ID: 1190726707

View in Genome Browser
Species Human (GRCh38)
Location X:53194745-53194767
Sequence TACCCAGGACAGGAGCAAAG TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 270
Summary {0: 1, 1: 0, 2: 2, 3: 29, 4: 238}

Found 10 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1190726702_1190726707 -1 Left 1190726702 X:53194723-53194745 CCTTGAAGGCCACGATCTGCCAT 0: 1
1: 1
2: 0
3: 7
4: 151
Right 1190726707 X:53194745-53194767 TACCCAGGACAGGAGCAAAGTGG 0: 1
1: 0
2: 2
3: 29
4: 238
1190726693_1190726707 24 Left 1190726693 X:53194698-53194720 CCCTCCTTCTCCTTCTGTTCCCC 0: 2
1: 1
2: 12
3: 233
4: 1927
Right 1190726707 X:53194745-53194767 TACCCAGGACAGGAGCAAAGTGG 0: 1
1: 0
2: 2
3: 29
4: 238
1190726700_1190726707 3 Left 1190726700 X:53194719-53194741 CCCTCCTTGAAGGCCACGATCTG 0: 1
1: 1
2: 0
3: 16
4: 80
Right 1190726707 X:53194745-53194767 TACCCAGGACAGGAGCAAAGTGG 0: 1
1: 0
2: 2
3: 29
4: 238
1190726695_1190726707 20 Left 1190726695 X:53194702-53194724 CCTTCTCCTTCTGTTCCCCCTCC 0: 1
1: 3
2: 38
3: 695
4: 4368
Right 1190726707 X:53194745-53194767 TACCCAGGACAGGAGCAAAGTGG 0: 1
1: 0
2: 2
3: 29
4: 238
1190726701_1190726707 2 Left 1190726701 X:53194720-53194742 CCTCCTTGAAGGCCACGATCTGC 0: 1
1: 0
2: 1
3: 8
4: 74
Right 1190726707 X:53194745-53194767 TACCCAGGACAGGAGCAAAGTGG 0: 1
1: 0
2: 2
3: 29
4: 238
1190726699_1190726707 4 Left 1190726699 X:53194718-53194740 CCCCTCCTTGAAGGCCACGATCT 0: 1
1: 0
2: 1
3: 9
4: 96
Right 1190726707 X:53194745-53194767 TACCCAGGACAGGAGCAAAGTGG 0: 1
1: 0
2: 2
3: 29
4: 238
1190726696_1190726707 14 Left 1190726696 X:53194708-53194730 CCTTCTGTTCCCCCTCCTTGAAG 0: 1
1: 1
2: 0
3: 28
4: 291
Right 1190726707 X:53194745-53194767 TACCCAGGACAGGAGCAAAGTGG 0: 1
1: 0
2: 2
3: 29
4: 238
1190726704_1190726707 -10 Left 1190726704 X:53194732-53194754 CCACGATCTGCCATACCCAGGAC 0: 1
1: 0
2: 0
3: 6
4: 104
Right 1190726707 X:53194745-53194767 TACCCAGGACAGGAGCAAAGTGG 0: 1
1: 0
2: 2
3: 29
4: 238
1190726694_1190726707 23 Left 1190726694 X:53194699-53194721 CCTCCTTCTCCTTCTGTTCCCCC 0: 1
1: 2
2: 36
3: 445
4: 3503
Right 1190726707 X:53194745-53194767 TACCCAGGACAGGAGCAAAGTGG 0: 1
1: 0
2: 2
3: 29
4: 238
1190726698_1190726707 5 Left 1190726698 X:53194717-53194739 CCCCCTCCTTGAAGGCCACGATC 0: 1
1: 0
2: 1
3: 3
4: 169
Right 1190726707 X:53194745-53194767 TACCCAGGACAGGAGCAAAGTGG 0: 1
1: 0
2: 2
3: 29
4: 238

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1190726707 Original CRISPR TACCCAGGACAGGAGCAAAG TGG Intronic
900006355 1:56341-56363 CACACAGGACAGGAGCACATTGG + Intergenic
900437083 1:2635846-2635868 TATCCAGGGCAGGAGGGAAGGGG + Intergenic
900935758 1:5765474-5765496 TGCCTAGGACCAGAGCAAAGTGG + Intergenic
