ID: 1190729698

View in Genome Browser
Species Human (GRCh38)
Location X:53217479-53217501
Sequence GGTGGAGGAAGTGACTGGAA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 678
Summary {0: 1, 1: 0, 2: 4, 3: 58, 4: 615}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1190729698 Original CRISPR GGTGGAGGAAGTGACTGGAA GGG (reversed) Intronic
901215777 1:7554591-7554613 GGTGGAGGCAGTGACAGGAGGGG - Intronic
902706512 1:18209009-18209031 GGTGAAGGTAGTGACTGGGGAGG + Intronic
902785634 1:18730943-18730965 GGAGGAGGAAGGGAGAGGAAGGG + Intronic
902926639 1:19700345-19700367 GGTGGAGGGAGGGGCTGGAGGGG - Intronic
903121948 1:21221887-21221909 GGTGAAGGAGGGGACTGGTATGG + Intronic
903142601 1:21348063-21348085 TGGGGAGGGAATGACTGGAAAGG + Intergenic
903337228 1:22633274-22633296 GGAGGAGGAGGAGACTGGAAGGG + Intergenic
903479893 1:23645379-23645401 GGTGCAGGAAGAGACTTCAACGG + Intergenic
903660011 1:24971316-24971338 CTTGGAGGAAGTGAGTGGGAGGG - Intergenic
904224705 1:29006628-29006650 GTTGGAGGTAGTGACTGGAAGGG - Intronic
904876465 1:33658305-33658327 GGTGGAGGCAGTGATAGTAATGG - Intronic
904973567 1:34438011-34438033 GAAGGAGGAAGTGAGTGAAATGG - Intergenic
905221145 1:36448798-36448820 GGTGGAAGAAGGGACTGCAGAGG + Intronic
905292010 1:36928193-36928215 AGTGGAGGCAGGGACTGGAGAGG + Intronic
906617641 1:47245103-47245125 GGTGGAGGGAGTGGCTGCATTGG + Intergenic
906647149 1:47483441-47483463 GGTGAAGGCAGTGACAAGAAGGG + Intergenic
907148536 1:52259824-52259846 GTTGGAGGATGAGATTGGAATGG - Intronic
907965745 1:59327489-59327511 AGTGGAGGAAGTTACTGCAGAGG - Intronic
910354898 1:86342570-86342592 GGTGGAGTAGGTGACTGGCGAGG - Intergenic
910826492 1:91413700-91413722 GGTGGAACAATTGACTGTAAAGG - Intergenic
910865522 1:91784844-91784866 AGTGGAAGATGAGACTGGAAAGG - Intronic
911566856 1:99472427-99472449 GGTGGAGGATGTGCTTGGAGGGG + Intergenic
912300693 1:108513727-108513749 GGTGGAGGCAGAGACTAGAGTGG - Intergenic
912354543 1:109043848-109043870 CGTGGAGGTAGTGAATAGAATGG + Intergenic
912498654 1:110107390-110107412 AGTGTAGGAAGTGCTTGGAAAGG - Intergenic
912514122 1:110207443-110207465 GGTGGAGGGGGGGCCTGGAAAGG + Intergenic
912616392 1:111104397-111104419 AATGGGGGAAGTGACTGCAAAGG - Intergenic
912734583 1:112139127-112139149 GGTTGAGGAGGTGGATGGAACGG + Intergenic
913022010 1:114797476-114797498 GATGGAGGCAGAGACTGGAGTGG + Intergenic
913523289 1:119666609-119666631 GGAGGGGGCAGTGACTGGGAAGG - Intronic
914351926 1:146847473-146847495 GATGGAGGCAGAGAGTGGAATGG - Intergenic
914433207 1:147638585-147638607 GGTGGAGGATGAGGCTGGAGAGG + Intronic
915626941 1:157119689-157119711 GGTGAAGGATGAGGCTGGAAGGG + Intergenic
915646544 1:157276828-157276850 GGTGGAGTAAGTGACTGGTGAGG + Intergenic
915943877 1:160136006-160136028 GGTGGAGGAGGGGACAGGCAAGG + Intronic
916748050 1:167699485-167699507 GATGGAGGCAGAGACTGGAGTGG - Intronic
917186562 1:172362995-172363017 GGTGGAAGAAGTGCCAGCAAAGG - Intronic
918080757 1:181206230-181206252 GGTGGAGGAGGAGGCTGGCAGGG + Intergenic
918384356 1:183990562-183990584 GGAGGAGGGAGTGGCTAGAAAGG + Intronic
918530184 1:185511041-185511063 GGGGAAGGAATTGACTGGAAAGG - Intergenic
918833892 1:189434923-189434945 GGTGGAGGAAGGCAATGGATAGG + Intergenic
920024196 1:202980673-202980695 AGTGGAGGAAGTACCTGCAAAGG - Intergenic
920499091 1:206475001-206475023 GGTGGAGGCAGGGACAGGGAGGG - Intronic
920753198 1:208702360-208702382 GGTGGAGGAATTGATAGAAAAGG + Intergenic
920913033 1:210234516-210234538 GGTAGTGGAAGGGACTGGATGGG - Intronic
921977905 1:221222506-221222528 GGAGCAGGAATTGACTGGGAAGG - Intergenic
922562884 1:226581868-226581890 GGTGCAGGATGTCCCTGGAATGG - Intronic
923201920 1:231720940-231720962 TCTGCAGGAAGTCACTGGAAGGG + Intronic
923328372 1:232900086-232900108 GGTGGAGGAAGGCAAGGGAATGG + Intergenic
923342970 1:233023090-233023112 CGTGAAGCAAGTGGCTGGAAGGG - Intronic
923355153 1:233147523-233147545 GGTGGAGGAAGTGGAAGGGAAGG + Intronic
923392473 1:233527359-233527381 GGTGGGGAAACTTACTGGAAGGG + Intergenic
923672949 1:236056665-236056687 GGTGGACGTAGAGAGTGGAATGG - Intronic
924620140 1:245653229-245653251 CTTGGAGGAAGTGAATAGAAGGG + Intronic
1063087840 10:2835726-2835748 GTTGGAGAAAGTGGCTGGCATGG - Intergenic
1063161155 10:3420046-3420068 GGCTGAGGAAGGGACAGGAAGGG + Intergenic
1063431836 10:5997843-5997865 AGTGTAGGAATTGACTGTAAAGG - Intergenic
1063442435 10:6083846-6083868 GGGGGAGGATGTAACTTGAAAGG + Intergenic
1063499196 10:6537887-6537909 GGAGGAGGAAGTGCAGGGAAGGG - Intronic
1064114739 10:12568276-12568298 GGTGGGGGATGGGACGGGAAGGG - Intronic
1064428607 10:15252328-15252350 GGCTGCGGAAGAGACTGGAAAGG - Intronic
1064643659 10:17438609-17438631 GGTGTAGGAAGGGAAGGGAAAGG - Intronic
1065924010 10:30419607-30419629 GGTGAAGGAAGTGAATGGGATGG - Intergenic
1066037501 10:31508412-31508434 GGTGTTGGCAGTGACTGCAATGG + Intronic
1066081394 10:31934215-31934237 GGAGGAGGAAGGGGATGGAAAGG - Intergenic
1066510910 10:36094890-36094912 GTTGGAGGAGGGGACTGGAGGGG + Intergenic
1066739542 10:38507642-38507664 TGTAAAGGAAGTGAATGGAACGG + Intergenic
1066768789 10:38826842-38826864 CGTAGTGGAATTGACTGGAAAGG + Intergenic
1067777654 10:49175063-49175085 GGTGGCAGCAGGGACTGGAATGG + Intronic
1067785616 10:49243448-49243470 TGTGGAAGAAAGGACTGGAAGGG + Intergenic
1068757358 10:60670277-60670299 GGTGGAGGAACTGGCTTGGAGGG - Intronic
1068824554 10:61420360-61420382 GGTGGAGGAGGTGAAAGGAGAGG + Intronic
1069774949 10:70920857-70920879 GGTGGAGGCAGAGACTGGAGTGG - Intergenic
1070690042 10:78517727-78517749 GGTTGGGGCAGTGACTGGACTGG - Intergenic
1071088120 10:81887827-81887849 GGGGCAGGTAGTGAATGGAAGGG + Intronic
1071335662 10:84598520-84598542 GGAGGAGGAAGTGACAGCAGTGG - Intergenic
1071403240 10:85299282-85299304 TGTGGAGGAGGTTACTGGACTGG + Intergenic
