intergenic
1066927264 10:41713582-41713604 ACGGGTGTCAGGCTGGGGGACGG - Intergenic
1067090991 10:43265871-43265893 ACAGGAGTCAGGCTGGGTGCAGG - Intronic
1069879538 10:71583236-71583258 AGGGGAGGCGGGGTGGGGGCGGG + Intronic
1070998312 10:80806308-80806330 ACGGGTGTCTGGCTGGGGGACGG - Intergenic
1071396820 10:85232218-85232240 AGGGGAGTGGGGCCCTGGGCTGG + Intergenic
1072541768 10:96403666-96403688 ACGGGTGTCGGGCTGGGGGACGG - Intronic
1072669278 10:97417380-97417402 ACGGGTGTCGGGCTGGGGGACGG + Intronic
1072708572 10:97700244-97700266 ACGGGTGTCAGGCTGGGGGACGG - Intergenic
1072947297 10:99821386-99821408 ACGGGTGTCGGGCTGGGGGACGG + Intronic
1073196202 10:101694332-101694354 ACGCGGGGCCGGCTCGGGGCGGG + Intronic
1073286360 10:102391842-102391864 ACGGGTGTCGGGCTGGGGGACGG - Intergenic
1073298340 10:102454919-102454941 ACGGGTGTCGGGCTGGGGGACGG + Intergenic
1074867174 10:117551756-117551778 CTGGGAGTGGGGCGCGGGGCAGG + Intergenic
1075718411 10:124570346-124570368 ATGTGAGTCGGGCACTGGGCTGG + Intronic
1075890051 10:125940658-125940680 ACAGGTGTCGGGCTGGGGGATGG + Intronic
1076356625 10:129858065-129858087 ACGGGGCTCGGGCACGTGGCAGG + Intronic
1076459239 10:130628349-130628371 ACGGGTGTCGGGCTGGGGGACGG - Intergenic
1076932449 10:133541605-133541627 ATGGGTGTCGGGCTGGGGGATGG + Intronic
1076980527 11:202098-202120 ACGGTTGTCGGGCTGGGGGACGG - Intronic
1077103779 11:833238-833260 GCGGGAGGCGGACTCCGGGCGGG + Intronic
1077274221 11:1695975-1695997 ACAGGACTCAGGATCGGGGCAGG - Intergenic
1077322083 11:1947109-1947131 CGGGGAGTGGGGGTCGGGGCGGG + Intergenic
1077577433 11:3395132-3395154 ATGGGTGTCGGGCTCGGGGACGG + Intergenic
1078327408 11:10391858-10391880 ACGGGTGTCGGGCTGGGGGACGG + Intronic
1079664924 11:23093083-23093105 ACGGGTGTCGGGCTGGGGGACGG + Intergenic
1079769978 11:24446482-24446504 ACGGGTGTCGGGCTGGGGGATGG - Intergenic
1080873565 11:36257766-36257788 AAGGGAGTAGGGCTGGGGCCAGG + Intergenic
1082288901 11:50346852-50346874 ATGGGTGTCGGGCTGGGGGGTGG - Intergenic
1082706884 11:56503151-56503173 ACGGGTGTCGGGCTGGGGGATGG + Intergenic
1082716376 11:56618899-56618921 ACGGGTGTCAGGCTGGGGGCCGG + Intergenic
1082811649 11:57482492-57482514 GCGGGAAACGGGCTCGGGGTGGG - Intergenic
1083139962 11:60713717-60713739 ACGGGTGTTGGGCTGGGGGACGG + Intronic
1083146020 11:60759506-60759528 ACGGGTGTCGGGCTAGGGGATGG - Intronic
1083285403 11:61655558-61655580 ACGGGTGTCGGGCTGGGGGACGG + Intergenic
1083372795 11:62195057-62195079 ACGGGTGTCGGGCTGGGGGATGG - Intergenic
1083393043 11:62369035-62369057 ACGGGTGTCAGGCTGGGGGACGG + Intronic
1083543120 11:63528520-63528542 ACGGGTGTCGGGCTGGGGGACGG + Intergenic
1083543417 11:63530863-63530885 ACAGGTGTCGGGCTGGGGGACGG + Intergenic
1083849069 11:65354907-65354929 TCGGGAGCCGGGCTGGGGGCAGG + Exonic
1083875658 11:65523179-65523201 ACGGGTGTCGGGCTGGGGGATGG - Intergenic
1083927644 11:65818230-65818252 ACGAGTGCCGGGCTCCGGGCGGG + Intergenic
1083945023 11:65918939-65918961 AGCGGAGCCGGGCCCGGGGCTGG - Exonic
1084207408 11:67603903-67603925 ACGGGTGTCGGGCTGGGGGACGG + Exonic
1084247398 11:67868513-67868535 ACGGGTGTCGGGCTGGGGGACGG + Intergenic
1084259830 11:67968828-67968850 ACGGGGGTCAGGCTCGTGGACGG + Intergenic
1084429541 11:69103441-69103463 CCGGGAGGCGGACTCCGGGCTGG + Intergenic
1084799711 11:71535093-71535115 ATGGGTGTCGGGCTGGGGGACGG - Intronic
1084808810 11:71599788-71599810 ACTGGTGTCGGGCTTGGGGATGG - Intronic
1084812943 11:71626424-71626446 ACGGGGGTCAGGCTGGGGGACGG - Intergenic
1084830779 11:71767494-71767516 ACGGGTGTCGGGCTGGGGGATGG + Intergenic
1084845916 11:71899780-71899802 ACGGGTGTCGGGCTCGGCGACGG - Intronic
1084880092 11:72164770-72164792 ACGGGTGTCGGGCTGGGGGACGG - Intergenic
1085463905 11:76711513-76711535 ACGGATGTCGGGCTGGGGGACGG - Intergenic
1087712180 11:101567047-101567069 GCTGAAGTCTGGCTCGGGGCGGG + Intronic
1087723726 11:101695459-101695481 ACGGGTGTCGGGCTGGGGGACGG - Intronic
1087724657 11:101703957-101703979 ACGGGTGTCGGGCTGGGGGACGG - Intronic
1088032220 11:105265248-105265270 ACAGGTGTCGGGCTGGGGGACGG - Intergenic
1088173102 11:107018804-107018826 TGGGGAGAAGGGCTCGGGGCTGG + Intergenic
1089471218 11:118721562-118721584 ATGGGTGTCGGGCTGGGGGACGG + Intergenic
1089472113 11:118729755-118729777 ACGGGTGTCGGGCAGGGGGACGG + Intergenic
1089517057 11:119039818-119039840 ACGGGTGTCGGGCTGGGGGACGG + Intergenic
1090377854 11:126304016-126304038 GCTGGACTCGGGCTAGGGGCGGG + Exonic
1090817962 11:130314977-130314999 TCGGGGGCGGGGCTCGGGGCGGG + Intergenic
1202805099 11_KI270721v1_random:2422-2444 CGGGGAGTGGGGGTCGGGGCGGG + Intergenic
1091394131 12:143203-143225 AGGGGAGCTGGGCTGGGGGCTGG + Intronic
1092059564 12:5537414-5537436 ACGGGTGTCAGGCTGGGGGACGG - Intronic
1092249689 12:6886403-6886425 ACGGGTGTCGGGATGGGGGATGG + Intronic
1092431126 12:8409798-8409820 ACGGGAGTCGGGCTGGGGGACGG + Intergenic
1092434030 12:8431987-8432009 ACGGGGGTCGGGCTGGGGGACGG + Intergenic
1092437529 12:8462328-8462350 ACGGGTGTCAGGCTGGGGGACGG - Intronic
1092455096 12:8636053-8636075 TCGGGTGTCGGGCTGGGGGACGG - Intergenic
1092559829 12:9600862-9600884 ACGGGTGTCGGGCTGGGGGACGG - Intronic
1092645916 12:10571817-10571839 ATGGGTGTCGGGCTGGGGGATGG + Intergenic
1092857092 12:12684559-12684581 AAGAGAGTGGGGCTGGGGGCGGG - Intronic
1094389361 12:29932603-29932625 ACGGGTGTCGGGCTGGGGGACGG + Intergenic
1094623212 12:32099907-32099929 ACGGGTGTCGGGCTGGGGGACGG - Intergenic
1095451016 12:42330355-42330377 ATGGGTGTCGGGCTGGGGGACGG + Intronic
1095456133 12:42388114-42388136 ACGGGTGTTGGGCTGGGGGATGG - Intronic
1096420692 12:51454836-51454858 ACGGGTGTCGGGCTGGGGGACGG + Intronic
1096940048 12:55333827-55333849 ACGGGTGTCGGGCTGGGGGACGG - Intergenic
1097076801 12:56400910-56400932 ACGGGTGTCGGGCTGGGGGACGG + Intergenic
1097132443 12:56822535-56822557 ACGGGTGTCGGGCTGGGGGACGG - Intergenic
1097330522 12:58328008-58328030 ACGGGTGTCGGGCTGGGGGACGG + Intergenic
1097331457 12:58336497-58336519 ACGGGTGTCGGGCTGGGGGACGG + Intergenic
1098426101 12:70366663-70366685 GAGGCAGTCGGGCTCGGCGCCGG + Exonic