901779030 1:11580524-11580546 TGCCCAGGTGAGGAGCAAAGAGG - Intergenic
901871672 1:12142222-12142244 CAGCCAGGATGGGAGCAAAGAGG - Intronic
902689402 1:18100697-18100719 TGTCCAGGAAAGGAGGAAAGAGG + Intergenic
903406936 1:23105189-23105211 GAACCAGGACAGTAGCAATGGGG + Intronic
904875428 1:33651208-33651230 AAACCAGGACAGGAGCTAGGAGG + Intronic
906459359 1:46025518-46025540 CACCCATGCCAGCAGCAAAGGGG + Intronic
906662404 1:47592546-47592568 AGCCCAGGACTGGGGCAAAGAGG + Intergenic
910492931 1:87793029-87793051 TGCAGAGGACAGGAGCAGAGGGG - Intergenic
911216047 1:95196267-95196289 ACCCCATGACAGGAGCACAGAGG + Exonic
911683432 1:100745743-100745765 TACCCAGGATAGATGAAAAGTGG - Intergenic
913969418 1:143403275-143403297 TCCCCAGTTCAGGAGCAAGGAGG - Intergenic
914063795 1:144228874-144228896 TCCCCAGTTCAGGAGCAAGGAGG - Intergenic
914115355 1:144737480-144737502 TCCCCAGTTCAGGAGCAAGGAGG + Intergenic
915016193 1:152736521-152736543 TTCCCTGGACAGGAGCCAAGAGG - Intergenic
917451662 1:175152293-175152315 CACCCAGGAAAAGAGAAAAGTGG - Intergenic
917964413 1:180169347-180169369 TACACAGCACAGCAGCATAGGGG + Intronic
919626601 1:199916684-199916706 CACCCAGGCCTGGAGCACAGTGG + Intergenic
920101933 1:203522167-203522189 GCCCCAGGACAGGTGCAGAGTGG - Intergenic
920854140 1:209649930-209649952 TTCCCAGGACTGGAGGAAGGCGG - Intronic
921805547 1:219450171-219450193 AACACAGGACAGCAGAAAAGAGG - Intergenic
923877632 1:238066691-238066713 TCACCAGGACAGAAGCAATGAGG - Intergenic
1063197562 10:3757981-3758003 GACCCTGTCCAGGAGCAAAGTGG + Intergenic
1063439005 10:6056916-6056938 TGTCCAGGGCAGGAGCACAGTGG + Intronic
1065133514 10:22645504-22645526 TACCCAGAACTGGAGCACAGTGG - Intronic
1065309415 10:24400130-24400152 ATCCCAGGAAAGCAGCAAAGAGG + Intronic
1068488155 10:57685775-57685797 TACCCAGGACAGGTGAAATGAGG - Intergenic
1068787207 10:60989659-60989681 TACCCAGAGTAGGGGCAAAGTGG - Intronic
1069943122 10:71968971-71968993 TACCCTGGAGAGGACCAAAAAGG - Intronic
1071265903 10:83964709-83964731 TATACATGACTGGAGCAAAGGGG + Intergenic
1072464424 10:95650018-95650040 TACCCAGGGCTAGAGCATAGTGG - Intronic
1073429443 10:103476723-103476745 TCCCCAGGACTGGAGCACTGAGG + Intronic
1074060907 10:109964742-109964764 TTCCCAGGACAGCAAGAAAGTGG + Intergenic
1074577706 10:114686061-114686083 AAGGCAGGACAGGGGCAAAGTGG + Intergenic
1075267780 10:121019308-121019330 TCTGAAGGACAGGAGCAAAGTGG + Intergenic
1075715882 10:124555154-124555176 CACCCAGGAAGAGAGCAAAGGGG - Intronic
1076045689 10:127292513-127292535 TGCCTAGGAGAGGAGCAAACAGG + Intronic
1076415158 10:130281060-130281082 TACCAGGGATAGGAGCAAAGGGG + Intergenic
1078335798 11:10462372-10462394 TACCCAGGACAGGAGTGACAAGG + Intronic