1073697649 10:105888986-105889008 GGTGGAGGCAGAGATTGAAATGG + Intergenic
1074242655 10:111654524-111654546 GGGGGAGGAAGGGAAGGGAAGGG - Intergenic
1074242671 10:111654563-111654585 GGGGGAGGAAGGGAAGGGAAGGG - Intergenic
1074376630 10:112946392-112946414 GGTGGATGAGGTGGTTGGAATGG - Intergenic
1074421554 10:113313639-113313661 TGGAGAGGAATTGACTGGAAAGG - Intergenic
1074915099 10:117947800-117947822 CGTGGAGGAAATGGCTGCAAGGG + Intergenic
1075549376 10:123380831-123380853 GCTGGAGAAAGTGAGAGGAAGGG - Intergenic
1076005400 10:126944618-126944640 TGAGGAGGAAGTGACTGGGAAGG + Intronic
1076083789 10:127607022-127607044 AGAGGAGGATTTGACTGGAAAGG - Intergenic
1076228081 10:128796992-128797014 GGTGGAGGCAGAGATTGGAATGG - Intergenic
1076285060 10:129287208-129287230 GGTGCAGGAATTCACTGGGAGGG + Intergenic
1077234821 11:1475699-1475721 GGTGGAGGAGGTGAGAGGATGGG - Intronic
1077899919 11:6479921-6479943 GGTGGAGGAGGGGACAGGAATGG - Intronic
1078760680 11:14248913-14248935 GGTGCAGGTAGAGACAGGAAAGG + Intronic
1079352579 11:19704252-19704274 AGTTGAGGAAATGAGTGGAAAGG - Intronic
1079467918 11:20749744-20749766 GGTAGATGAAGTGTCAGGAAGGG - Intronic
1079531503 11:21460080-21460102 GGTGGAGGATGTGATGGGATAGG + Intronic
1080032233 11:27673926-27673948 GGTGATGGAAGAAACTGGAAAGG + Intronic
1080241581 11:30133316-30133338 GGTGGAGAAAGCGTCTGGGAAGG - Intergenic
1080620220 11:33981083-33981105 GAAGAAGGAAATGACTGGAAAGG - Intergenic
1080642281 11:34164961-34164983 GGTGGACGAAGTGAAGGGAGAGG + Intronic
1081057967 11:38434426-38434448 ATGGGAGGAAGTGACTGCAAAGG - Intergenic
1081441253 11:43083964-43083986 GGAGGAGGAAGAGTCAGGAATGG + Intergenic
1082565814 11:54676805-54676827 GGTGGGGGAAGGGAGGGGAAAGG - Intergenic
1082634999 11:55584321-55584343 GGCAGAGTAGGTGACTGGAAAGG - Intergenic
1083802913 11:65057292-65057314 ACTGGAGGAAGTGAGGGGAAGGG - Intronic
1083871446 11:65490707-65490729 GGAGGAGGAAATGACTGGCCAGG - Intergenic
1083982753 11:66186894-66186916 GGTGGAGGCACTGATTGGAAGGG - Intronic
1084273404 11:68040460-68040482 AGGGGAGGAAGTGACTGGCTGGG + Intronic
1084337861 11:68471567-68471589 GGTGCAGGAAAAGCCTGGAAGGG + Intronic
1085285234 11:75355344-75355366 GGTGGAGGATGTGACACAAATGG - Intergenic
1085508985 11:77075837-77075859 CTTGGGGGTAGTGACTGGAAGGG - Intronic
1085815981 11:79737887-79737909 GCTGCAGGAAGTGGCTGGAAGGG + Intergenic
1086148391 11:83580848-83580870 GGTGGAGGAAGTAAGGGGAAGGG - Intronic
1086356308 11:86004394-86004416 TGGGTAAGAAGTGACTGGAAGGG + Intronic
1086830568 11:91558175-91558197 GGGTGAGGGAGTGATTGGAAGGG - Intergenic
1086957968 11:92953533-92953555 GGTGGAGGGAGAGACAGGAGAGG + Intergenic
1087326670 11:96732317-96732339 GGAGGAGGAAGAGATTGGGATGG - Intergenic
1088496356 11:110435121-110435143 GGAGGAGGAAGAGGCTGCAATGG - Intronic
1089070457 11:115695922-115695944 GGTGGAGGAAGAGAGGGGAGAGG - Intergenic
1089072155 11:115709163-115709185 GGTGGAGAAAGAGGCTGGGATGG + Intergenic
1089208958 11:116788050-116788072 GCTGGCGGAAGTGACGGGAGAGG - Exonic
1089319676 11:117616648-117616670 GAGGGAGTTAGTGACTGGAAGGG + Intronic
1089490784 11:118882532-118882554 GGTGAAGGAGGGCACTGGAAAGG + Intergenic
1089558312 11:119328485-119328507 GGTGGAGAAATGGAATGGAAGGG - Intergenic
1089640986 11:119847080-119847102 GGTGGATGAGGTGAGGGGAAGGG + Intergenic
1089840101 11:121409235-121409257 TTTGGAGGATTTGACTGGAATGG - Intergenic
1090403010 11:126460959-126460981 GGTGGTGGCAGTGAATCGAATGG + Intronic
1090562838 11:127951186-127951208 GATGGAGGAAGTTATTGGATTGG + Intergenic
1090651553 11:128810849-128810871 GCTGGAGGAAGTGACAGGCATGG - Exonic
1090728896 11:129552667-129552689 AGGGGAGGAAGGGCCTGGAATGG + Intergenic
1090828942 11:130407578-130407600 AGTGGGGGAAGTGGCTGGACAGG + Intronic
1090874796 11:130778869-130778891 GGTGGAGGCAGTGACAGCTATGG + Intergenic
1091145856 11:133279615-133279637 GGTGGAGGTGGTGAGAGGAAGGG - Intronic
1091268533 11:134289380-134289402 GGTGGAGGAGGTGGCAGGAGAGG + Intronic
1091399528 12:173770-173792 GGTGGAGGAGATGGGTGGAAGGG - Intronic
1091835492 12:3582885-3582907 GATGGAGGAGGTGATTGGGAGGG + Intronic
1092219239 12:6701300-6701322 GGTGGAGGAAAGGACTGGGGAGG + Intergenic
1092357919 12:7811909-7811931 GGAGGAGGAAGGAAGTGGAAAGG + Intergenic
1092696063 12:11172398-11172420 GGCGGGGGAAGTAAATGGAATGG + Intergenic
1093230158 12:16534017-16534039 GGTGGAAGATGAGTCTGGAAAGG + Intronic
1094127634 12:27039957-27039979 GTTGGAGGAAATGGTTGGAAAGG + Intronic
1094472252 12:30814185-30814207 GGTGGGTGATGTGACTGAAAAGG - Intergenic
1095532538 12:43206354-43206376 GTGGGATGAAGTGACTGCAAAGG + Intergenic
1096193877 12:49636579-49636601 GGTGGGGGAAGGGCCTGGAGGGG - Exonic
1096290320 12:50336741-50336763 AGTGGGGGATGAGACTGGAATGG + Intronic
1097214874 12:57403032-57403054 GGCGTAGGAAGTGACTGGTTTGG + Intronic
1099917636 12:88915266-88915288 GGTGTTGGAAGTGGCTGCAATGG + Intergenic
1100028697 12:90160933-90160955 GCAGGAGGAAGAGACTGAAAAGG + Intergenic
1100916581 12:99430572-99430594 GGTGGAGGATGTTACTCTAATGG - Intronic
1101141239 12:101798000-101798022 GGTAGAGGGACTCACTGGAATGG - Intronic
1101271905 12:103156325-103156347 GGGGGTGGTAGTGACTGAAAAGG + Intronic
1101542444 12:105677095-105677117 GAGGGAGGGAGTGATTGGAAGGG + Intergenic
1101905300 12:108820349-108820371 GGTGGAGGAAGGGGCTGGGGAGG - Intronic
1102640864 12:114365382-114365404 GGAGGAAGAATTGACTGGAAAGG - Intronic
1103172578 12:118834180-118834202 GGAGGTGGAAGTGGCTGGATTGG + Intergenic
1103689267 12:122757819-122757841 GAAGGAGGAAGTGCCTGAAATGG + Intronic
1103997826 12:124841612-124841634 GTTGGGAGAAGTGACTGGAGGGG - Intronic
1104371633 12:128228710-128228732 TGTGGAGGACGTGCCAGGAAAGG - Intergenic
1104729852 12:131098687-131098709 GGTGGCGGAGGTGACTGCAGAGG - Intronic
1104916284 12:132266520-132266542 GGTGGAGGCCGAGACTCGAATGG + Intronic