1098837976 12:75444443-75444465 AGGGGAGTGGGGCTGGGGGAAGG + Intergenic
1100276297 12:93074798-93074820 ACGGGTGTCAGGCTGGGGGACGG - Intergenic
1101253624 12:102957370-102957392 ACAGGCGGCGCGCTCGGGGCGGG - Intronic
1102135450 12:110570434-110570456 ACGGGTGTCGGGCTGGGGGACGG - Intronic
1103595538 12:122022495-122022517 CCGGGAGGGGGGCTCGGGGCCGG + Intronic
1103982539 12:124745998-124746020 ACGGGAGGCAAGGTCGGGGCAGG - Intergenic
1105055082 12:133091112-133091134 ACAGGTGTCGGGCTGGGGGACGG + Intronic
1105055618 12:133096047-133096069 ATGGGTGTCGGGCTGGGGGATGG + Intronic
1105349130 13:19600614-19600636 ACGGGTGTCGGGCTGGGAGATGG - Intergenic
1106250369 13:27978009-27978031 GCGGGAGGCGGACTCGGGCCTGG - Exonic
1107700358 13:43041088-43041110 ACAGGTGTCGGGCTGGGGGACGG + Intronic
1108352425 13:49599419-49599441 ACGGGTGTCGGGCTGGGGGACGG - Intergenic
1108603190 13:52012066-52012088 ACGGGCGGCGGGCTTTGGGCCGG + Intergenic
1108813901 13:54267347-54267369 ATGGGTGTCGGGCTGGGGGACGG + Intergenic
1109959805 13:69615425-69615447 ACAGGTGTCGGGCTGGGGGACGG + Intergenic
1110710633 13:78647194-78647216 ACGGGTGTCAGGCTGGGGGACGG - Intronic
1113492780 13:110705784-110705806 ACGGGATCTGGGCTCGGGGAGGG - Intronic
1113747010 13:112752273-112752295 AGGACAGTGGGGCTCGGGGCCGG + Intronic
1114006551 14:18319875-18319897 ACGGGTGTTGGGCTGGGGGATGG - Intergenic
1114072950 14:19129840-19129862 ACGGGTGTCAGGCTGGGGGACGG - Intergenic
1114089315 14:19270153-19270175 ACGGGTGTCAGGCTGGGGGACGG + Intergenic
1114154449 14:20084984-20085006 ATGGGTGTCGGGCTGGGGGATGG - Intergenic
1114168046 14:20242136-20242158 ACGGGTGTCCGGCTGGGGGACGG + Intergenic
1114170595 14:20269319-20269341 ACGGGTGTCGGGCTGGGGGTCGG - Intronic
1114604089 14:23982071-23982093 ATGGGTGTCGGGCTGGGGGACGG + Intronic
1115898525 14:38118496-38118518 ATGGGTGTCGGGCTGGGGGACGG - Intergenic
1116481294 14:45393981-45394003 ACAGGTGTCGGGCTGGGGGACGG - Intergenic
1116759080 14:48988357-48988379 ACGTGAGTGGGGCTAGGGGCCGG + Intergenic
1117335415 14:54753173-54753195 ACGGGTGTTGGGCTGGGGGACGG + Intronic
1118352040 14:64979137-64979159 ACGGGTGTCGGGCTGGGGGACGG + Intronic
1118776627 14:68978054-68978076 ACGGGAGCTGGGCTCGGAGCTGG - Intronic
1119557951 14:75567814-75567836 AGGGGAGCAGGGCTGGGGGCAGG + Intergenic
1119823136 14:77635826-77635848 ACAGGTGTCGGGCTAGGGGACGG + Intergenic
1119826619 14:77661947-77661969 ACGGGTGTCGGGCTGGGGGACGG + Intergenic
1119841321 14:77795223-77795245 ACAGGAGTTGGGCTGGGGGACGG + Intergenic
1120641630 14:87020535-87020557 ACGGGTGTCCGGCTGGGGGATGG - Intergenic
1120733117 14:88024737-88024759 ACGGGTGTCTGGCTGGGGGACGG - Intergenic
1121295747 14:92820561-92820583 ACAGGTGTCGGGCTGGGGGACGG + Intronic
1121527067 14:94626547-94626569 ACGGGTGTCGGGCTGGGGGACGG - Intergenic
1121673222 14:95729686-95729708 ACAGGTGTCGGGCTGGGGGATGG + Intergenic
1121741377 14:96254651-96254673 AAGGGAGTGGGGCTGAGGGCAGG - Intronic
1122062675 14:99147218-99147240 ACGGGAGAGGGGCTGGTGGCTGG - Intergenic
1122275202 14:100587426-100587448 CGGGGAGCCGGGCTGGGGGCGGG - Intergenic
1122621022 14:103057670-103057692 CAGGGAGCCGGGCGCGGGGCGGG - Intergenic
1122689558 14:103525486-103525508 ACGGGTGTTGGGCTGGGGGATGG + Intergenic
1122720324 14:103718290-103718312 TCGGGAGACGGGCACTGGGCTGG - Intronic
1122778987 14:104135768-104135790 CAGGGAGTCGGGGTCGGGGCAGG + Intergenic
1122997604 14:105273874-105273896 ACGGGTGTCGGGCTGGGGGACGG - Intronic
1123052852 14:105555218-105555240 ACGGGTGTCGGGCTGGGGGACGG - Intergenic
1123077434 14:105675606-105675628 ACGGGTGTCGGGCTGGGGGACGG - Intergenic
1123136457 14:106031809-106031831 ACGGGAGTCAGGCTGGGGGACGG + Intergenic
1202919344 14_KI270723v1_random:16547-16569 ATGGGTGTCGGGCTGGGGGATGG + Intergenic
1123723739 15:23082286-23082308 ATGGGTGTCGGGCTGGGGGATGG + Intergenic
1126002932 15:44229008-44229030 ACGAGTGTCGGGCTGGGGGACGG - Intergenic
1127893781 15:63277461-63277483 ACGGGGGCGGGGCTCGGGGGCGG - Intronic
1128131013 15:65227091-65227113 ACGGGTGTCGGGCTGGGGGACGG + Intergenic
1128193957 15:65734050-65734072 ACAGGTGTCGGGCTAGGGGACGG - Intronic
1128744440 15:70103629-70103651 ATGGGAGTCGGGATAGGGGCAGG - Intergenic
1129221308 15:74133359-74133381 AATGGAGTCGGGCTCGGGTAAGG - Exonic
1129485866 15:75871403-75871425 ACGGGTGTCAGGCTGGGGGACGG + Intronic
1129539759 15:76340206-76340228 CCGGAGGTTGGGCTCGGGGCGGG + Intronic
1129853857 15:78810948-78810970 ACAGTAGTCGGGGTCGGGCCGGG - Intronic
1129988021 15:79935821-79935843 ACGGGTGTCGGGCTGGGGTATGG + Intergenic
1130944509 15:88540948-88540970 ATGGGTGTCGGGCTGGGGGACGG - Intronic
1131097499 15:89665808-89665830 ACGCGGGGCGGGCTCCGGGCCGG + Exonic
1131274996 15:90973498-90973520 ACGGGTGTCGGGCTGGGGGATGG - Intronic
1131946680 15:97629682-97629704 ACGGGTGTCGGGCTGGGGGACGG + Intergenic
1132440593 15:101860526-101860548 ACGGGTGTCGGGCTGGGGGACGG + Intergenic
1132720953 16:1315389-1315411 ACGGGGGTCGGGGGCTGGGCTGG - Intronic
1132831651 16:1931255-1931277 ACAGGTGTCGGGCTCGGGGACGG - Intergenic
1132858232 16:2057041-2057063 GCGGGACTGGGGCTGGGGGCAGG + Intronic
1133396169 16:5449165-5449187 TCGGGAGTGGGGCTTTGGGCAGG - Intergenic
1133433004 16:5754937-5754959 ACGGGTGTCGGGCTGGGGGACGG + Intergenic
1133687426 16:8179310-8179332 ACGGGTGTCGGGCTGGGGGACGG + Intergenic
1133973049 16:10580682-10580704 CCGGGAGGCGGGATCGGGGAAGG - Exonic
1134483301 16:14636688-14636710 ACGGGTGTCGGGCTGGGGGACGG + Intronic
1134624693 16:15715109-15715131 AGGGGAGGCCGGCTGGGGGCTGG + Intronic
1135577857 16:23599872-23599894 ACGGGTGTCGGGCTGGGGGACGG - Intergenic
1136930369 16:34412606-34412628 ACGGGTGTCGGGCTGGGGGATGG + Intergenic
1136974205 16:34999202-34999224 ACGGGTGTCGGGCTGGGGGATGG - Intergenic
1136991474 16:35153854-35153876 ACAGGTGTCGGGCTGGGGGACGG - Intergenic
1137075484 16:35956104-35956126 ACGGGTGTTGGGCTGGGGGACGG + Intergenic
1137366590 16:47864855-47864877 ACGGGTGTTGGGCTGGGGGACGG - Intergenic
1138651508 16:58463884-58463906 GCTGGGGTCGTGCTCGGGGCTGG - Intronic
1139394347 16:66628307-66628329 ACGGGTGTCGGGCTGGGGGACGG + Intronic