1078879364 11:15433004-15433026 TAAATAGGACAGGAGAAAAGGGG - Intergenic
1079308219 11:19343330-19343352 TAACCATCACAGGGGCAAAGTGG + Intergenic
1080641231 11:34159710-34159732 GACCCAGGGCAGCAGGAAAGGGG - Intronic
1081743531 11:45457400-45457422 CACACAGGACAGCAGCCAAGTGG + Intergenic
1083142431 11:60733175-60733197 CAGCCAGGACAGGAGCCAGGTGG + Intronic
1083526595 11:63372065-63372087 TTCCCAGGACAGTATCACAGAGG - Intronic
1083882456 11:65555296-65555318 TACACAGGGAAGGAGCAGAGGGG - Intronic
1085408809 11:76279746-76279768 CACCCAGGATAGGAGCAGAGGGG - Intergenic
1085772494 11:79337828-79337850 TGCCAAGGACAGGGGCAAAGTGG + Intronic
1086375850 11:86200136-86200158 CAGCCAGGACAGGAGTTAAGAGG + Intergenic
1087159436 11:94934655-94934677 TACACAGGCCAGGAGGAAGGTGG + Intergenic
1088354907 11:108932652-108932674 TATCCAGGAAAGAAACAAAGTGG - Intronic
1088536405 11:110866652-110866674 CAACAAGGACAGGAGCAAATGGG - Intergenic
1088682574 11:112256519-112256541 GAACCAGGCCAGGTGCAAAGCGG - Intronic
1088827079 11:113505036-113505058 TACCCAAGAGTAGAGCAAAGAGG + Intergenic
1089011710 11:115136933-115136955 TTCTCAGGACAGGAGGAAAGTGG + Intergenic
1089014903 11:115157758-115157780 TTCCCAGGACAGAAGCACAGAGG - Intergenic
1089556925 11:119320172-119320194 GACCCAGGGCAGGAGGAAGGAGG + Intronic
1091059946 11:132451983-132452005 AACCCAGGGAGGGAGCAAAGCGG - Intronic
1093246989 12:16751086-16751108 TACACAGGACACGTGCAGAGTGG + Intergenic
1097050873 12:56222333-56222355 TTCCCATGACAGGAGTCAAGGGG - Intronic
1097258401 12:57697966-57697988 TTACCAGGACAGGAGCAATAGGG - Intronic
1100374109 12:93996448-93996470 TACCCAGGACCTGAGCTTAGAGG + Intergenic
1101337680 12:103810775-103810797 TACCCAGGACTGTAGGAAATAGG - Intronic
1101825902 12:108219757-108219779 TACCCAGGACAACCCCAAAGGGG + Intronic
1102027806 12:109723482-109723504 GACCCAGGACAGGAGAAGGGTGG - Intronic
1102101142 12:110280397-110280419 TTCCCTCGACAGGAGAAAAGGGG - Intergenic
1105706319 13:22969629-22969651 TGACCAGGACAGGAGCTCAGAGG + Intergenic
1105858969 13:24393087-24393109 TGACCAGGACAGGAGCTCAGAGG + Intergenic
1106384042 13:29267102-29267124 TGCCCATCACAGGAGCAGAGGGG + Intronic
1107998439 13:45884539-45884561 TACCCAGCACCAGAGCACAGGGG + Intergenic
1110496777 13:76177015-76177037 TACACAGTACAGGTGGAAAGTGG - Intergenic
1110708822 13:78627200-78627222 TAAGAAGGACAGGAACAAAGCGG + Intronic
1112212155 13:97388555-97388577 CCCACAGGACAGGAGGAAAGTGG - Intronic
1113635601 13:111916983-111917005 GACCCAGGACAGTCTCAAAGTGG - Intergenic
1113681299 13:112246980-112247002 TCCCAATGACAGGAGCAAAGAGG - Intergenic
1113781670 13:112980918-112980940 GACCCTGGACATGAGCACAGTGG + Intronic