1105964022 13:25369049-25369071 GGAGGAGGAAGTGAAGGGAAAGG - Intergenic
1106072650 13:26427103-26427125 AGTGAAGGAAGTGACATGAATGG + Intergenic
1106105170 13:26726622-26726644 GCAGGAGGCAGTGGCTGGAAAGG - Intergenic
1106575627 13:30971886-30971908 GTTGGAGGAAGAGATGGGAAGGG - Intronic
1106953853 13:34913849-34913871 GATGCAGGAAGTGAGTGGAGAGG - Intergenic
1107312185 13:39091007-39091029 GGTGGAGCTTGTGACTTGAAAGG - Intergenic
1107359637 13:39603913-39603935 GAGGGAGGAAGTGAAGGGAAAGG - Intergenic
1108352084 13:49596976-49596998 GCAGGAGGAAGTGAAGGGAATGG + Intergenic
1108433219 13:50375655-50375677 GATGGAGGAAGGGAAGGGAAGGG - Intronic
1108451125 13:50564339-50564361 AGTGGAGGAATTGGCTGGGAAGG - Intronic
1108807600 13:54178599-54178621 GGTGGAGGACGAGATTTGAATGG - Intergenic
1109220241 13:59634138-59634160 GGGTGAGGAAGGGAGTGGAAAGG + Intergenic
1111702930 13:91713466-91713488 GGTAGAGAAAATGACGGGAAAGG - Intronic
1112272111 13:97977163-97977185 GGTGGAGACAGCGGCTGGAAGGG - Intronic
1112583616 13:100697466-100697488 GGTGGAGGAGGTGTCTGGGCTGG + Intergenic
1112587000 13:100727715-100727737 GGAGCAGGGAGTGACTGGAAAGG - Intergenic
1113329858 13:109317431-109317453 GGTAGAGGAAGGAGCTGGAAAGG + Intergenic
1113618464 13:111697238-111697260 TGTGGAGGAAGGGAGAGGAAGGG - Intergenic
1113623993 13:111782499-111782521 TGTGGAGGAAGGGAGAGGAAGGG - Intergenic
1113777668 13:112957745-112957767 GGTGGAAGAAGAGACTACAAGGG - Intronic
1113814852 13:113162924-113162946 GGTGGGGGTGGTGACAGGAATGG - Intronic
1114549764 14:23525959-23525981 GGTGGGGGAGGGGACAGGAAAGG + Exonic
1114553972 14:23551057-23551079 GGTGGAGGGAGAAACGGGAACGG - Intronic
1116299900 14:43165166-43165188 AGTGGAGGAAGTAACTGCATAGG + Intergenic
1116503511 14:45650063-45650085 GGGTGAAGAAATGACTGGAAGGG - Intergenic
1117388807 14:55243542-55243564 GATGGAGGAAGTGACAAAAAAGG - Intergenic
1118817589 14:69324062-69324084 GAGGGAGGAAGTGACGGGATAGG + Intronic
1118942031 14:70347179-70347201 GGTGGAGTAGGTGACTGGTGAGG - Intronic
1118968494 14:70610910-70610932 GCTGGAAGATGAGACTGGAAGGG + Intergenic
1119654919 14:76410366-76410388 AGTGCAGGCAGTGACTGGTAGGG + Intronic
1119692012 14:76680812-76680834 GGTGGAGCAGGTGATTGAAAAGG - Intergenic
1119882333 14:78110731-78110753 GGAGGAGGAAGAGAATGGATTGG + Intergenic
1119895080 14:78213274-78213296 GATGGGGGAAGAGAATGGAAGGG + Intergenic
1120008241 14:79384254-79384276 GGTGGGGGAAGAGAGGGGAAGGG + Intronic
1120930610 14:89844663-89844685 CTGGGAGGAAGTGACTGGGAAGG - Intronic
1121031918 14:90665390-90665412 GCTGGAAAAAGAGACTGGAAAGG - Intronic
1121038595 14:90726938-90726960 GGTGGAGGAAGTTACCGGCCTGG + Intronic
1121715682 14:96072085-96072107 GGTGGGGGATATGAATGGAAAGG + Intronic
1121726915 14:96158968-96158990 GGAAGAGCAAGAGACTGGAAAGG + Intergenic
1122007720 14:98719071-98719093 GGTGGAAGAGGTGTCTGGACAGG + Intergenic
1122977418 14:105176598-105176620 GCTGGAGGAAGTGGCTTGCAAGG - Exonic
1124033431 15:26031829-26031851 GGTGGAGGCAGGGCATGGAAGGG + Intergenic
1125259309 15:37804111-37804133 GAGGTAGGTAGTGACTGGAAGGG + Intergenic
1125727273 15:41874485-41874507 GGAGGAGGAAGAGATTGGAGAGG + Intronic
1125926393 15:43566689-43566711 GGTGGAGGAAGTTGCTGTATAGG - Intronic
1125939537 15:43666239-43666261 GGTGGAGGAAGTTGCTGTATAGG - Intronic
1127607135 15:60597795-60597817 GGAGTAGGAACTGACTGCAACGG + Intronic
1127720686 15:61695779-61695801 GGTGGGAGAAAAGACTGGAATGG + Intergenic
1128233545 15:66051753-66051775 GAGGGAGGAAATGACTGGGAAGG + Intronic
1128246331 15:66135175-66135197 GGTGAAGGATGTGGCTGGGAAGG - Intronic
1128401091 15:67281624-67281646 GATCCAGGAAATGACTGGAAAGG + Intronic
1128437616 15:67670316-67670338 GGAGGAGGAGTTGACTGTAAAGG + Intronic
1128561031 15:68667779-68667801 AGTGGAGGGAGTTGCTGGAAAGG + Intronic
1128565354 15:68697514-68697536 TGGTGAGGAGGTGACTGGAAGGG + Intronic
1129089708 15:73136393-73136415 GGTGGTGGTGGTGACAGGAAGGG + Intronic
1129329570 15:74820179-74820201 GGTGGAGGTAAGGGCTGGAATGG - Intronic
1129641395 15:77382289-77382311 GGTGAAGGATGAGATTGGAAAGG - Intronic
1129746745 15:78027229-78027251 GGGCGGGGTAGTGACTGGAAAGG + Intronic
1130179903 15:81615134-81615156 GGAGGAGACAGTGATTGGAAGGG - Intergenic
1131054725 15:89368527-89368549 GGTGGAGGGAGTGAATGGGGTGG + Intergenic
1131377988 15:91941020-91941042 GGTAGAGGGAGTGGGTGGAAAGG + Intronic
1131518191 15:93093448-93093470 GGTGGAGATATTGACTGCAAGGG + Intergenic
1131814808 15:96211384-96211406 GTTGGTGAAAGTGGCTGGAAGGG - Intergenic
1131909348 15:97179704-97179726 GGTGATAGAAGTGACTGGATTGG + Intergenic
1132036615 15:98490689-98490711 GGTGGAGGAAATGACTGATCAGG - Intronic
1132346596 15:101112479-101112501 TGTGGAGGAAATGAATGGATGGG - Intergenic
1133360046 16:5166960-5166982 GGTGGAGGAAGTACCTGGGGAGG + Intergenic
1133983349 16:10650004-10650026 GGGGGAGGAAGAAAGTGGAACGG - Intronic
1134427295 16:14162725-14162747 TCAGGAGGAAGTGACTAGAAGGG + Intronic
1135923842 16:26674766-26674788 GGTGGAAGAGGGGACAGGAAAGG + Intergenic
1136511747 16:30742200-30742222 GGTAGAATAGGTGACTGGAAAGG + Intronic
1137343698 16:47635636-47635658 GCTGGAGGAAGTGACAAGATAGG + Intronic
1137482370 16:48863273-48863295 AGGGGAGGATGTGACTGTAAAGG + Intergenic
1137784507 16:51126903-51126925 GGTGAAGGCAGAGACTGGAGTGG + Intergenic
1138319241 16:56097948-56097970 GGTGGAGGAATTGACTACAAAGG + Intergenic
1138851326 16:60633128-60633150 GGTGGGGGTAGTGATTGCAAAGG + Intergenic
1139588209 16:67917838-67917860 TGAGGAGGAGATGACTGGAAAGG + Intronic
1139838112 16:69856300-69856322 GGAGGAGGGATTGACTGCAAAGG + Intronic
1139938323 16:70587119-70587141 GGAGGAGGCAGTGACTCCAAAGG - Intronic
1140734702 16:77887944-77887966 GGTGGAGGAGGTGAGGGTAATGG - Intronic
1142356205 16:89603387-89603409 GGTGGAGCAAGTGACGTGCAAGG + Intergenic