1139439146 16:66955956-66955978 ATGGGTGTCGGGCTGGGGGACGG + Intergenic
1140418889 16:74799942-74799964 ACGGGTGTCGGGCTGGGGGACGG + Intergenic
1140546616 16:75815844-75815866 ACGGGTGTCGGGCTGGGGGACGG + Intergenic
1141416532 16:83879765-83879787 ACGGGTGTCGGGCTGGGGGATGG + Intergenic
1141517485 16:84555540-84555562 GTGGGAGGCGGGCTCGGGGGAGG + Intergenic
1141650577 16:85390742-85390764 ACGGGGTTCGGGCTGGGGCCAGG - Intergenic
1142872040 17:2827443-2827465 ATGAGGGTGGGGCTCGGGGCTGG + Intronic
1142876299 17:2853654-2853676 GCGGGAGGCGGGGCCGGGGCGGG + Intronic
1143116494 17:4584472-4584494 CGGGGAGGCGGGCGCGGGGCGGG - Intronic
1143195769 17:5075228-5075250 ACGGGTGTCGGGCTGGGGGATGG + Intergenic
1144624030 17:16835436-16835458 ACGGGTGTCGGGCTGGGGGACGG + Intergenic
1144639848 17:16931264-16931286 ACGGGAGGCTGAGTCGGGGCAGG - Intronic
1144882398 17:18437280-18437302 ACGGGTGTCGGGCTGGGGGACGG - Intergenic
1145031043 17:19505503-19505525 ACGGGTGTCGGGCTGGGGGACGG + Intronic
1145033086 17:19520101-19520123 ACGGGTGTCGGGCTGGGGGACGG - Intronic
1145149836 17:20507106-20507128 ACGGGTGTCGGGCTGGGGGACGG + Intergenic
1146161774 17:30563743-30563765 ACGGGTGTTGGGCTGGGGGACGG + Intergenic
1146166666 17:30595015-30595037 ACGGGTGTCGGGCTGGGGGACGG + Intergenic
1146181427 17:30700590-30700612 ACGGGTGTCGGGCTGGGGGACGG + Intergenic
1146839476 17:36140449-36140471 ACGGGTGTCCGGCTGGGGGACGG - Intergenic
1147407028 17:40219564-40219586 CGGGGAGGGGGGCTCGGGGCGGG + Intronic
1147790949 17:43014053-43014075 ATGGGAGAAGGGCTGGGGGCTGG - Intronic
1147838763 17:43355342-43355364 ACGGGTGTCGGGCTGGGGGACGG - Intergenic
1148475805 17:47927917-47927939 ACAGGAGTGGGGCTGAGGGCAGG - Exonic
1148482749 17:47970888-47970910 ACGCGAGGCGGGCTCAGGGCAGG - Intronic
1148578833 17:48729246-48729268 AGGGGAGTCGGGGGTGGGGCTGG + Intergenic
1148733435 17:49851382-49851404 GCGGGAGCCGGGCCGGGGGCGGG + Intergenic
1148742357 17:49899987-49900009 AGGGCAGTGGGGCTGGGGGCAGG + Intergenic
1149202356 17:54201970-54201992 ACGGGTGTCGGGCTGGGGGCCGG - Intergenic
1149767370 17:59290485-59290507 ACGGGTGTTGGGCTGGGGGATGG + Intergenic
1150409344 17:64930418-64930440 AAGGGTGTCGGGCTGGGGGACGG - Intergenic
1150840919 17:68604541-68604563 ACGGGTGTCGGGCTGGGGGACGG + Intergenic
1150983441 17:70169308-70169330 CGGGGAGTCGGGCCCGGGCCGGG - Intronic
1151360114 17:73583726-73583748 ACGGGTGGTGGGCTGGGGGCAGG + Intronic
1151559002 17:74860986-74861008 CCGGGAGTGGGGGCCGGGGCTGG - Intronic
1151954393 17:77373271-77373293 CCGGGAGGCGGGGGCGGGGCGGG + Intronic
1151956794 17:77384141-77384163 GCGGGAGGCTGGCTGGGGGCTGG + Intronic
1152480907 17:80551757-80551779 ACGGGTGTCGGGCTGGGGGACGG + Intronic
1152619017 17:81352124-81352146 ACGGGTGGGGGGCGCGGGGCGGG + Intergenic
1152869585 17:82745078-82745100 ATGGGTGTCGGGCTGGGGGACGG + Intronic
1152962953 18:90781-90803 ATGGGTGTCGGGCTGGGGGACGG + Intergenic
1153143463 18:2001363-2001385 AAGGGTGTCGGGCTGGGGGACGG + Intergenic
1153489323 18:5630753-5630775 CTGGGAGGCGGGCTCAGGGCGGG - Intergenic
1155472121 18:26202383-26202405 ATGGGTGTCGGGCTGGGGGACGG + Intergenic
1157220704 18:45826790-45826812 ACTGGAGTCCAGCTCGGGGCTGG + Intronic
1159051213 18:63422617-63422639 GCGGAAGTCGGGCTCGGCGCAGG + Intergenic
1159484929 18:69043401-69043423 ATGGGTGTCGGGCTTGGGGACGG + Intronic
1160474232 18:79167926-79167948 ACGGGAGGGTGGCTCGGGGCAGG - Intronic
1160514434 18:79470725-79470747 ACGGGAGGCGGGGCCGGGACAGG - Intronic
1160593750 18:79960513-79960535 ACGGGTGTCGGGCTGGGGGACGG - Intergenic
1160675177 19:387068-387090 ACGGGTGTCGGGCTGGGGGACGG - Intergenic
1160697372 19:491657-491679 AGGGGAGGGGGGCTTGGGGCTGG - Intronic
1160697579 19:492154-492176 AGGGGAGGGGGGCTTGGGGCTGG - Intronic
1160975250 19:1789814-1789836 AGGGGCGGCGGGCTCGGGGTGGG - Intronic
1161029491 19:2051094-2051116 ACCGGGGTCGGGCTTGGGCCGGG + Exonic
1162096845 19:8315245-8315267 ACCGGTGTCGGGCTGGGGGACGG - Intronic
1162099939 19:8333517-8333539 CCGGGAGTGGGGCTGGGGCCGGG + Intronic
1162802038 19:13116605-13116627 GAGGGATTCGGACTCGGGGCGGG - Intronic
1163126516 19:15247180-15247202 ACTGGAGTGGGGCTGGGGGGTGG - Intronic
1163636993 19:18441605-18441627 ACAGGAGTGGGGCTGGGGGTGGG - Intergenic
1163885584 19:19961989-19962011 ATGGGTGTCGGGCTGGGGGATGG - Intergenic
1163898818 19:20082735-20082757 ATGGGTGTCGGGCTGGGGGATGG - Intronic
1163920715 19:20286148-20286170 ATGGGTGTCGGGCTGGGGGATGG - Intergenic
1164049028 19:21568340-21568362 ATGGGTGTCGGGCTGGGGGGCGG - Intergenic
1164122844 19:22283932-22283954 ACGGGTGTCGGGCTGGGGGATGG - Intergenic
1164153683 19:22575334-22575356 ATGGGTGTCGGGCTGGGGGATGG - Intergenic
1164154357 19:22581188-22581210 ACGGGTGTCGGGCTGGGGGACGG - Intergenic
1164276610 19:23724190-23724212 ACGGGTGTCGGGCTGGGGGACGG + Intergenic
1164370355 19:27638139-27638161 ACGGGTGTCGGGCTGGGGGACGG + Intergenic
1164390425 19:27814991-27815013 ACGGGTGTCAGGCTGGGGGATGG - Intergenic
1164424712 19:28131026-28131048 ACGGGTGTCGGGCTGGGGGATGG - Intergenic
1164489021 19:28689861-28689883 ACGGGTGTCGGGCTGGGGGACGG + Intergenic
1164605673 19:29596196-29596218 AATGGAGTCGCGCTGGGGGCAGG - Intergenic
1165256004 19:34577599-34577621 ACGCGGTTCGGGGTCGGGGCCGG + Intergenic
1165295121 19:34920575-34920597 ACGGGTGTTGGGCTGGGGGATGG - Intergenic
1165311402 19:35031011-35031033 GCGGGAGCCGGGCTTGGGGAGGG + Intronic
1165506447 19:36233913-36233935 ACGGGTGTCGGACTGGGGGACGG + Intronic
1165508085 19:36247514-36247536 ACGGGTGTCGGGCTGGGGGACGG + Intergenic
1165595098 19:37006555-37006577 ACGGGTGTCAGGCTGGGGGACGG - Intergenic
1165607186 19:37115746-37115768 ACGGGTGTTGGGCTGGGGGGCGG + Intronic
1165652340 19:37502298-37502320 ACGGGTGTCGGGCTGGGGGATGG + Intergenic
1165655708 19:37530352-37530374 ATGGGTGTCGGGCTGGGGGATGG + Intronic
1165666209 19:37630494-37630516 ACGGGTGTCGGGCTGGGGGACGG + Intronic
1165691407 19:37866573-37866595 ACGGGTGTCGGGCTGGGGGATGG - Intergenic
1165952045 19:39479881-39479903 ACGGGTGTCGGGCTGGGGGACGG - Intergenic
1166013273 19:39959778-39959800 ACGGGTGTCGGGCTGGGGGACGG + Intergenic