1114059052 14:19002254-19002276 CACCCAGGAGACAAGCAAAGTGG + Intergenic
1114103491 14:19399500-19399522 CACCCAGGAGACAAGCAAAGTGG - Intergenic
1114375248 14:22139183-22139205 TCCCCAGGAGAGGAGCACAACGG - Intergenic
1114621388 14:24098389-24098411 TAACCAGGGCAGGGGCACAGTGG + Intronic
1116706415 14:48307881-48307903 TGCCCAGGTCAGGATGAAAGAGG + Intergenic
1117137483 14:52751806-52751828 CTCCCAGGATAGGAGCAAGGTGG - Intronic
1117753001 14:58943148-58943170 TACTCAGGAGAGAAGTAAAGAGG + Intergenic
1119204599 14:72784620-72784642 CATACAGGCCAGGAGCAAAGCGG + Intronic
1119421203 14:74508996-74509018 TCCCAAGGACAGGAGTCAAGGGG + Intronic
1122791291 14:104185222-104185244 TTCCCAGGAGAGGAGCAGACAGG - Intergenic
1123463576 15:20496429-20496451 GACCCACGAGAGGAGGAAAGAGG + Intergenic
1127964989 15:63916581-63916603 TTCCCAGGAAAGGAGCACATGGG + Intronic
1128691339 15:69726851-69726873 CCCCCAGGCCAGCAGCAAAGGGG - Intergenic
1130440293 15:83946117-83946139 AAGCAAGGACAGAAGCAAAGTGG - Intronic
1131344697 15:91635524-91635546 TCCCCAGGAGAGCAGGAAAGTGG - Intergenic
1131387659 15:92020444-92020466 TTCCCAGGACAGGGGTCAAGTGG - Intronic
1132447166 15:101934617-101934639 CACACAGGACAGGAGCACATTGG - Intergenic
1132806358 16:1776899-1776921 CACCCAGCACAGCAGCAGAGGGG + Exonic
1133800931 16:9084737-9084759 TTCCCAGGTCAGAAACAAAGCGG + Intergenic
1134075823 16:11290643-11290665 TTCTCAGCACAGGAGCACAGGGG - Intronic
1138109490 16:54312210-54312232 GCCCCAGGACAGGAAGAAAGAGG + Intergenic
1138607227 16:58097082-58097104 CACCCAGGCCAGGAGCCATGTGG + Intergenic
1140050251 16:71474231-71474253 TAGCCAGGTCAAGGGCAAAGCGG + Exonic
1141600061 16:85120235-85120257 TCCCCAGGACAGGAGATAAAGGG + Intergenic
1144642955 17:16948755-16948777 TACCAAGGATTGGAGCACAGAGG - Exonic
1146662240 17:34672514-34672536 TTCCCAGGACATGAGCAGAGGGG + Intergenic
1151026817 17:70686641-70686663 TACCCTGGAGAGGGGAAAAGAGG + Intergenic
1151521136 17:74630489-74630511 TAACCTGGACTGGAGTAAAGTGG - Intergenic
1153479249 18:5530600-5530622 TACAGAGGCCAGGAGGAAAGAGG - Intronic
1156471415 18:37379269-37379291 TACCCACGCCAGGGCCAAAGGGG - Intronic
1156685025 18:39633934-39633956 AACCAAAGACAGGAGAAAAGGGG - Intergenic
1156910925 18:42410111-42410133 TACTCAGGACAGTACCAAGGGGG + Intergenic
1157575133 18:48738544-48738566 TACCCAGGAGAAGAGCAATCCGG - Intronic
1159371699 18:67535683-67535705 TTACCAAGACAGCAGCAAAGGGG + Intergenic
1160620371 18:80166654-80166676 GAGCCAGGACAGGATGAAAGGGG - Intronic
1160638110 19:97916-97938 CACACAGGACAGGAGCACATTGG + Intergenic
1161423318 19:4187701-4187723 CACCCAGGCCAGGCACAAAGAGG - Intronic
1161579077 19:5070893-5070915 TGCCCAGGGCAGAAGCAAAGTGG - Intronic
1163003046 19:14381079-14381101 TTCCCTGGGCAGGCGCAAAGGGG - Intronic