1142602699 17:1062129-1062151 AGTGGAGGAAGGGCCTGGAGCGG - Intronic
1143030003 17:3962663-3962685 GGAGGAGGAACTGACTGGGAGGG - Intronic
1143606165 17:7987562-7987584 GGTGGAAGAGGTGAGTGGCATGG - Intergenic
1143720764 17:8807495-8807517 GGTGGAGGATGTGGAAGGAAGGG + Intronic
1143817522 17:9529563-9529585 GGGGGAAGTAGTGACTAGAAGGG - Intronic
1143827524 17:9622826-9622848 GGTGAGGGTAGTGATTGGAAGGG - Intronic
1143972363 17:10804859-10804881 GATGCAGGCAGTGTCTGGAAGGG - Intergenic
1143976256 17:10832144-10832166 GGTGGGGGTAGTGACTGAAATGG + Intronic
1144554193 17:16267352-16267374 GGTGGAGGAAGTGGATGGGGAGG + Intronic
1144554201 17:16267382-16267404 GGTGGAGGAAGTGGATGGGAAGG + Intronic
1145802320 17:27696000-27696022 GGGGGAGGTAGAGACTGTAATGG - Intergenic
1145978232 17:28996545-28996567 TGGGGAGGAAGAGACTGGAGTGG + Intronic
1146804128 17:35851628-35851650 GGTAGCTGAAGTGAATGGAAGGG + Intronic
1146945938 17:36873552-36873574 GGTGGGAGATGGGACTGGAAAGG - Intergenic
1147139191 17:38452089-38452111 GGAGGAGGAAGAGAGAGGAAGGG - Intronic
1147190495 17:38735433-38735455 GGAGGAGGAGGTGGCTGGCAGGG + Exonic
1147710729 17:42462331-42462353 GGTGGAAGAAAGGACTGGCATGG - Intronic
1147859445 17:43509453-43509475 GGTGGAGGGAGTTAATTGAAAGG - Intronic
1147977838 17:44258217-44258239 GCTGGAGGAGGTGAGGGGAAAGG + Intronic
1148216258 17:45835461-45835483 GGAGCAGGAGGTGACTGGTATGG - Exonic
1148643776 17:49207261-49207283 GAAGGAGGAAGTGACCAGAAAGG - Intronic
1148785507 17:50144289-50144311 GGTGGAGGCTGTGAGTGGGAGGG - Intronic
1149638664 17:58189673-58189695 GGTGGAGGCAGTGAGTGCAAGGG - Intergenic
1149691415 17:58580120-58580142 GGAAGAGGCAGTGACTGGATGGG + Intronic
1150225783 17:63523761-63523783 GGGGCAGGCAGTGGCTGGAAGGG - Intronic
1150603039 17:66667116-66667138 GGTGGGGGAAGGGACTGGGCAGG - Intronic
1150666718 17:67146846-67146868 GGTCAGGGTAGTGACTGGAAAGG + Intronic
1151759232 17:76091104-76091126 GGAGGAGGAAGGGACAGGAGGGG + Intronic
1152230592 17:79112344-79112366 GGTGGTGGAGGTGTCGGGAAAGG + Intronic
1152328771 17:79658364-79658386 GGAGGAGGAAGAGACAGGGAGGG - Intergenic
1152509649 17:80777283-80777305 GTGGGAGGAAGAGACAGGAAAGG + Intronic
1152795858 17:82305866-82305888 GATGGAGGCAGAGACTGGAGCGG + Intergenic
1154235003 18:12596937-12596959 GGTGGAGGAGGAAACAGGAAGGG - Intronic
1155232234 18:23784695-23784717 GGAGGAGGAAGTGTCTGGTCCGG + Intronic
1157382021 18:47227165-47227187 GGAGGAGGAAGAGGCAGGAAAGG - Intronic
1157586163 18:48802611-48802633 GCTGCAGGAAGTGCCTAGAAAGG + Intronic
1157751069 18:50178964-50178986 AGTGGAGGAAGCAACTGGAGGGG + Intronic
1157976011 18:52327634-52327656 GGCAGAGGATGTGACTGGACCGG - Intergenic
1158430361 18:57379844-57379866 GGTGGGAGAATTGACTGAAAGGG - Intergenic
1158922169 18:62205362-62205384 GGGGTAGGAACTGACTGGAAAGG - Intronic
1159206889 18:65264886-65264908 GGTAGTGGAAGTGCATGGAATGG + Intergenic
1159607955 18:70494822-70494844 GGAGGAGGATGTGATTGGATGGG + Intergenic
1160039281 18:75331281-75331303 GGAGGAGGAAGAGAAGGGAAGGG - Intergenic
1160273939 18:77412613-77412635 GGGGGTGGCTGTGACTGGAAGGG - Intergenic
1160372781 18:78388774-78388796 GGTGGAGGAAGTGAAGAGAAGGG - Intergenic
1161329736 19:3680813-3680835 GGTGGAGGGAGTGACCGAAATGG + Intronic
1161588287 19:5117326-5117348 GGTGGAGGGAGGGACTGCAGTGG + Intronic
1161958373 19:7508501-7508523 GCTGGAGGAAGGGACTGCACGGG + Intronic
1162269757 19:9604652-9604674 GGGGGAGGATGTGTCTGAAAGGG - Intergenic
1163096401 19:15060724-15060746 GGTGAAGATAGAGACTGGAATGG + Intergenic
1164605067 19:29591959-29591981 TGTGCAGGGAGTGGCTGGAAAGG + Intergenic
1164792441 19:30999711-30999733 TGAGGAGGCAATGACTGGAAGGG + Intergenic
1164853496 19:31503184-31503206 GGTGGAGAAGGTCACTGAAATGG - Intergenic
1165280040 19:34788291-34788313 GATGGAGACAGTGACTGGATGGG - Intergenic
1165583499 19:36891145-36891167 GATGGAGGCAGAGATTGGAATGG + Exonic
1165918884 19:39279685-39279707 GAGGGAGGATGTGACTGTAAAGG - Intergenic
1166043513 19:40216775-40216797 GGTGCAGGAAGTGAATGAATAGG + Intronic
1166178948 19:41093764-41093786 GGTGGAGGGTAAGACTGGAAAGG + Exonic
1166644149 19:44518798-44518820 TGTGGAGGATGAGACTGGGATGG - Intronic
1167766253 19:51484682-51484704 GGGAGAGACAGTGACTGGAAGGG - Intronic
1167995585 19:53399363-53399385 GGTGGAGGATGTAACAGGGAAGG - Intronic
1168472945 19:56654487-56654509 GGTGGTGGTAGTGAAGGGAAGGG + Intronic
925487912 2:4356599-4356621 GGTGGAGGAAGAGAAAGAAAAGG + Intergenic
925920577 2:8634992-8635014 GGTGGAGGCAGAGGCTGGAGAGG - Intergenic
926344627 2:11934060-11934082 GTGAGAGGAAGTGATTGGAAGGG - Intergenic
926883445 2:17574613-17574635 GCTGGAGCCAGTGACTGGCAAGG - Intronic
926893011 2:17654584-17654606 GCTGGAGGAAGTGGTTAGAAAGG - Intronic
927478563 2:23432905-23432927 GGAGGATGAAGAGACAGGAAAGG + Intronic
927847013 2:26476923-26476945 CGTGGAGGAGGAGACTGGCAAGG - Exonic
928318511 2:30264686-30264708 GGATGAGGGAGTGAATGGAAGGG + Intronic
928607472 2:32956563-32956585 AGTGGAGGAAGTCACTGCAGAGG - Intronic
928978093 2:37109918-37109940 GGAGGAGGCACTGACTGGAAAGG + Intronic
928986558 2:37188167-37188189 GGTGGATGACGGGCCTGGAAGGG - Intronic
929147717 2:38721413-38721435 AGAGGTGGAAGTGACTGGGACGG - Intronic
929369599 2:41206571-41206593 GGTGGAGGAAATGAAAGGAGAGG - Intergenic
929577407 2:43060726-43060748 GGAGGAGGAGGTGAGTGGATGGG - Intergenic
929787844 2:45004898-45004920 GGTGGAGAAAGAGGCTGGCAAGG + Intergenic
929930489 2:46251872-46251894 GGTGTGGGAAGTGACTGGCCTGG - Intergenic
930023681 2:47016737-47016759 CAAGGAGGAAGTGTCTGGAAAGG + Intronic
930443546 2:51440953-51440975 GGTGGAGGAAGAAATTAGAAGGG + Intergenic
931683758 2:64774842-64774864 AGTGGAGGAAGTAACTGCAGAGG - Intergenic
931694444 2:64861082-64861104 GTTGGGGGAAGTGACTAGGAGGG - Intergenic
931770170 2:65490553-65490575 GGTGGAGGCAGAGATTGGAGTGG + Intergenic