1166105618 19:40596871-40596893 ACGGGAGCGGGGTTGGGGGCAGG - Intronic
1166596378 19:44053677-44053699 ATGGGTGTCGGGCTGGGGGACGG + Intronic
1166653645 19:44594492-44594514 ACGGGTGTCGGGCTGGGGGACGG - Intergenic
1166659825 19:44639452-44639474 ATGGGTGTCGGGCTGGGGGACGG - Intergenic
1166846846 19:45733684-45733706 AGGGGAATGGGGCGCGGGGCAGG + Intronic
1167134427 19:47608662-47608684 CCGGGACTGGGGCTGGGGGCGGG + Intronic
1167336578 19:48890032-48890054 ACGGGTGTCGGGCTGGGGGACGG - Intronic
1167493826 19:49806703-49806725 ACGGGAGACGGGCTCCTTGCTGG - Exonic
1167818606 19:51906089-51906111 ACGGGTGTCGGGCTGAGGGATGG - Intronic
1167818963 19:51908739-51908761 ACGGGTGTCGGGCTGGGGGACGG + Intronic
1167824603 19:51960816-51960838 ATGGGTGTCGGGCTGGGGGAGGG + Intergenic
1167831646 19:52028010-52028032 ACGGGTGTTGGGCTGGGGGACGG - Intronic
1167833122 19:52043529-52043551 ACGGGTGTCGGGCTGGGGGACGG - Intronic
1167876920 19:52421506-52421528 ACGGGTGTCGGGCTGGGGGACGG + Intergenic
1167883830 19:52484399-52484421 ACGGGTGTCGGGCTAGGGGATGG + Intronic
1167884052 19:52485933-52485955 ATGGGTGTCGGGCTGGGGGATGG - Intronic
1167893195 19:52559091-52559113 ACGGGTGTTGGGCTGGGGGATGG - Intronic
1167910518 19:52698288-52698310 ACGGGTGTCGGGCTGGGAGACGG + Intergenic
1167913753 19:52724128-52724150 ACGGGTGTCTGGCTGGGGGATGG + Intronic
1167951112 19:53028459-53028481 ACGGGTGTTGGGCTGGGGGATGG + Intergenic
1168006966 19:53498036-53498058 ACGGGTGTCAGGCTGGGGGATGG - Intergenic
1168052363 19:53839022-53839044 ACGGGTGTCGGGCTGGGAGACGG - Intergenic
1168115634 19:54220217-54220239 ACGGGAGGCGGGTGAGGGGCGGG + Intronic
1168118621 19:54239963-54239985 ACGGGAGGCGGGTGAGGGGCGGG + Intronic
1168218551 19:54944124-54944146 ACGGGTGTCGGGCTGGGGTACGG - Intronic
1168235430 19:55060099-55060121 ACGGGTGTTGGGCTGGGGGACGG - Intronic
1168358517 19:55718290-55718312 ACGGGTGTCGGGTTGGGGGATGG - Intronic
1168401517 19:56088291-56088313 AAGGGCTTCGGGCACGGGGCCGG - Exonic
1168461176 19:56559873-56559895 ACCGGTGTCGGGCTCAGGGACGG + Intergenic
924967849 2:94459-94481 ACAGGTGTCGGGCTGGGGGACGG - Intergenic
925142698 2:1560844-1560866 ACGGGGGTCGGGCTGGGGGACGG + Intergenic
926190063 2:10721664-10721686 ACGGGCGGCGGGTGCGGGGCCGG - Exonic
926801835 2:16665907-16665929 CCGCGAGCCGGGCTGGGGGCGGG - Intronic
927188821 2:20501749-20501771 ACGGGTGTCGGGCTGGGGGACGG + Intergenic
927518979 2:23688017-23688039 AAGGGTGTGGGGCTCTGGGCAGG - Intronic
927881438 2:26692649-26692671 GCGGGGGGCGGGCGCGGGGCCGG + Intergenic
927891132 2:26750258-26750280 ACGGGTGTGGGGCTGGGGGACGG - Intergenic
927992838 2:27460375-27460397 ACGGGTGTCGGGCTGGGGGACGG - Intronic
928355867 2:30614021-30614043 ACGGGTGTCGGGCTGGGGGACGG + Intronic
928990238 2:37225714-37225736 ACGGGTGTCGGGCTGGGGGACGG - Intronic
929097519 2:38278181-38278203 TCGGGTGTCGGGCTGGGGGACGG - Intergenic
929208104 2:39321557-39321579 ATGGGTGTCGGGCTGGGGGACGG - Intronic
932600332 2:73119759-73119781 ACGGGTGTCGGGCTGGGGGACGG + Intronic
932770764 2:74499644-74499666 ACGGGACTCGGGCCCAGAGCCGG - Exonic
932798686 2:74720376-74720398 ACGGGTGTCGGGCTGGGAGACGG - Intergenic
933838052 2:86261696-86261718 ACAGGTGTCGGGCTGGGGGACGG - Intronic
934123868 2:88867077-88867099 ACGGGTGTCAGGCTGGGGGACGG + Intergenic
934592391 2:95567592-95567614 ACGGGTGTTGGGCTGGGGGATGG - Intergenic
935180448 2:100685263-100685285 ACGGGTGTTGGGCTGGGGGACGG - Intergenic
935818203 2:106867695-106867717 GCGGGGGTCGGGCTGGGGGTGGG - Intronic
936107489 2:109637416-109637438 ACGGGTGTTGGGCTGGGGGATGG + Intergenic
936157268 2:110056468-110056490 ACGGGTGTCGGGCTGGGGGACGG - Intergenic
936187426 2:110314976-110314998 ACGGGTGTCGGGCTGGGGGACGG + Intergenic
936378516 2:111963391-111963413 ACGGGTGTCGGGCTGGGGGACGG + Intronic
936487006 2:112934651-112934673 ACGGGTGTCGGGCTGGGGGACGG - Intergenic
938235371 2:129701777-129701799 ACGGGTGTCGGGCTGGGGGACGG - Intergenic
938487003 2:131721621-131721643 ACGGGTGTCAGGCTGGGGGATGG - Intergenic
938530009 2:132175597-132175619 ACGGGTGTTGGGCTTGGGGATGG + Intronic
943327725 2:186521918-186521940 ACGGGTGTTGGGCTTGGGGACGG - Intergenic
943838222 2:192542490-192542512 ACGGGTGTCGGGCTGGGGGACGG + Intergenic
943880926 2:193142818-193142840 ACGGGTGTCGGGCTGGGGGACGG - Intergenic
943977684 2:194504861-194504883 ACGGGTGTCGGGCTGGGGGACGG + Intergenic
944581987 2:201139398-201139420 ATGGGTGTCGGGCTGGGGGACGG - Intronic
944681681 2:202083378-202083400 ACTGGAGTAGAGGTCGGGGCAGG - Intronic
945175213 2:207037222-207037244 ACGGGTGTCGGGCTGGGGGATGG - Intergenic
945832390 2:214803281-214803303 ACGGGTGTCGGGCTGGGGGACGG - Intronic
946360990 2:219219193-219219215 ACGGAATCCTGGCTCGGGGCAGG + Intronic
946780677 2:223190874-223190896 ATGGGTGTCGGGCTGGGGGACGG - Intronic
947273413 2:228364191-228364213 ACGGGTGTCGGGCTGGGGGACGG + Intergenic
947520745 2:230844186-230844208 ACGGGTGTCGGGCTGGGGGACGG + Intergenic
947730100 2:232423402-232423424 ACAGGTGTCGGGCTGGGGGACGG - Intergenic
948149135 2:235730975-235730997 AGGAGAGCCGGGCTAGGGGCTGG - Intronic
948824812 2:240568963-240568985 ACAGCAGGCGGGCTCGGAGCCGG - Exonic
948843460 2:240671772-240671794 ACGGGTGTCGGGCTGGGGGACGG - Intergenic
1168825740 20:812403-812425 ATGGGTGTCGGGCTGGGGGATGG + Intergenic
1169247428 20:4034545-4034567 TCGGGTGTCGGGCTGGGGGACGG + Intergenic
1169658860 20:7956596-7956618 ATGGGTGTCGGGCTGGGGGATGG - Intergenic
1170397857 20:15947244-15947266 ACAGGTGTCGGGCTGGGGGATGG + Intronic
1171276583 20:23861147-23861169 ACGGGTGTCGGGCTGGGGGACGG + Intergenic
1171291024 20:23983039-23983061 ACGGGTGTCAGGCTGGGGGATGG - Intergenic
1171385087 20:24764450-24764472 AGGTCAGGCGGGCTCGGGGCTGG + Intergenic
1171450755 20:25234387-25234409 ATGGGTGTCGGGCTGGGGGATGG + Intergenic
1171451890 20:25241645-25241667 ATGGGCGTCGGGCTGGGGGACGG - Intergenic
1171495331 20:25550911-25550933 ACAGGTGTCGGGCTGGGGGACGG + Intronic
1171817902 20:29804819-29804841 ACAGGTGTCGGGCTGGGGGATGG - Intergenic
1172569015 20:35954404-35954426 GAGGGAGTCGGACTCGGGACCGG + Exonic
1173319066 20:41971292-41971314 ACGGGTGTCGGGCTGGGGGACGG - Intergenic