1163422090 19:17219441-17219463 TTCCCAGCACAGGAGCATTGTGG + Intronic
1163547211 19:17947693-17947715 AACTCAGGACAGGAGCTGAGAGG + Intergenic
1166920774 19:46227536-46227558 TCCCCAGGGCAGGGGCAAGGTGG - Intergenic
1202682529 1_KI270712v1_random:20518-20540 TACATAGGACAGAAGCAAATAGG - Intergenic
925214523 2:2083262-2083284 TACCCAGGGCAAGAGCTGAGTGG - Intronic
926759124 2:16261910-16261932 AACCCAGGGCAGGAGGACAGGGG - Intergenic
926773609 2:16400493-16400515 TTCCCAGCACTTGAGCAAAGGGG + Intergenic
928054398 2:28037189-28037211 TTACCTGGACAGGAGGAAAGTGG - Intronic
928322740 2:30296212-30296234 GACCAAGGCCAGGAGCACAGTGG - Intronic
928718936 2:34096929-34096951 TACCCAGGTCAAGAACAAAGTGG - Intergenic
929091491 2:38221946-38221968 GTCCCAGGACAGGAGCAAGCAGG + Intergenic
929453399 2:42050761-42050783 TACCCAGGAAAAGTGAAAAGTGG + Intronic
929510821 2:42564713-42564735 AACCCAGGACAGGAGCCTGGAGG - Intronic
929549327 2:42879515-42879537 TGGCCAGGACTGGATCAAAGGGG + Intergenic
929991168 2:46788148-46788170 TACCCAGGACTGGAGTGCAGTGG - Intergenic
933015278 2:77116051-77116073 TACATAGGACTGGAGCAAAATGG + Intronic
934174111 2:89564178-89564200 TCCCCAGTTCAGGAGCAAGGAGG - Intergenic
934284426 2:91638527-91638549 TCCCCAGTTCAGGAGCAAGGAGG - Intergenic
935060385 2:99601921-99601943 TTCCCAGAACAGCAGCAAAATGG - Intronic
935849174 2:107199714-107199736 TACCCTGGACTGAGGCAAAGAGG - Intergenic
936685198 2:114819757-114819779 TACCCAGGAGGAGAGCAATGGGG - Intronic
937340658 2:121088642-121088664 TCCCCAGGAGAGGAGGAAAAAGG + Intergenic
938161154 2:128985619-128985641 TTCCCAGGACAGAAACACAGTGG - Intergenic
938282133 2:130071978-130072000 CACCCAGGAAACAAGCAAAGTGG - Intergenic
938332760 2:130460550-130460572 CACCCAGGAAACAAGCAAAGTGG - Exonic
938357048 2:130660121-130660143 CACCCAGGAAACAAGCAAAGTGG + Intergenic
938433482 2:131266927-131266949 CACCCAGGAAACAAGCAAAGTGG + Intronic
939627591 2:144497008-144497030 AACACAGGGCATGAGCAAAGAGG - Intronic
939994459 2:148907168-148907190 TTCACAGGACAGCAGCAAAGAGG - Intronic
940394139 2:153167849-153167871 TGTCCAGGAAAGGAACAAAGAGG + Intergenic
946767623 2:223054606-223054628 TTCCCAGGACTGAAGGAAAGAGG + Exonic
948687464 2:239677938-239677960 TACCCAGGCCAGGAGAAAGGAGG - Intergenic
1169144097 20:3241127-3241149 TACACAGGACAGGAGGCAGGTGG - Intergenic
1171524262 20:25797097-25797119 TGCCTAGCAGAGGAGCAAAGAGG + Intronic
1171524603 20:25799077-25799099 TTTCCAGGACAGGTGCAAACAGG + Intronic
1171533396 20:25866615-25866637 TGCCTAGCAGAGGAGCAAAGAGG + Intronic
1171533786 20:25868726-25868748 TTTCCAGGACAGGTGCAAACAGG + Intergenic
1171552224 20:26056806-26056828 TTTCCAGGACAGGTGCAAACAGG - Intergenic