932412828 2:71557395-71557417 GGTGGGGGAAGTGGCAGGAGAGG + Intronic
933601013 2:84330041-84330063 AGTGGAGGAAGCGACAGGGATGG + Intergenic
933767020 2:85716571-85716593 GGGGGAAGAAGTGACAGGCATGG + Intergenic
934943511 2:98519769-98519791 GGAGGAAGAAGTGACCAGAAGGG + Intronic
935625393 2:105168423-105168445 GGAGCAGGAAGTGAATGGAATGG + Intergenic
935787687 2:106563706-106563728 GGTGGTGGAAGGGGCAGGAATGG - Intergenic
936674533 2:114699808-114699830 GGTCAAGGGAGTGAATGGAAAGG + Intronic
936964897 2:118117892-118117914 GGTAGAGGAAGTGGGTGGAAGGG + Intergenic
937256093 2:120556849-120556871 GGTGGAGGACATGGCAGGAATGG + Intergenic
938025838 2:127947089-127947111 GATGGAGGCAGGGACTGGAGTGG + Intronic
938663469 2:133510292-133510314 GGTGGAGTTATTGACTAGAATGG - Intronic
939512271 2:143122142-143122164 GGCGGAAGAAGGGACTGGAGGGG - Intronic
939534980 2:143416798-143416820 GGTGGGGGAAGTGGCAGGCAGGG - Intronic
940779739 2:157919848-157919870 GGTGGGGGAACTGAATGGAATGG - Intronic
941620246 2:167769558-167769580 GGTGAAGGATTTGACTAGAAAGG - Intergenic
941931214 2:170941510-170941532 TGTGCAGGATGTCACTGGAAAGG - Intronic
942735299 2:179103742-179103764 GGGACAGGAATTGACTGGAAAGG + Exonic
943231320 2:185256240-185256262 GGAGGAGGTAGAGACTCGAAGGG - Intergenic
944253848 2:197604607-197604629 TGTGGAGGAAGTGAATGTGATGG + Intronic
944343293 2:198629968-198629990 GCGGGAGGAACTGACTGGCATGG - Intergenic
944355186 2:198779013-198779035 GGGCCAGGAAATGACTGGAAAGG - Intergenic
944495189 2:200300254-200300276 GGTGGAGGAAGTGAAAGAAGAGG + Intergenic
945307852 2:208276055-208276077 GGTTGGGGAAGTGACAGGGAAGG + Intronic
945310656 2:208308583-208308605 GGTTGAGGGAGTGAAGGGAATGG - Intronic
945824153 2:214699553-214699575 GGAGGAGGAAAGGACTTGAAAGG + Intergenic
946137981 2:217663849-217663871 GGTGGTTGAAGTGACTGGGGTGG - Intronic
946514457 2:220396483-220396505 GGGTGAGTAAGTGACTGGAAAGG - Intergenic
946734766 2:222743296-222743318 GGTGGAGGGAGAAAGTGGAAGGG - Intergenic
949077947 2:242073312-242073334 TGTGGAGGGAGGGACTTGAAGGG + Intergenic
1168815178 20:731777-731799 GGTGGAGGGATGGACTGGGAAGG + Intergenic
1169038101 20:2470260-2470282 GTTGGCGGAAGTGGGTGGAAGGG - Intronic
1169552378 20:6714357-6714379 GAGGGAGGAAGAGACTTGAAAGG + Intergenic
1169789756 20:9397341-9397363 AGTGGAGGAAGTCACTGCAGAGG - Intronic
1169835767 20:9876296-9876318 GGTGGAGGAATTGGGTGGAGTGG + Intergenic
1169921367 20:10737452-10737474 GGGGGAGGAATTGACTAGAATGG - Intergenic
1170335968 20:15270460-15270482 AGGGGAGGATGTGACTGTAAAGG + Intronic
1170566915 20:17612758-17612780 GGTGGTGGCAGTGACTCGGATGG - Intergenic
1170989259 20:21287111-21287133 GGAGGAGAAATTGCCTGGAAGGG + Intergenic
1172199940 20:33118336-33118358 GAAGGAGGAAGAGACTGGATTGG + Intergenic
1172270713 20:33654317-33654339 GGTGCAGGGAGTGGGTGGAAGGG + Intergenic
1172963986 20:38819949-38819971 GGTGTAGGGAGTGACTGGAAAGG - Intronic
1173060208 20:39653335-39653357 GGGCGAGGCAGTGACTGGAAGGG + Intergenic
1173239846 20:41284791-41284813 GGTGGAGGATGAGGCTGGAGAGG - Intronic
1173552730 20:43944545-43944567 GGAGGAGGGAGAGGCTGGAAGGG - Intronic
1173761530 20:45564836-45564858 TGTGGAGGAAGGGAAAGGAAAGG + Intronic
1174282722 20:49451024-49451046 TTTGGAGGTATTGACTGGAAGGG - Intronic
1174512083 20:51061026-51061048 AGTGGAGTCAGTGTCTGGAATGG + Intergenic
1174544909 20:51318057-51318079 GGTGGAGAGAGAGACAGGAAGGG - Intergenic
1174753441 20:53135288-53135310 GGAGGAGGGTGTGACTGGAGAGG - Intronic
1175574386 20:60049908-60049930 GGTGAAGGAAGGGAGTGGGAGGG - Intergenic
1175728908 20:61339267-61339289 TGTGGAGGAAGGGACTGGGATGG + Intronic
1175845191 20:62054589-62054611 GGTGGAGGAGGTTGCAGGAAGGG - Intronic
1177159246 21:17529908-17529930 AGTAAAGGAAGGGACTGGAAGGG - Intronic
1177249376 21:18572276-18572298 GGAGGAGGAAGTTGGTGGAAGGG + Intergenic
1177309718 21:19374887-19374909 GGTGTAGGAAATGACTGACAAGG - Intergenic
1178936413 21:36866202-36866224 GGTGGGGGAAGGGAATGGTAAGG + Intronic
1178976666 21:37226560-37226582 GGTGGAGGGTGTGGCTGGAGTGG + Intronic
1179043663 21:37826940-37826962 GGTGGAAGAAGGGACCGCAAAGG + Intronic
1179063385 21:38001187-38001209 ATTGGAGGAAATGACTAGAAAGG - Intronic
1179472325 21:41620036-41620058 GGTGGAGGAAGCAGCTCGAACGG - Intergenic
1179667357 21:42922071-42922093 GGCGGAGGAGGTGACTGGCGAGG + Intergenic
1179953721 21:44726421-44726443 CGTGGAGGCAGAGAGTGGAATGG + Intergenic
1179986692 21:44926159-44926181 GGTGGAGGGAGTGAAGGGGAGGG + Intronic
1180011842 21:45056361-45056383 GGTGCAGGAAGAGAGAGGAATGG - Intergenic
1180121022 21:45748246-45748268 GGTGGAGCAGGAGACTGGGATGG - Intronic
1180815225 22:18785248-18785270 CGTGGAGTGTGTGACTGGAAGGG - Intergenic
1181167124 22:20989747-20989769 GGTGGAGGAGGTGAGGGGCATGG + Intronic
1181201415 22:21219585-21219607 CGTGGAGTGTGTGACTGGAAGGG - Intronic
1181700332 22:24617378-24617400 CGTGGAGTATGTGAGTGGAAGGG + Intronic
1182548390 22:31088585-31088607 TGTGGAGGAATTGACTGCACTGG + Exonic
1182683326 22:32100182-32100204 GATGGAAGATGTGGCTGGAAAGG + Intronic
1183590894 22:38778819-38778841 GGTCGAGGAGGGGACGGGAAAGG + Exonic
1183906857 22:41048178-41048200 GGGGGTGGTAGTGACTGGAAGGG - Intergenic
1183983043 22:41553635-41553657 GCTGGAGGAGGTGACTGGAAGGG - Intergenic
1185351986 22:50344038-50344060 GGGGGGGGAACTGACTGGAGGGG - Intronic
1185352089 22:50344371-50344393 GGGGGGGGAACTGACTGGAGGGG - Intronic
1185352223 22:50344792-50344814 GGGGGGGGAACTGACTGGAGGGG - Intronic
1185352379 22:50345295-50345317 GGGGGGGGAACTGACTGGAGGGG - Intronic
1185352391 22:50345327-50345349 GGGGGGGGAACTGACTGGAGGGG - Intronic
1185352519 22:50345736-50345758 GGGGGGGGAACTGACTGGAGGGG - Intronic
1203225499 22_KI270731v1_random:75845-75867 CGTGGAGTGTGTGACTGGAAGGG + Intergenic
1203265331 22_KI270734v1_random:10939-10961 CGTGGAGTGTGTGACTGGAAGGG - Intergenic