1174736718 20:52972217-52972239 AGGGGAGAGGGGCTGGGGGCGGG - Intergenic
1175014670 20:55776771-55776793 AGGGGAGTAGGGCTGGGGGAGGG - Intergenic
1175573480 20:60041730-60041752 ACAGGTGTCGGGCTGGGGGATGG + Intergenic
1175907290 20:62387151-62387173 GCGGGCTTCGGGCTCAGGGCTGG + Intronic
1176424436 21:6539364-6539386 ATGGGTGTCGGGCTGGGGGACGG + Intergenic
1177175154 21:17694765-17694787 ACGGGTGTCGGGCTGGGGGACGG + Intergenic
1177199078 21:17933269-17933291 ATGGGTGTCGGGCTGGGGGACGG + Intronic
1177249113 21:18569226-18569248 ACGGGTGTTGGGCTGGGGGACGG + Intergenic
1178483011 21:32996687-32996709 ACGGGTGTCGGGCTGGGAGACGG - Intergenic
1179699929 21:43147679-43147701 ATGGGTGTCGGGCTGGGGGACGG + Intergenic
1180110084 21:45643474-45643496 GCGGGGGTGGGGCTGGGGGCGGG - Intergenic
1180232330 21:46434601-46434623 GTGGGAGTCGGGCCCTGGGCAGG + Intronic
1180333019 22:11550059-11550081 ACGGGTGTCGGGCTGGGGGACGG - Intergenic
1180431060 22:15250686-15250708 ACGGGTGTTGGGCTGGGGGATGG - Intergenic
1180491392 22:15852194-15852216 ACGGGTGTCAGGCTGGGGGACGG - Intergenic
1180766390 22:18348048-18348070 ACAGGTGTCGGGCTGGGGGACGG + Intergenic
1180779925 22:18514330-18514352 ACAGGTGTCGGGCTGGGGGACGG - Intergenic
1180812639 22:18771651-18771673 ACAGGTGTCGGGCTGGGGGACGG - Intergenic
1180837733 22:18939070-18939092 ACGGGTGTCGGGCTGGGGGACGG - Intergenic
1181198798 22:21205899-21205921 ACAGGTGTCGGGCTGGGGGACGG - Intergenic
1181400942 22:22649900-22649922 ACGGGTGTCGGGCTGGGGGACGG + Intergenic
1181535158 22:23538135-23538157 ACGGGTGTCGGGCTGGGGGACGG - Intergenic
1181594837 22:23907480-23907502 ACGGGTGTCGGGCTGGGGTACGG - Intergenic
1181642611 22:24211438-24211460 ACGGGTGTCGGGCTGGGGGATGG + Intergenic
1181702919 22:24630992-24631014 ACGGGTGTCGGGCTGGGGAACGG + Intergenic
1183627259 22:39012086-39012108 ACGGGTGTCGGGCTGGGGGACGG + Intergenic
1183788280 22:40044743-40044765 AATGGAGTGGGGCTCTGGGCGGG + Intergenic
1184226011 22:43129175-43129197 AGAGGAGTCAGGCTCGGGGCAGG - Intronic
1184523670 22:45009465-45009487 CCGGGGGCCGGGCCCGGGGCCGG - Intronic
1185050622 22:48552286-48552308 CCAGGAGTTGGGCTCTGGGCAGG + Intronic
1185330792 22:50251297-50251319 CCGGGAGCAGGGCGCGGGGCGGG - Exonic
1203228007 22_KI270731v1_random:88938-88960 ACAGGTGTCGGGCTGGGGGACGG + Intergenic
1203287824 22_KI270734v1_random:164369-164391 ACGGGTGTCGGGCTGGGGGACGG - Intergenic
949547168 3:5082145-5082167 ACGGGTGTTGGGCTGGGGGAAGG + Intergenic
949804679 3:7942101-7942123 ACGGGTGTCAGGCTGGGGGGCGG - Intergenic
950030390 3:9848231-9848253 ACAGGTGTCGGGCTGGGGGACGG + Intronic
950031095 3:9854178-9854200 ACGGGTGTCGGGCTGGGGGACGG + Intronic
950262354 3:11552484-11552506 ACTGGAGTGGGACTGGGGGCTGG - Intronic
950387921 3:12674512-12674534 AAGGGTGTCGGGCTGGGGGACGG - Intergenic
950607114 3:14091734-14091756 ACGGGTGTCGGGCTGGGGGACGG + Intergenic
951514652 3:23545212-23545234 ACGGGTGTCGGGCTGGGGGAGGG + Intronic
953059941 3:39418848-39418870 ACGGGTGTCAGGCTGGGGGACGG + Intergenic
953410600 3:42688578-42688600 ACGGGAGTGGGGGTGGGGGAGGG - Intronic
953439556 3:42906179-42906201 CGGGGAGTCGGGCGTGGGGCGGG + Exonic
953960086 3:47259930-47259952 ACGGGTGTCGGGCTGGGGGACGG - Intronic
954267627 3:49482303-49482325 ACAGGTGTCGGGCTGGGGGAAGG - Intronic
954896296 3:53978063-53978085 ACGGGTGTCAGGCTGGGGGATGG + Intergenic
955257111 3:57343611-57343633 ACAGGTGTCGGGCTGGGGGACGG - Intronic
955996878 3:64687491-64687513 CCGGGAGGCGGCGTCGGGGCCGG + Intronic
957074781 3:75593251-75593273 ACGGGGGTCGGGCTGGGGGATGG + Intergenic
957082168 3:75645725-75645747 ATGGGTGTCGGGCTGGGGGATGG - Intergenic
958937547 3:100273042-100273064 ACGGGTGTCGGGCTAGGGGACGG + Intronic
958943256 3:100336875-100336897 ACGGGTGTCGGGCTGGGGGACGG + Intronic
958975772 3:100666689-100666711 ACGGGTGTCAGGCTGGGGGACGG + Intronic
959069874 3:101692290-101692312 ACGGGTGTCAGGCTGGGGGACGG - Intergenic
959070779 3:101700444-101700466 ACGGGTGTCGGGCTGGGGGACGG - Intergenic
959071301 3:101704382-101704404 ACGGGTGTCGGGCTGGGGGACGG + Intergenic
959398358 3:105869033-105869055 ACAGGACCCAGGCTCGGGGCGGG + Exonic
959985279 3:112564628-112564650 ACAGGTGTCGGGCTGGGGGACGG + Intronic
960027433 3:113024826-113024848 ACGGGTGTCGGGCTGGGGGACGG + Intergenic
960028346 3:113033025-113033047 ACGGGTGTCGGGCTGGGGGACGG + Intergenic
961276427 3:125730866-125730888 ACTGGTGTCCGGCTCGGGGACGG - Intergenic
961512594 3:127412211-127412233 AAGGGTGTCGGGCTGGGGGACGG + Intergenic
961834029 3:129641644-129641666 ACGGGTGTCGGGCTGGGGGACGG + Intergenic
961875075 3:130016152-130016174 ACTGGTGTTGGGCTCGGGGACGG + Intergenic
961878013 3:130038867-130038889 ATGGGGGTCGGGCTCAGGGATGG + Intergenic
962128626 3:132649192-132649214 ACGGGTGTCGGGCTGGGGGACGG - Intronic
962334672 3:134516482-134516504 ACGGGTGTCGGGCTGGGGGACGG + Intronic
966073357 3:175906099-175906121 ACGGGTGTCGGGCTGGGGGACGG + Intergenic
966771906 3:183511502-183511524 ACGGGTGTCGGGCTGGGGGATGG + Intronic
966773039 3:183520927-183520949 GCGGGTGTCGGGCTGGGGGACGG + Intronic
967025865 3:185563097-185563119 ACGGGTGTCGGGCTGGGGGACGG + Intergenic
967026774 3:185571309-185571331 ACGGGTGTCGGGCTGGGGGACGG + Intergenic
967176549 3:186866049-186866071 TCGGGTGTCGGGCTGGGGGACGG + Intergenic
967179103 3:186887423-186887445 ACGGGTGTCGGGCTGGGGGAGGG + Intergenic
967179735 3:186893616-186893638 ACGGGTGTCAGGCTGGGGGATGG - Intergenic
968054914 3:195684018-195684040 ACAGCAGTCGGGCTTCGGGCTGG + Intergenic
968095612 3:195928074-195928096 ACGGGTGTCGGGCTGGGGGACGG + Intergenic
968266252 3:197365793-197365815 AGGGGAGTCGGTTACGGGGCTGG - Intergenic
968387242 4:152291-152313 ACGGGTGTCGGGCTGGGGGACGG + Intronic
968562978 4:1294795-1294817 ACGGGGGTGGGGCCGGGGGCAGG + Intronic
968571970 4:1346807-1346829 ACGGGCGCCGGGGGCGGGGCCGG - Intergenic
968695224 4:2021749-2021771 ACTGGTGTCGGGCTGGGGGATGG - Intronic
968885999 4:3332744-3332766 ACAGGAGTCATGCCCGGGGCAGG - Intronic
968987427 4:3883929-3883951 ACGGGGGTCGGGCTGGGGGATGG + Intergenic
968990227 4:3905900-3905922 TCGGGTGTCGGGCTCGTGGACGG + Intergenic