1171552565 20:26058786-26058808 TGCCTAGCAGAGGAGCAAAGAGG - Intergenic
1171793355 20:29548098-29548120 TTTCCAGGACAGGTGCAAACAGG - Intergenic
1173043781 20:39490437-39490459 GACCCAGGGCAGGAGCAATGGGG - Intergenic
1174446495 20:50594552-50594574 TACCCAGGACAGCTGGAAATAGG - Exonic
1175072844 20:56349309-56349331 ACCCCAGGGCTGGAGCAAAGTGG + Intergenic
1180477536 22:15724870-15724892 CACCCAGGAGACAAGCAAAGTGG + Intergenic
1181677270 22:24463727-24463749 TACCCAGGACATAAGAAAGGGGG - Intergenic
1183640723 22:39090820-39090842 CACCCGGGTCAGGAGTAAAGTGG + Intergenic
1184251198 22:43261302-43261324 CACCCAGGGCAGGACCAAACGGG - Intronic
1184426571 22:44412268-44412290 TCCCCAGGAGAGGAGCAAGGGGG - Intergenic
1184428213 22:44425459-44425481 TCCCCAGGACAGGAGCGAGGAGG - Intergenic
1184853574 22:47134764-47134786 AACCCAGGACATGAGCAGAAAGG - Intronic
1184929783 22:47672552-47672574 CTCCAAGGACAGGAACAAAGAGG - Intergenic
949163555 3:910506-910528 CACCCAGGAAAAGGGCAAAGAGG + Intergenic
950475993 3:13215154-13215176 TACACAAGACAGGAGCATGGAGG + Intergenic
950703666 3:14767086-14767108 TACCTAGGACTGGAGCTAACTGG + Intronic
952866341 3:37857715-37857737 GACCAAGGACAGGAGCAGATAGG - Intergenic
953752800 3:45622205-45622227 TACCCAGGGCTGGAGGACAGCGG - Intronic
955656526 3:61250850-61250872 TGCCCAGGACAGGAGCAAACCGG - Intronic
955933106 3:64077470-64077492 GACCCAGGACAGGAGGCAAGAGG + Intergenic
959192635 3:103134499-103134521 TACCAAGGATAGGAGAAAAGAGG + Intergenic
960844789 3:121995438-121995460 TGCCAAGGCCAGCAGCAAAGGGG + Intronic
961238798 3:125392012-125392034 TACCAAGGAGATGAGCAAGGTGG - Intergenic
961393123 3:126568430-126568452 TTCCCGGCACAGGTGCAAAGAGG + Intergenic
962410081 3:135133266-135133288 TGCCCAGCACAAAAGCAAAGAGG + Intronic
962620673 3:137174930-137174952 TACCCAGCACAGGAAAAAAGTGG + Intergenic
962901515 3:139765899-139765921 GAACCAGGGCAGTAGCAAAGAGG - Intergenic
963171874 3:142259590-142259612 TCCACAGGGCAGGAGCATAGGGG + Intergenic
963778613 3:149464874-149464896 TACCCAGGAGAGGAGTACTGTGG - Intergenic
964061098 3:152523955-152523977 TACTCTGGACAGGAACAAAGAGG + Intergenic
964587392 3:158321835-158321857 TACAAAGGAGAGGAGCACAGAGG - Intronic
966709958 3:182961816-182961838 TACACAGTACAGGAGTAAACAGG + Intronic
967689315 3:192455931-192455953 TGCTCAAGACAGAAGCAAAGTGG + Intronic
968322959 3:197787704-197787726 TACAAAGGCCAGGAGCAAAGTGG - Intergenic
969827963 4:9773122-9773144 TTCCCAGTTCAGGAGCAAGGAGG - Intronic
971252498 4:24985225-24985247 CACCCAAGACAGGAGGACAGAGG - Intergenic
971835741 4:31760695-31760717 TACCCAGGACAGGCACAATGTGG + Intergenic
975853262 4:78595431-78595453 TGCCCAGGTCAGTAACAAAGCGG + Exonic