1203296990 22_KI270736v1_random:50395-50417 TGTGGTGGAAATGAATGGAATGG + Intergenic
1203299505 22_KI270736v1_random:67199-67221 GGTAGAGGATTTGAGTGGAATGG + Intergenic
949198545 3:1342953-1342975 GGTGGAGGAGGTGAAAGGAGAGG - Intronic
949514267 3:4793003-4793025 AGTGGGAGAAGTGTCTGGAAAGG + Intronic
949801433 3:7908482-7908504 GGTGGAGAAAATCACTGGAGTGG - Intergenic
950265617 3:11570752-11570774 GTTGGAGGAAGGGACTAAAAGGG - Intronic
952007875 3:28863217-28863239 GGTGGAGGGAGGGATTGGGAAGG + Intergenic
952701406 3:36332120-36332142 GGTGGAGGAAATAACTGAAATGG + Intergenic
952815334 3:37442562-37442584 GGTGGAGGTTCTGACTGCAAAGG - Intergenic
953000160 3:38924856-38924878 GGATGAGGATGGGACTGGAAAGG - Intronic
954367387 3:50153943-50153965 GGTGGAGGAAGAGAAGGGAGAGG + Intergenic
954400222 3:50315599-50315621 GGTGCAGGAAGTCACAGGTATGG + Intergenic
955032353 3:55233551-55233573 GGTGGAGACATTCACTGGAATGG - Intergenic
955734164 3:62018900-62018922 GCTAGAGGAAATGATTGGAATGG + Intronic
955807859 3:62755913-62755935 AGTGGAGGAAGTCTCTGGAAAGG + Intronic
955996801 3:64687069-64687091 GGTGAAGGGATTGACTCGAATGG - Intronic
956986040 3:74701918-74701940 GGGGGAGGAAGTGGGAGGAAAGG - Intergenic
959386018 3:105708108-105708130 GGTGGAGGAAATGGCTGATAAGG - Intronic
959561628 3:107789031-107789053 GGTGGAGGAACTGACCAGATGGG + Intronic
959798168 3:110457431-110457453 GGGGGAGGTAGGGCCTGGAAAGG + Intergenic
960721576 3:120629085-120629107 GGTGAAGGAAATGGCAGGAATGG + Intronic
961403504 3:126663470-126663492 GGTGGATGCAGAGACTGGCAAGG + Intergenic
961476077 3:127147226-127147248 GGGTGAGGGAGTGGCTGGAAAGG - Intergenic
961831711 3:129626506-129626528 GGGGGAGGGACTGACTGGGAAGG + Intergenic
962496975 3:135949832-135949854 GGTGGAGGGATTGACTACAAAGG + Intergenic
963774171 3:149421606-149421628 GTTGATGGATGTGACTGGAAGGG - Intergenic
963808773 3:149753639-149753661 TGTGGAGGAAGAGAGGGGAAGGG + Intergenic
963861118 3:150311589-150311611 GGAGGAGGAGGTAACTAGAAGGG + Intergenic
964076504 3:152699434-152699456 AGTGGAGGAAGTAACTGCAAAGG - Intergenic
964484581 3:157174688-157174710 TGTGGGGTAAGTGACTGGAGGGG + Intergenic
964524664 3:157605759-157605781 GGTGAAGGAAATAACTGGAATGG - Intronic
964728031 3:159835319-159835341 GGGTCAGGAACTGACTGGAAGGG + Intronic
964880347 3:161416791-161416813 GGTGGATGAACTTAATGGAAGGG + Intergenic
965549357 3:169948295-169948317 GCAGGAGAAAGTGGCTGGAAAGG - Intergenic
965566838 3:170128742-170128764 GGAGGAGGAAGAGTCTGAAATGG + Exonic
966431460 3:179835022-179835044 GATGGAGGCAGAGACTGGAGTGG + Intronic
966655956 3:182359063-182359085 GGTGGTGCAATTTACTGGAAAGG - Intergenic
966815129 3:183884478-183884500 TGGGAAGGACGTGACTGGAAGGG - Intronic
966992106 3:185243031-185243053 GGTGGAGGAAGCAGCAGGAAAGG - Intronic
968434686 4:578404-578426 GGAGGAGGAAGTGAACGGATGGG + Intergenic
968950573 4:3689317-3689339 GGTGGAGGCAGTCCCTGGAGAGG - Intergenic
969283364 4:6186393-6186415 GATGGAGGATGAGACAGGAAGGG + Intronic
969397803 4:6934071-6934093 GGTGGAGTAGGTGACTAGAGAGG + Intronic
969868072 4:10088103-10088125 GGAGAAGGTAGTGGCTGGAACGG - Intronic
971257652 4:25029695-25029717 GCAGGAGGAACTGACAGGAAAGG - Intronic
973907563 4:55546678-55546700 GGTGGAGGAGGGGAAGGGAAGGG - Intronic
974585296 4:63866570-63866592 GGGGAAGGAAGTGACATGAAAGG + Intergenic
975342506 4:73258229-73258251 GAGGGAGGAAGGGACTGTAAGGG - Intronic
975499715 4:75071182-75071204 GGTGGGGGAAGTGAAATGAAGGG - Intergenic
975761929 4:77628881-77628903 AGTGGAGGAAGTAACTGCAGAGG - Intergenic
977941675 4:102866433-102866455 GGTGGTGGATGTGGTTGGAAGGG + Intronic
978202295 4:106036247-106036269 GGTGGAGAAGATGACTGGCAAGG + Intergenic
978385849 4:108174845-108174867 GGTGGGGAGAGTGACTAGAAAGG + Intergenic
978435399 4:108678527-108678549 GGTGGGGGTAGTGACCAGAAAGG + Intergenic
978529368 4:109698799-109698821 GGTGGAGGAAGGGAAGGGCAAGG + Intronic
978805382 4:112794846-112794868 GGAGGAGGCAGTGACAGAAATGG + Intergenic
979577787 4:122315787-122315809 TGTGGAGGAAGAGAAGGGAATGG + Intronic
980102493 4:128555317-128555339 TGTGGAGGAAATGACTTGCAAGG - Intergenic
980636664 4:135514644-135514666 GATGGAAGAAGTGATGGGAATGG - Intergenic
980733749 4:136855627-136855649 AGTAGAGGAATTGACTAGAAAGG - Intergenic
981136529 4:141217024-141217046 GGTGAAGGTAGTGACTTCAAAGG - Intergenic
981286798 4:143026886-143026908 GATGGAGTCAGTGATTGGAAAGG + Intergenic
981537714 4:145817163-145817185 GGGAGAGGTAGTGACTGGGATGG - Intronic
981546076 4:145894864-145894886 GGTGGAGGAAATGACAAGGAAGG - Intronic
981793518 4:148568204-148568226 GTTGTTGGAAGTGACTGAAATGG + Intergenic
981965099 4:150590984-150591006 AGTGGAGAAAGTGATTGGGATGG + Intronic
982552464 4:156819981-156820003 GATGGAGGAAGTAACTGCACAGG + Intronic
983114831 4:163801670-163801692 GGAAGAGGAATTGACTGGGAAGG - Intronic
983735329 4:171051940-171051962 GGAGGAGGAAGAGACAGGGAAGG - Intergenic
983765371 4:171474744-171474766 GATGAAGGAAGTAACTGGAAAGG - Intergenic
984563639 4:181301374-181301396 GGTAGAGGAAGGGGCTGAAAAGG + Intergenic
984721525 4:182977594-182977616 GGTAGAGGAAGCAACGGGAAAGG + Intergenic
985401193 4:189595884-189595906 GGCTCAGGTAGTGACTGGAAGGG - Intergenic
985886800 5:2686399-2686421 GGTGGTGGAAGGGAATGGGAGGG - Intergenic
985958031 5:3278948-3278970 GGGGGAGGAAGGGAAGGGAAAGG - Intergenic
986017286 5:3768403-3768425 GATGGAGCATGTGTCTGGAAAGG - Intergenic
987246889 5:16058237-16058259 GGTGGAGGATGGGAAAGGAAGGG - Intergenic
987344194 5:16964272-16964294 GGTGGAGAAAGTGAAGGGGAGGG - Intergenic
988729368 5:33955158-33955180 GGTGGAGGAAGCCACTTGAAAGG + Intronic
989169077 5:38457470-38457492 ACTGGAGGCAGGGACTGGAATGG - Intronic
989425142 5:41287997-41288019 GGTGGAAGGAGAGTCTGGAACGG - Intergenic
990185216 5:53203859-53203881 GGTGGAGTAGGTGACTGGTGAGG - Intergenic