969023068 4:4151090-4151112 ACTGGTGTCGGGCTCGGGGACGG + Intergenic
969131131 4:4991800-4991822 ACGGGAGTGGGAATCCGGGCAGG + Intergenic
969730737 4:8955993-8956015 ACTGGTGTCGGGCTCGGGGACGG - Intergenic
969735602 4:8987829-8987851 ACTGGTGTCGGGCTTGGGGACGG - Intergenic
969786909 4:9465622-9465644 ACGGGTGTCGGGCTCGGGGACGG - Intergenic
969825093 4:9751465-9751487 ACGGGTGTCAGGCTCGGAGACGG - Intergenic
970075227 4:12210802-12210824 ACTGGAGTCAGAGTCGGGGCAGG + Intergenic
971720065 4:30233464-30233486 ACGGGTGTCGGGCTGGGGGATGG + Intergenic
973541789 4:51942134-51942156 GCGGGAGTCTGGGTGGGGGCAGG + Intergenic
974517959 4:62941274-62941296 ACGGGTGTCGGGCTGGGGGACGG - Intergenic
974766940 4:66359307-66359329 ACGGGTGTTGGGCTGGGGGATGG + Intergenic
974924641 4:68282007-68282029 ACGGGTGTTGGGCTGGGGGACGG + Intergenic
974960512 4:68693864-68693886 ACGGGTGTTGGGCTGGGGGACGG - Intergenic
975246836 4:72129773-72129795 ACGGGTGTCGGGCTGGGGGACGG + Intronic
975519697 4:75287176-75287198 ATGGGTGTCGGGCTGGGGGACGG + Intergenic
976080066 4:81345843-81345865 ACGGGAGTGGGGCAGTGGGCAGG + Intergenic
978048924 4:104171394-104171416 ACGGGTGTCAGGCTGGGGGACGG - Intergenic
979141654 4:117183509-117183531 ACGGGTGTCGGGCTAGGGGACGG - Intergenic
979996718 4:127440051-127440073 ACGGGTGTCGGGCTGGGGGATGG + Intergenic
981315504 4:143336580-143336602 ACGGGCAGCGGGCGCGGGGCTGG - Intergenic
982512850 4:156305311-156305333 ACGGGTGTCGGGCTGGGGGACGG + Intergenic
982659676 4:158191807-158191829 AGGGGAGTTGGGATCGGGGAAGG + Intergenic
982876594 4:160659182-160659204 ACGGGTGTCGGGCTGGGGGACGG - Intergenic
983205457 4:164906063-164906085 ACGGGTGTCGGGCTGGGGGACGG + Intergenic
983214501 4:164990778-164990800 ACGGGTGTCGGGCTGGAGGACGG - Intergenic
983215178 4:164996082-164996104 ACGGGTGTCGGACTGGGGGATGG - Intergenic
983215896 4:165002346-165002368 ATGGGTGTCGGGCTGGGGGACGG - Intergenic
983224520 4:165073527-165073549 ACAGGTGTCGGGCTGGGGGATGG - Intergenic
983313269 4:166093643-166093665 ACAGGTGTCGGGCTGGGGGACGG + Intronic
984423430 4:179553725-179553747 AGGGGTGTCGGGCTGGGGGATGG + Intergenic
985057803 4:186050446-186050468 ATGGGTGTCGGGCTTGGGGACGG - Intergenic
985494575 5:197352-197374 ACGGGTGTCGGGCTGGGGGACGG + Exonic
985502089 5:254659-254681 ACAGCAGTCGGGCTTCGGGCTGG + Intronic
985588006 5:750922-750944 GCGGGAGGCAGGCTCGGGGAGGG - Intronic
985602675 5:843389-843411 GCGGGAGGCAGGCTCGGGGAGGG - Intronic
985734164 5:1567941-1567963 ACGGGTGTCGGGCTGGTGGATGG + Intergenic
985738082 5:1596526-1596548 ACGGGTGTCGGGCTGGGGGACGG + Intergenic
986130486 5:4925325-4925347 ACAGGTGTCGGGCTGGGGGACGG - Intergenic
986549623 5:8938137-8938159 ACGGGTGTCGGGCTGGGGGACGG - Intergenic
987132276 5:14871322-14871344 GCGGGCGTGGGGCGCGGGGCCGG + Intronic
987490855 5:18578851-18578873 ACGGGTGTCGGGCTGGGGGACGG - Intergenic
988379988 5:30487202-30487224 ACGGGTGTCGGGCTGGGGGACGG + Intergenic
988850602 5:35176782-35176804 ACGGGTGTCGGGCTGGGGGACGG - Intronic
989586454 5:43077589-43077611 ATGGGTGTCGGGCTGGGGGATGG + Intronic
989640754 5:43580817-43580839 ACGGGTGTTGGGCTGGGGGATGG - Intergenic
989837408 5:46009484-46009506 ATGGGTGTCGGGCTGGGGGATGG + Intergenic
990414289 5:55571468-55571490 ACGGGTGTTGGGCTGGGGGACGG - Intergenic
990789747 5:59464183-59464205 ACGGGTGTCGGGCTGGGGGACGG - Intronic
992320208 5:75606382-75606404 ACGGGTGTCGGGCTGGGGGACGG + Intergenic
992459316 5:76945347-76945369 ATGGGTGTCGGGCTGGGGGACGG - Intergenic
992779097 5:80112111-80112133 ACGGGTGTCGGGCTGGGGGACGG - Intronic
993889564 5:93457159-93457181 ACGGGTGTCGGGCTGGGGAACGG + Intergenic
994404594 5:99328820-99328842 ACGCGTGTCGGGCTGGGGGACGG - Intergenic
994531997 5:100983583-100983605 ACGGGTGTCGGGCTGGGGGACGG + Intergenic
995816277 5:116171827-116171849 ACGGGTGTGGGGCTAGGGGAGGG + Intronic
995878853 5:116821527-116821549 ACGGGTGTCGGGCTGGGGGACGG - Intergenic
996163415 5:120195233-120195255 ACGGGTGTCGGGCTGGGGGACGG + Intergenic
999216927 5:149943043-149943065 ACGGGTGTTGGGCTGGGGGATGG + Intronic
999419250 5:151426719-151426741 ATGGGTGTCGGGCTGGGGGATGG + Intergenic
999560661 5:152797866-152797888 ACTGGTGTCGGGCTGGGGGACGG + Intergenic
999752189 5:154636534-154636556 ACGGGTGTCGGGCTGGGGGACGG + Intergenic
999753038 5:154644228-154644250 ACAGGTGTCGGGCTGGGGGACGG + Intergenic
999951708 5:156658255-156658277 ACAGGTGTCGGGCTGGGGGACGG + Intronic
999952611 5:156666467-156666489 ACAGGTGTCGGGCTGGGGGACGG + Intronic
999989286 5:157034568-157034590 ACGGGTGTCGGGCTCGGGGAGGG + Intronic
1001232108 5:169997424-169997446 ATGGGTGTCGGGCTGGGGGACGG + Intronic
1001289104 5:170443879-170443901 AAGGGAGTCAGGCCCAGGGCAGG + Intronic
1001401821 5:171450711-171450733 AGGGGGGTCGGGGCCGGGGCCGG + Intronic
1002452430 5:179326482-179326504 ATGGGAGTGGGGGGCGGGGCCGG - Intronic
1002482802 5:179514512-179514534 ACGGGTGTCGGGCTGGGGGACGG + Intergenic
1002650593 5:180690129-180690151 ACAGGTGTCGGGCTGGGGGACGG + Intergenic
1002666242 5:180827662-180827684 ACGGGTGTCGGGCTGGGGGACGG - Intergenic
1003066591 6:2909060-2909082 ACGGGTGTCGGGCTGGGGGACGG - Intergenic
1003545091 6:7052101-7052123 AGCGGAGTTGGGCTGGGGGCGGG + Intergenic
1004009066 6:11663921-11663943 AGGGGAGGCGGGCGGGGGGCGGG + Intergenic
1004716956 6:18227136-18227158 AAGGGTGTCGGGCTGGGGGACGG - Intronic
1004924305 6:20403212-20403234 AGGGGAGTCGGGCGTGGGGGAGG + Intronic
1005206438 6:23410638-23410660 AGGGGAGTGGGAGTCGGGGCAGG - Intergenic
1005293401 6:24400601-24400623 ACGGGTGTCGGGCTGGGGGACGG + Intergenic
1005453794 6:25999626-25999648 ACGGGTGTCGGGCTGGGGGACGG - Intergenic
1005525309 6:26641887-26641909 ACGGGTGTCGGGCTAGGGGACGG - Intronic
1005618408 6:27597302-27597324 ACGGGTGTCGGGCTGGGGGACGG + Intergenic
1005638748 6:27775009-27775031 ACAGGTGTCGGGCTGGGGGACGG + Intergenic
1005644214 6:27826205-27826227 ACAGGTGTCGGGCTGGGGGACGG + Intergenic
1006399782 6:33810509-33810531 ACGGGTGTCGGGCTGGGGGACGG + Intergenic
1006538460 6:34720009-34720031 ACGGGTGTCGGGCTGGGGGACGG + Intergenic
1007571472 6:42894251-42894273 ACGGGTGTCGGGCTGGGGGATGG + Intergenic