976978409 4:91192616-91192638 TTCCAAGGAGAGGGGCAAAGAGG - Intronic
982377968 4:154715452-154715474 TAGCAAGGGCAAGAGCAAAGTGG - Intronic
983509257 4:168589853-168589875 TATACAGAACAGGAGCAGAGAGG - Intronic
984150072 4:176118692-176118714 TTTCCAGGACAGTAGCACAGTGG + Intronic
987263713 5:16229448-16229470 AACCCAGGACGGCAGCCAAGGGG + Intergenic
992677384 5:79118830-79118852 TACCCAGGACATGGGGCAAGGGG - Intronic
992777815 5:80103681-80103703 TTCAAAGGACAGGAGCAAGGGGG - Intergenic
999257773 5:150219242-150219264 TACCCTCAACAAGAGCAAAGGGG - Intronic
1000282280 5:159792715-159792737 TACAAAGGACAGCAGGAAAGGGG - Intergenic
1001802272 5:174554652-174554674 TGGCCAGGACAGAAGTAAAGGGG + Intergenic
1002450922 5:179318066-179318088 TACCCTGGCCATTAGCAAAGAGG + Intronic
1005716568 6:28554705-28554727 CATCCAAGACAGGAACAAAGCGG - Intergenic
1008328918 6:50221803-50221825 TACTCAGAACTGGAGCAAACTGG - Intergenic
1010162335 6:72871093-72871115 TACGCAGGACTGGGGCATAGAGG - Intronic
1011047522 6:83101982-83102004 TACCAAGGGCAGGAGAAAATGGG - Intronic
1015810943 6:137161789-137161811 TAACCAGCTCAGGACCAAAGAGG + Exonic
1016363397 6:143291353-143291375 TGCCCTGGACAGGAGCCAGGGGG + Intronic
1016880415 6:148905654-148905676 GACCCAGGGAAGGAGCCAAGTGG + Intronic
1017012528 6:150072244-150072266 TAACCGGGCCAGGAGGAAAGAGG + Intergenic
1017849735 6:158294769-158294791 TTCCCAGGCCTGGAGCACAGTGG + Intronic
1017952848 6:159151059-159151081 AGCCCAGGACAGGTGCAGAGGGG + Intergenic
1018362709 6:163087708-163087730 AAACCAGGACTGGAGCAGAGAGG + Intronic
1019681253 7:2351075-2351097 CACCCAGGCCGGGAGCACAGTGG - Intronic
1019858283 7:3631480-3631502 CATAGAGGACAGGAGCAAAGAGG - Intronic
1020174296 7:5869883-5869905 GACCCAGGACAAGAGCACAGAGG + Intergenic
1021748345 7:23767473-23767495 CACCCAGGAGAGAAGCAAAGAGG - Intronic
1022945285 7:35278112-35278134 AACCCAGCACAGGTGAAAAGAGG + Intergenic
1023113960 7:36842143-36842165 TACCAGGGTCAGGAGCTAAGGGG - Intergenic
1023367076 7:39475010-39475032 TACCCAGGCCAGGAGCTGTGGGG - Intronic
1024436111 7:49356616-49356638 TACCAAGGACAGAAAGAAAGAGG - Intergenic
1027363679 7:77434705-77434727 TTCCCAGGGGAGGAGAAAAGGGG + Intergenic
1028904611 7:96138977-96138999 TACCCAGGACTGGAATAATGTGG + Intronic
1029084462 7:98000490-98000512 GACCCAGGACAAGAGCACAGAGG - Intergenic
1031080866 7:117255734-117255756 TACCCAGCCCAGGAAGAAAGGGG + Intergenic
1032271977 7:130417328-130417350 TACACAGAAGAGGAGCAAAAAGG + Intronic
1033102901 7:138491373-138491395 TCCCAAGGACAGAAGGAAAGAGG - Intronic
1034057089 7:148046655-148046677 TACCCAGCTCAAGAACAAAGGGG + Intronic
1037587756 8:20289625-20289647 GTCCCAGGACAGGAGACAAGAGG - Intronic
1040372251 8:46788452-46788474 TCCCCAGAAAATGAGCAAAGAGG - Intergenic