991369748 5:65905734-65905756 GGGGGAGGTAGTGACTGGAAGGG + Intergenic
991915039 5:71597260-71597282 GGTGGAGGGAGTGAGGGGAGAGG + Intronic
991980906 5:72229695-72229717 GGTGGTGACAGTGACTGGGATGG + Intronic
992081899 5:73241383-73241405 GTAGGAGGAAGGGAATGGAAGGG + Intergenic
992881562 5:81115458-81115480 TGTGGAGGGAATGACTGGAATGG + Intronic
993556532 5:89346672-89346694 GTGGGAGGAATTGACTGGAAAGG - Intergenic
993973508 5:94448779-94448801 GGTGAGGGAAATGAATGGAAAGG + Intronic
994648116 5:102495238-102495260 GGAGCAGGAAGTGACTGCAAAGG + Intronic
994945381 5:106381173-106381195 GGTGGAGGAAGGGAATTCAAAGG + Intergenic
995064409 5:107843855-107843877 GGTGGAGGAAGTGTGGGGAGGGG + Intergenic
995156003 5:108913994-108914016 GGTGGGTGTAGTGACTGAAAGGG + Intronic
995545236 5:113223568-113223590 AGTGGAAGTAGGGACTGGAAAGG + Intronic
995866614 5:116698240-116698262 GGTGGAGGAAATGCCAGCAAAGG + Intergenic
997184466 5:131867633-131867655 AGTGAAAGAAGTGACTGAAAAGG - Intronic
997283170 5:132661200-132661222 GTTGGAGGAGGGGACTGGGATGG + Intergenic
997452634 5:133995924-133995946 GGTGGAAGGAGTGACTGGGAGGG - Intronic
997615488 5:135243583-135243605 GATGCAGGATGTGACTAGAAGGG - Intronic
997897082 5:137728645-137728667 AATGGAGGCAGTGAATGGAAAGG + Intronic
999497759 5:152117069-152117091 GGTTGGAGAAGTGACTGGATTGG + Intergenic
999921755 5:156329189-156329211 GGTGGAGGCAGTGAAGGGAGAGG + Intronic
1000550723 5:162659473-162659495 GGGAGAGGAAGTGGTTGGAATGG + Intergenic
1001176081 5:169470270-169470292 GGTAGCTGAAGTGAATGGAAGGG + Intergenic
1002696954 5:181098277-181098299 GCTGGGGGAAGGGACTGGAGGGG + Intergenic
1002720700 5:181259956-181259978 GGGGGATGAAGGGAGTGGAAAGG - Intronic
1003240412 6:4340702-4340724 GGTGGAGGGAGTGTCTGCATAGG - Intergenic
1003708531 6:8562615-8562637 CGTGGAGGTAGTGAATAGAATGG + Intergenic
1004369918 6:15043551-15043573 GGTGCAGGAAGGGACAGGAGTGG + Intergenic
1006949130 6:37806952-37806974 GGGGCAGGGAATGACTGGAAGGG - Intergenic
1007166247 6:39830886-39830908 GATGGAGGAAGGGCCTGAAATGG - Intronic
1007423814 6:41734755-41734777 GCTGGAGGAAGGGACGGGAAGGG + Intronic
1007485665 6:42179011-42179033 GGTGGAGGAAGTGACCAGCACGG - Intronic
1007664739 6:43507537-43507559 GGAGGAGGAAGTGGCAGGAGGGG - Exonic
1007851139 6:44803804-44803826 GGTGGAGGGGGTGACAGGATGGG + Intergenic
1007963758 6:45985078-45985100 GCTGGAGGGAGGGCCTGGAAAGG + Intronic
1008590298 6:52987071-52987093 GGGGGAGGAAGAGATTGGAGGGG + Intronic
1008779112 6:55080764-55080786 TGTGGAGGAAGTGATAGGAGGGG + Intergenic
1009375870 6:62968017-62968039 TGTGGAGAAATTGACTAGAAAGG - Intergenic
1010159848 6:72840544-72840566 CTTGGAGTAAGTGACTGGTATGG - Intronic
1011735089 6:90302536-90302558 GGTGGAATATGGGACTGGAAAGG + Intergenic
1012398370 6:98824930-98824952 GGTGGAGGAGGTGGCGGGAAGGG - Intergenic
1012494536 6:99819726-99819748 GCTGGACAAAGTGAGTGGAAGGG + Intergenic
1013033909 6:106361554-106361576 GGAGGAGGAAGTGGCAGGAATGG + Intergenic
1013293575 6:108739280-108739302 GGTGGAGGAAGTGACTGAGGTGG - Intergenic
1013861605 6:114642349-114642371 GGCATGGGAAGTGACTGGAAAGG - Intergenic
1013877773 6:114855437-114855459 GGTAGAGGAAGCAGCTGGAAAGG + Intergenic
1014107288 6:117581513-117581535 GGTGGAGGTAGTGATTGGAGCGG - Intronic
1014317336 6:119884265-119884287 GGTGGAGGAAGTGCCTTGCATGG - Intergenic
1016191504 6:141272896-141272918 GAGGGAGGAAATGACTGCAAAGG - Intergenic
1016397511 6:143641313-143641335 GATGGAGGCAGAGATTGGAATGG + Intronic
1016537086 6:145119615-145119637 GGTGGAGGGGATGACTGGGATGG - Intergenic
1016686792 6:146891053-146891075 GGTGGAATAAGTCAATGGAATGG - Intergenic
1017083412 6:150690637-150690659 TGTGGAGGATGTGAGAGGAAGGG + Intronic
1017171773 6:151462333-151462355 AATGAAGGCAGTGACTGGAAAGG - Intronic
1017187863 6:151620554-151620576 AGTGGAGGAAGTGACTTCACTGG + Exonic
1018017198 6:159723314-159723336 AGAGAAGGAATTGACTGGAAAGG - Intronic
1018047588 6:159978958-159978980 GGTGTAGGAAGTGAGGGGGATGG + Intronic
1019254815 7:42622-42644 TGAGGATGAAGTGACTGGGAAGG - Intergenic
1020813839 7:12879816-12879838 TTTGTAGGAAGTGAGTGGAAGGG + Intergenic
1023098784 7:36691509-36691531 GGAGGAGAAAGAGAATGGAAAGG + Intronic
1023661538 7:42476047-42476069 GATGGAGGAAGAGATTGGAGTGG + Intergenic
1024932332 7:54676869-54676891 AGTGGAGGAAGTAACTGCAGAGG + Intergenic
1028720602 7:94026651-94026673 GGGGGAGGAGGTGAGGGGAAAGG - Intergenic
1028793328 7:94877886-94877908 GGTGGAGCAGGTGATAGGAATGG - Intergenic
1030173825 7:106630819-106630841 GGTGGAGGCAGAGGTTGGAATGG - Intergenic
1030413560 7:109212793-109212815 GGTGTAGGAGGTGTCTGGAGGGG + Intergenic
1030424685 7:109359598-109359620 GGTGAAGGGACTGAGTGGAAAGG - Intergenic
1030792996 7:113752468-113752490 TGAGGAGGAAATGCCTGGAATGG - Intergenic
1031318572 7:120290236-120290258 GGTTGAAGAAGTGGCTAGAAAGG - Intronic
1031473405 7:122193606-122193628 GGTGCAAGAGCTGACTGGAACGG + Intergenic
1031556443 7:123182465-123182487 AGTGGAGGAAGTGGGTGGAGGGG - Intronic
1032776082 7:135114657-135114679 GGTGGTGGAAATGGCTAGAAGGG - Intronic
1033393263 7:140949246-140949268 GGGGGAGGAGGTGAGAGGAAGGG - Intergenic
1034112275 7:148548502-148548524 AGTGGAGGAAGGGAGTTGAAAGG - Intergenic
1034128668 7:148697100-148697122 GCTGGAGGAAGTCACAGAAAAGG + Intergenic
1034333651 7:150306015-150306037 GGTTGAGGAAGTGATGAGAATGG - Intronic
1034664392 7:152803875-152803897 GGTTGAGGAAGTGATGAGAATGG + Intronic
1035035697 7:155892541-155892563 GGTGGAGGTGGTGACTGTTATGG + Intergenic
1035035728 7:155892675-155892697 GGTGGAGGTGGTGACTGTTATGG + Intergenic
1035101678 7:156402576-156402598 GGGGGAGGAAGGGAGGGGAAGGG - Intergenic
1035536486 8:395113-395135 TGTGGAGGGAGGGACTCGAAGGG + Intergenic
1035884977 8:3281823-3281845 GTTGGAGGTAGTGCCTGGAGGGG + Intronic
1036466886 8:9006042-9006064 GGTGGATGTAGTTACTGGTACGG + Intronic