1007572494 6:42903211-42903233 ACGGGTGTTGGGCTGGGGGATGG + Intergenic
1007624907 6:43240075-43240097 ACGAGTGTCGGGCTGGGGGACGG + Intergenic
1007793531 6:44328591-44328613 ACGGGTGTCGGGCTGGGGGACGG + Intronic
1008578452 6:52883661-52883683 ACGGGTGTCGGGCTGGGGGACGG - Intronic
1008582984 6:52923068-52923090 ACGGGTGTCGGGCTGGGGGACGG - Intergenic
1009193721 6:60660381-60660403 ACGGGTGTTGGGCTGGGGGGCGG - Intergenic
1010001675 6:70955782-70955804 GCGGGAGTGGGCCTCCGGGCCGG - Intronic
1010260100 6:73805573-73805595 ACGGGTGTTGGGCTGGGGGACGG + Intronic
1010423857 6:75704658-75704680 ACGGGTGTTGGGCTGGGGGACGG + Intronic
1010591461 6:77717494-77717516 ACGGGTGTCGGGCTGGGGGACGG + Intronic
1010592398 6:77725956-77725978 ACGGGTGTCAGGCTGGGGGACGG + Intronic
1010686413 6:78859184-78859206 ACGGGTGTCGGGCTGGGGGACGG - Intergenic
1011536552 6:88381984-88382006 ACGGGTGTCGGGCTGGGGGACGG - Intergenic
1011693483 6:89891216-89891238 ACAGGTGTCGGGCTGGGGGACGG - Intergenic
1012120598 6:95361780-95361802 ACGGGTGTCGGGCTGGGGGACGG + Intergenic
1012458140 6:99429767-99429789 ACGGGTGTCGGGCTGGGGGACGG - Intergenic
1013575743 6:111482723-111482745 GCGGGCGCCGGGCGCGGGGCGGG - Intronic
1013709986 6:112885928-112885950 ACGGGGGCCGGTCTGGGGGCGGG + Intergenic
1014396642 6:120931850-120931872 ACAGGTGTCGGGCTGGGGGACGG - Intergenic
1014800832 6:125776398-125776420 ACCGGTGTCGGGCTGGGGGACGG + Intergenic
1015285224 6:131479055-131479077 ACGGGTGTCAGGCTGGGGGATGG - Intergenic
1015394780 6:132721355-132721377 ACGGGTGTCGGGCTGGGGGACGG + Intergenic
1015574784 6:134659659-134659681 ACGGGTGTCGGGCTGGGGGACGG + Intergenic
1015589096 6:134805285-134805307 TCGGTAGTGGGGGTCGGGGCAGG - Intergenic
1015878132 6:137844866-137844888 ACGGGTGTCGGGCTGGGGGACGG - Intergenic
1016177330 6:141096789-141096811 ATGGGTGTCGGGCTGGGGGACGG + Intergenic
1017171115 6:151455759-151455781 ACGGGTGTCGGGCTGGGGGACGG + Intronic
1017785400 6:157752762-157752784 ACGGGTGTCGGGCTGGGGGACGG + Intronic
1018024676 6:159795280-159795302 ACGGGTGTCAGGCTGGGGGACGG + Intronic
1018150281 6:160931174-160931196 ACGGGGCTGGGGCCCGGGGCGGG + Intergenic
1018480216 6:164182427-164182449 AGGGCAGGCAGGCTCGGGGCAGG - Intergenic
1019071244 6:169346834-169346856 ACGGGTGTCGGGCTGGGGGACGG + Intergenic
1019519655 7:1454910-1454932 TCTGGAGGCGGGCTCAGGGCTGG - Intronic
1019687537 7:2389954-2389976 ACGGGTGTCGGGCTGGGGGACGG + Intergenic
1019976135 7:4582975-4582997 ACGGGTGTCGGGCTGGGGGACGG + Intergenic
1019977069 7:4591479-4591501 ACGGGTGTCGGGCTGGGGGACGG + Intergenic
1019978005 7:4599982-4600004 ACGGGTGTCGGGCTGGGGGACGG + Intergenic
1020313061 7:6883954-6883976 ACGGGTGTCGGGCTCGTGGACGG + Intergenic
1021067781 7:16198118-16198140 ACGGGTGTCGGGCTGGGGGACGG - Intronic
1021671589 7:23040252-23040274 ACGGGTGTCGGGCTGGGGGACGG - Intergenic
1021747553 7:23757760-23757782 ATGGGTGTCGGGCTGGGGGACGG + Intronic
1022164308 7:27742202-27742224 ACGGATGTCGGGCTGGGGGATGG + Intronic
1022477188 7:30719158-30719180 ACAGGTGTCGGGCTGGGGGACGG + Intronic
1024313257 7:47990069-47990091 ACGGGTGTCGGGCTGGGGGATGG - Intronic
1024746501 7:52413064-52413086 ACGTGAGGCAAGCTCGGGGCAGG + Intergenic
1025075968 7:55943456-55943478 ACGGGTGTCGGGCTGGGGGACGG + Intergenic
1025850976 7:65243582-65243604 ACGGGTGTCGGGCTGGGGGACGG + Intergenic
1025853652 7:65260704-65260726 TCGGGTGTCGGGCTGGGGGACGG + Intergenic
1025932270 7:66005259-66005281 ACGGGTGTCAGGCTGGGGGATGG + Intergenic
1026188656 7:68104331-68104353 ACGGGTGTCAGGCTGGGGGATGG + Intergenic
1027188574 7:75985509-75985531 ACGGGACTTGGGGCCGGGGCTGG + Intronic
1027221464 7:76216879-76216901 GAGAGAGTCGGGCTGGGGGCTGG - Intronic
1027372183 7:77518089-77518111 ACGGGGGTCGGGGTCGGGGATGG - Intergenic
1029076870 7:97941597-97941619 ACTGGTGTCGGGCTCAGGGATGG + Intergenic
1029966717 7:104748317-104748339 ACGGGTGTCGGGCTGGGGGACGG - Intronic
1031606984 7:123781033-123781055 ACGGGTGTCGGGCTGGGGGACGG - Intergenic
1031724598 7:125221719-125221741 ACGGGTGTCGGGCTGGGGGACGG + Intergenic
1031795424 7:126168556-126168578 ACGGGTGTCGGGCTGGGGGACGG - Intergenic
1031995802 7:128230046-128230068 AAGGAAGACGGGCTGGGGGCTGG - Intergenic
1033349877 7:140553526-140553548 ATGGGTGTCGGGCTGGGGGACGG + Intronic
1034428425 7:151027422-151027444 ATGGGTGTCGGGCTGGGGGACGG - Intergenic
1034448779 7:151126486-151126508 AGGGGAGTCGGGACGGGGGCGGG + Intronic
1035167411 7:156999980-157000002 CCGGGGGGCGGGCCCGGGGCCGG + Intronic
1035349658 7:158237187-158237209 ACGGGTGTCGGGCTGGGGGACGG - Intronic
1035518019 8:253181-253203 ACAGGTGTCGGGCTGGGGGACGG - Intergenic
1036261148 8:7241234-7241256 ACGGGGGGCGGGCTGGGGGATGG + Intergenic
1036291683 8:7498424-7498446 ACGGGTGTCGGGCTGGGGGACGG + Intronic
1036292615 8:7506927-7506949 ACGGGTATCGGGCTGGGGGACGG + Intronic
1036305457 8:7598313-7598335 ACGGGGGGCGGGCTGGGGGATGG - Intergenic
1036313187 8:7699778-7699800 ACGGGGGGCGGGCTGGGGGATGG + Intergenic
1036356307 8:8046310-8046332 ACGGGGGGCGGGCTGGGGGATGG - Intergenic
1036848352 8:12185047-12185069 GCGGCAGTCGGGGTCAGGGCTGG - Intronic
1036869714 8:12427328-12427350 GCGGCAGTCGGGGTCAGGGCTGG - Intronic
1037429447 8:18794345-18794367 ACGGGTGTCGGGCTGGGGGACGG - Intronic
1038730068 8:30118970-30118992 ATGGGTGTCGGGCTGGGGGATGG + Intronic
1039392647 8:37193917-37193939 ACGGGTGTCGGGCTGGGGGACGG + Intergenic
1039674590 8:39647564-39647586 ACGGGTGTCAGGCTGGGGGACGG + Intronic
1039842900 8:41306639-41306661 TCGGGAGTGGGGCTTGGGACTGG - Intronic
1039903279 8:41767704-41767726 CCGGCCGGCGGGCTCGGGGCGGG + Intronic
1040126160 8:43740088-43740110 ACGGGTGTCGGGCTGGGGGATGG + Intergenic
1040413302 8:47176582-47176604 ACGGGTGTCGGGCTGGGGGACGG + Intergenic
1041060747 8:54032230-54032252 ACGGGTGTCGGGCTGGGGGACGG + Intergenic
1041511547 8:58659470-58659492 ACGGGAGGCGGCGTGGGGGCCGG - Exonic
1041513062 8:58672290-58672312 ACGGGTGTCGGGCTGGGGGACGG + Intergenic
1041786484 8:61639816-61639838 ACTGGAGTCAAGCACGGGGCAGG - Intronic
1042858886 8:73294461-73294483 ACGGCTGGCGGGCTGGGGGCTGG + Intronic
1044310172 8:90684428-90684450 ACGGGTGTCGGGCTGGGGGACGG - Intronic