1041309797 8:56504241-56504263 GCCCCAGGAAAGGAGCACAGTGG - Intergenic
1044538840 8:93387538-93387560 TACTCAGGACTGGATCAAACTGG + Intergenic
1046134009 8:110003544-110003566 TGCCCAGAGCAGGAGCAAGGTGG + Intergenic
1047026194 8:120827051-120827073 TACCTAGGAAAGGAAGAAAGAGG - Intergenic
1048635576 8:136291830-136291852 TAGCCAGAGCAGGAGCAAGGAGG + Intergenic
1049864055 8:144922224-144922246 TACCCAGGACTGCAGCACTGAGG - Intergenic
1051259074 9:15244343-15244365 TACCTAGGACAGGAACACAGTGG - Intronic
1053792929 9:41699570-41699592 TTTCCAGGACAGGTGCAAACAGG + Intergenic
1054152248 9:61615255-61615277 TTTCCAGGACAGGTGCAAACAGG - Intergenic
1054181340 9:61911591-61911613 TTTCCAGGACAGGTGCAAACAGG + Intergenic
1054472020 9:65546398-65546420 TTTCCAGGACAGGTGCAAACAGG - Intergenic
1054656254 9:67669551-67669573 TTTCCAGGACAGGTGCAAACAGG - Intergenic
1056888415 9:90466923-90466945 GAACTAGGACAGGAGGAAAGAGG + Intergenic
1057754453 9:97820657-97820679 TACCCAGGAAATGAGCAGTGAGG - Intergenic
1059097680 9:111436141-111436163 TTCCCAGGAGAGGGGAAAAGAGG - Intronic
1059126430 9:111690897-111690919 TCCCCAGGATAGGAGAAAAAGGG - Intronic
1059839084 9:118191973-118191995 CAAACAGGAAAGGAGCAAAGGGG + Intergenic
1060943182 9:127555256-127555278 TACACAGGACAGCAGAAAGGTGG - Intronic
1061259633 9:129472755-129472777 TGCCCAGGCCAGGATGAAAGAGG + Intergenic
1061719386 9:132542399-132542421 CACGCAGGTCAGGAGCAGAGGGG + Intronic
1185507690 X:642557-642579 TACCCAGGAGAGGAGAACCGCGG - Intronic
1185922763 X:4112525-4112547 GACTGAGGACAGAAGCAAAGGGG + Intergenic
1186689002 X:11955101-11955123 TCCACATGACAGGAGCAAAGGGG + Intergenic
1186788085 X:12971871-12971893 AAGGCAGGACAGGCGCAAAGTGG + Intergenic
1187983520 X:24785314-24785336 TACACAGGCAAGGATCAAAGGGG - Intronic
1190257319 X:48773341-48773363 TCCCCAGAACAGGGGCAAAAGGG + Exonic
1190726707 X:53194745-53194767 TACCCAGGACAGGAGCAAAGTGG + Intronic
1191111277 X:56804581-56804603 TGCCCAGCACAGGAACACAGAGG - Intergenic
1192608156 X:72541397-72541419 TACCAGGGAGAGGAGAAAAGGGG + Intronic
1192967661 X:76196090-76196112 TACCTAGGGCAGGGGCAAAATGG + Intergenic
1193408348 X:81132133-81132155 TACCTAGGACTAGAGCAAACTGG + Intronic
1194781411 X:98029070-98029092 CCCCCAGGAGAGAAGCAAAGTGG - Intergenic
1194917572 X:99723674-99723696 TCCCCAGGAGAGGAGCAAAGTGG + Intergenic
1195159359 X:102155886-102155908 TGCCCAGGAAAGGTGGAAAGTGG - Intronic
1197650382 X:129057552-129057574 AACTCAGGAGAGGAACAAAGAGG + Intergenic
1197708866 X:129652469-129652491 AACCCAGGACAGGAGCCAGCGGG + Intronic
1199210265 X:145200202-145200224 TACCAAGGACTGGAGGAGAGGGG + Intergenic
1200257708 X:154593443-154593465 TGGCCAGGGCAGGAGCAAGGGGG - Intergenic