1044310304 8:90685275-90685297 ACGGGTGTCGGGCTGGGGGACGG - Intronic
1045488516 8:102653828-102653850 AAGGGAGTGGGGCGCGAGGCAGG + Intronic
1048728869 8:137414897-137414919 ACTGGTGTCGGGCTGGGGGATGG + Intergenic
1049171604 8:141164796-141164818 ACGAGAGGCAGGCTCGTGGCTGG - Intronic
1049481933 8:142829237-142829259 ATGGGTGTCGGGCTGGGGGACGG - Intergenic
1049557017 8:143287833-143287855 ACGGGTGTCAGGCTGGGGGACGG + Intergenic
1049621038 8:143598480-143598502 CCGGGCGCGGGGCTCGGGGCTGG - Exonic
1049663631 8:143832385-143832407 ACGGGTGTCGGGCTGGGGGACGG - Intergenic
1049667116 8:143850252-143850274 ACGGGTGTCGGGCTGGGGGACGG + Intergenic
1049845020 8:144796290-144796312 ACGGGTGTCGGGCTGGGGGACGG - Intergenic
1049867723 8:144949853-144949875 ACGGGCGTTGGGCTGGGGGACGG - Intronic
1050972511 9:11895071-11895093 ACCGGTGTCGGGCTGGGGGACGG + Intergenic
1051170663 9:14315641-14315663 ACGGGCGACGGGGTGGGGGCGGG - Intronic
1051471281 9:17445757-17445779 ACGGGTGTCGGGCTGGGGGATGG - Intronic
1052279370 9:26715700-26715722 ACGGGTGTCGGGCTGGAGGACGG + Intergenic
1052279387 9:26715760-26715782 ACGGGTGTCGGGCTGGGGGACGG + Intergenic
1052676582 9:31633428-31633450 ACGGGTGTCGGGCTGGGGGACGG + Intergenic
1052871897 9:33515416-33515438 ACGGGTGTTGGGCTGGGGGATGG + Intergenic
1054322240 9:63682158-63682180 ATGGGTGTCGGGCTGGGGGACGG + Intergenic
1054843112 9:69763686-69763708 ACGGGTGTCGGGCTGGGGGACGG + Intergenic
1055157950 9:73087756-73087778 ACGGGTGTCGGGCTGGGGGACGG + Intergenic
1055321746 9:75088820-75088842 TCGGAAGCCAGGCTCGGGGCCGG - Intronic
1056567317 9:87785512-87785534 ACAGGTGTCGGGCTGGGGGATGG + Intergenic
1057685705 9:97232539-97232561 ACCGGTGTCGGGCTGGGGGATGG - Intergenic
1058806253 9:108595001-108595023 ACAGGTGTCGGGCTGGGGGACGG - Intergenic
1059309696 9:113379640-113379662 GCGGGTGTCGGGCTGGGGGACGG + Intergenic
1059428174 9:114234092-114234114 AAGGGAGCTGGGCTCGGAGCAGG - Intronic
1060147897 9:121268085-121268107 GCGGGAGCCGCCCTCGGGGCGGG - Intronic
1060167361 9:121429502-121429524 ACGGGTGTCGGGCTGGGGGATGG - Intergenic
1060309733 9:122448508-122448530 ACGGGCGTCAGGCTGGGGGATGG + Intergenic
1060831051 9:126716925-126716947 ATGGGAGTCGGGCTGGGGGACGG - Intergenic
1061149061 9:128818711-128818733 CCTGGCGTCGGGCGCGGGGCTGG + Exonic
1061235016 9:129337125-129337147 GTGGGAGTCGGGCTGGAGGCAGG + Intergenic
1061554250 9:131357107-131357129 ACGGGTGTCGGGCTGGGGGACGG - Intergenic
1061588234 9:131582319-131582341 ATGAGAGTGGGGCTGGGGGCTGG + Intronic
1061841689 9:133362157-133362179 GAGGGAGGCAGGCTCGGGGCTGG + Exonic
1061919866 9:133776756-133776778 ACGGGACTGGGGCTGGGGTCGGG + Intronic
1061955276 9:133958169-133958191 ACGGGTGTCGGGCTGGGGGACGG - Intronic
1061979511 9:134092985-134093007 ACGGGTGTCGGGCTGGGGGACGG + Intergenic
1062489278 9:136796926-136796948 ACTGGTGTCGGGCTGGGGGATGG - Intronic
1203456775 Un_GL000219v1:175607-175629 ACGGGTGTCGGGCTGGGGGACGG - Intergenic
1185575803 X:1171337-1171359 ACGGGTGTCGGGCTGGGGGACGG - Intergenic
1185682512 X:1900053-1900075 ATGGGTGTCGGGCTGGGGGATGG + Intergenic
1187181353 X:16946569-16946591 GCGGGAGGCGGGGGCGGGGCCGG + Intergenic
1187198865 X:17115559-17115581 ACGGGTGTCGAGCTGGGGGACGG + Intronic
1187858580 X:23660413-23660435 ACGGGTGTCGGGCTGGGGGACGG + Intergenic
1188139065 X:26526021-26526043 ACAGGTGTCGGGCTGGGGGACGG + Intergenic
1190261801 X:48802201-48802223 ACCGGGGTCGGGGCCGGGGCCGG + Intronic
1190726408 X:53193291-53193313 ACGGGAGTCGGGCTCGGGGCCGG - Exonic
1191033331 X:55998319-55998341 ACGGGTGTCGGGCTGGGGGACGG + Intergenic
1193964806 X:87972451-87972473 ACGGATGTCGGGCTGGGGGATGG - Intergenic
1194200762 X:90951012-90951034 ACGGGTGTCGGGCTGGGGGACGG - Intergenic
1195933552 X:110103626-110103648 ATGGGGGTCGGGGTGGGGGCAGG + Intronic
1195965396 X:110425442-110425464 AGGGCAGTGGGGCTCTGGGCTGG + Intronic
1196889485 X:120278132-120278154 ACGAAAGTCGGGGTCGGGGGTGG - Intronic
1197194017 X:123680059-123680081 ACGGGTGTCGGACTGGGGGACGG - Intronic
1197383850 X:125779907-125779929 ACGGGTGTCGGGCTGGGGGACGG - Intergenic
1197509539 X:127354348-127354370 ACGGGTGTCAGGCTGGGGGATGG - Intergenic
1197707419 X:129644345-129644367 AAGGGAGTGGGGCATGGGGCAGG - Intergenic
1198268197 X:135030742-135030764 ACAGGTGTCGGGCTAGGGGACGG - Intergenic
1198297691 X:135303286-135303308 ATGGGTGTCGGGCTGGGGGACGG + Intronic
1198308572 X:135406495-135406517 ACGGGTGTCGGGCTGGGGGACGG - Intergenic
1198424003 X:136497091-136497113 ACCGGGGTCGGGTTTGGGGCGGG - Exonic
1198602260 X:138296331-138296353 ACGGGTGTCAGGCTGGGGGATGG + Intergenic
1198605624 X:138333883-138333905 ACGGGTGTCAGGCTGGGGGATGG - Intergenic
1199256218 X:145721390-145721412 ACGGGTGTCAGGCTGGGGGACGG + Intergenic
1199612097 X:149627088-149627110 ACGGGTGTCGGGCTGGGGGGTGG + Intronic
1199896189 X:152130015-152130037 ACGGGTGTCGGGCTGGGGGATGG - Intergenic
1200145851 X:153926316-153926338 CCGGGAGCCGCGCTGGGGGCGGG - Intronic
1200245429 X:154521583-154521605 ACGGGTGTTGGGCTGGGGGACGG - Intergenic
1200257134 X:154589058-154589080 ACGGGTGTTGGGCTGGGGGACGG - Intergenic
1200259948 X:154608997-154609019 ACGGGTGTCAGGCTGGGGGACGG + Intergenic
1200260635 X:154615344-154615366 ACGGGTGTTGGGCTGGGGGACGG + Intergenic
1200294977 X:154910730-154910752 ACGGGTGTCGGGCTGGGGGACGG - Intronic
1200487061 Y:3782830-3782852 ACGGGTGTCGGGCTGGGGGATGG - Intergenic
1200555735 Y:4634450-4634472 ACGGGTGTCGGGCTGGGGGACGG - Intergenic
1200731646 Y:6749284-6749306 ACGGGTGTCGGGCTGGGGGATGG - Intergenic
1200777211 Y:7180272-7180294 ACGGGTGTCGGGCTGGGGGAAGG - Intergenic
1200833633 Y:7711735-7711757 ACAGGTGTCGGGCTAGGGGATGG - Intergenic
1201356709 Y:13104371-13104393 ACGGGTGTCGGGCTGGGGGACGG + Intergenic
1201604919 Y:15773715-15773737 ACGGGTGTTGGGCTGGGGGATGG + Intergenic
1201962745 Y:19700028-19700050 ATGGGTGTCGGGCTGGGGGATGG + Intergenic
1202253155 Y:22893588-22893610 ACGGGTGTCGGGCTGGGGGACGG + Intergenic
1202406145 Y:24527337-24527359 ACGGGTGTCGGGCTGGGGGACGG + Intergenic
1202464637 Y:25142744-25142766 ACGGGTGTCGGGCTGGGGGACGG - Intergenic