1036571029 8:9979986-9980008 GGAGGAGGCAGTGGCTGGAGGGG + Intergenic
1037916657 8:22777246-22777268 GATGGAGGAAGTGAGGGGAGTGG - Intronic
1037980372 8:23249139-23249161 GGGGGAGCTAGAGACTGGAATGG + Intronic
1038836016 8:31124338-31124360 GTTGGGGGCATTGACTGGAAAGG + Intronic
1039800292 8:40948820-40948842 AGTGGAGAGAGTGACAGGAAGGG + Intergenic
1040052183 8:43026775-43026797 TGGGGAAGAGGTGACTGGAAAGG + Exonic
1040584381 8:48726210-48726232 GATGGATGAAGTGAATGGGAGGG - Intronic
1041679748 8:60576796-60576818 GAGGGAGGAAGTGACAGTAATGG - Intronic
1041954428 8:63541943-63541965 GGTGGAGGAATTGTCTGAAGAGG - Intergenic
1042194954 8:66223892-66223914 GTTGGAGGAAGTGCCTGTGAAGG + Intergenic
1042302064 8:67294732-67294754 GGTGTAGGAATTGAGTGGGACGG + Intronic
1042310414 8:67373706-67373728 GGTGGATAATGTCACTGGAAAGG - Intergenic
1042464855 8:69116742-69116764 GGAGGAGGAAGTGAGTCAAAGGG + Intergenic
1042879857 8:73475110-73475132 GGGAGAGGGTGTGACTGGAAGGG + Intronic
1043202266 8:77385201-77385223 GTTGGAGGAAGTGAATTCAAAGG + Intergenic
1044535771 8:93354927-93354949 TGTGAAGGATGTAACTGGAATGG + Intergenic
1045012818 8:97973273-97973295 GGGGGAGGATGTGATTGGCAAGG - Intronic
1045383446 8:101648840-101648862 GTTGGGGGAAGTTCCTGGAAGGG - Intronic
1046685924 8:117226812-117226834 GGTGGCAGATGTGATTGGAAAGG + Intergenic
1046845697 8:118913208-118913230 GGTGGAGGCACAGAGTGGAAAGG - Intergenic
1047405942 8:124586032-124586054 GGAGGAGGAAGTGCTTGGCAGGG - Intronic
1047801395 8:128314153-128314175 GGTGGGGGATGTGACAGGGAGGG - Intergenic
1047930787 8:129726752-129726774 GGTGGGGGGAGGGACTGGATTGG - Intergenic
1048035625 8:130674667-130674689 AGGGGAGGAAGTGATGGGAAAGG - Intergenic
1049028746 8:140016429-140016451 GGGGCAGGAATTGACTGGGAAGG - Intronic
1049353842 8:142178088-142178110 AATGGGAGAAGTGACTGGAAAGG + Intergenic
1049788365 8:144462135-144462157 GGGCGAGGAAGTGGCTGTAAGGG + Intronic
1049816712 8:144606636-144606658 GGTGGAGGAGGTGACTGCGGAGG + Intergenic
1049910023 9:257002-257024 GGTGGAGTCAGTGCCTGGAAGGG - Intronic
1050083619 9:1941079-1941101 AGTGGAGGATGAGGCTGGAAAGG - Intergenic
1050673775 9:8028626-8028648 GATGTAGAAAGTGACTGGAGTGG + Intergenic
1050774052 9:9238005-9238027 GGAGGAGAAAGGGACTTGAAGGG - Intronic
1051115081 9:13685373-13685395 GGTGGGGAAAGTCATTGGAATGG - Intergenic
1051270411 9:15349854-15349876 AGTGGAGGAGGTGACAGGGAGGG - Intergenic
1052067318 9:24038137-24038159 GGCACAGGAAGTGACTGGATAGG - Intergenic
1052139301 9:24958901-24958923 GGGGGAGGAAGTGAATGAAAGGG - Intergenic
1053017078 9:34667952-34667974 GATGGAGGAAGTGATTGGGAGGG + Intergenic
1053432558 9:38052716-38052738 AGTGGAGGGAGTGAGTGAAAGGG - Intronic
1053454928 9:38226729-38226751 GGGGAAGTGAGTGACTGGAAGGG + Intergenic
1055236607 9:74130017-74130039 GGGGGAGGGTGTGACTGGAAAGG + Intergenic
1055434925 9:76282941-76282963 AGTGGAGGAAGTGACTGCAGAGG + Intronic
1056235099 9:84586532-84586554 GGGAGTGGATGTGACTGGAAAGG - Intergenic
1056434563 9:86562942-86562964 GGAGCAGGAAGGGATTGGAATGG + Intergenic
1057132132 9:92661519-92661541 GGTGGAGGAAATGTGAGGAAGGG - Intronic
1057184138 9:93047102-93047124 GGTGGAGGTAGAGATTGGAGTGG + Intergenic
1057825736 9:98371012-98371034 GGTACAGGAAGAGGCTGGAAGGG - Intronic
1058069057 9:100583279-100583301 GCAGGAGGAAGAGACTGGAGGGG - Intronic
1058271451 9:102976627-102976649 GGTGTTGGAAGTTAGTGGAAAGG - Intergenic
1058314910 9:103553794-103553816 GGGGCAGGAAGTGAGTGGTAGGG + Intergenic
1060129819 9:121085245-121085267 GTGGGAGTTAGTGACTGGAAGGG + Intronic
1060421708 9:123473771-123473793 AGTGGAGAAAGAGACTGGGATGG - Intronic
1060507559 9:124209500-124209522 GGAGGAGGAAGGGAGGGGAAGGG - Intergenic
1060886403 9:127155514-127155536 CGTGGAGGAAGAGGCTGGAAAGG + Intronic
1061256116 9:129454704-129454726 GGTGGAGGTAGTGGGTGGCAGGG + Intergenic
1061261613 9:129483383-129483405 GTGGGTGGAAGTGTCTGGAAGGG + Intergenic
1061369798 9:130191890-130191912 GGTGGAGACAGTGACTGCCAAGG + Intronic
1061394504 9:130336688-130336710 GATGGAGGGGGTGGCTGGAAAGG + Intronic
1061427979 9:130512715-130512737 AGTGTAGGCAGTGACTGGAGAGG - Intergenic
1061635489 9:131905838-131905860 GGAGGAAGAAGGAACTGGAAGGG - Intronic
1062446348 9:136596947-136596969 GGTGGAGGAGGGGACTGGAGTGG + Intergenic
1062594626 9:137293613-137293635 GCAGGAGGAATTGACTGGGATGG + Intergenic
1062628729 9:137454241-137454263 GGCTGGGGAAGTGGCTGGAAGGG + Intronic
1062670571 9:137706321-137706343 GGTGGATGTTGTGAGTGGAAAGG + Intronic
1203351201 Un_KI270442v1:82719-82741 TGTAGAGGAATTGAATGGAATGG + Intergenic
1185455694 X:309633-309655 GATGGAGGCAGAGACTGGAGTGG + Intronic
1185703858 X:2251902-2251924 GGGGTAGGAGGGGACTGGAAAGG + Intronic
1185782352 X:2860424-2860446 GTTGGAGGAAGTGTCTGAAGAGG + Intronic
1185940202 X:4309397-4309419 GGTGGAGGAGGTGGTGGGAATGG + Intergenic
1186410832 X:9343001-9343023 GGGTGAGGAAGTGCCTGGGAAGG + Intergenic
1187016962 X:15338778-15338800 GTTTGAGCATGTGACTGGAATGG + Intergenic
1187275458 X:17812998-17813020 GGTGGAGGGAGAGACAGGACTGG + Intronic
1187428267 X:19198182-19198204 AGGAGAGGAACTGACTGGAAAGG - Intergenic
1187956453 X:24523518-24523540 GGTGGTGCAATGGACTGGAATGG + Intronic
1188050188 X:25474986-25475008 TGTGGAAGAAGTCACTTGAAGGG + Intergenic
1188598701 X:31933698-31933720 CTTGGAGGCAGTGACTGCAAAGG - Intronic
1189150592 X:38702338-38702360 GGTGGAGGAACTGACCACAAAGG + Intergenic
1189167763 X:38878192-38878214 CGTGGGGGAGGTGACTGGAAAGG - Intergenic
1190460617 X:50669866-50669888 TGTGGAAGAAGTAACTGCAAAGG - Intronic
1190579536 X:51878258-51878280 GGGTGAGGAATTAACTGGAAGGG + Intronic
1190712722 X:53081690-53081712 GGTGGGGGAAGGGACAGAAACGG + Intergenic
1190729698 X:53217479-53217501 GGTGGAGGAAGTGACTGGAAGGG - Intronic
1190735139 X:53250906-53250928 GGTGGAGGAACTGGCGGGAGAGG + Exonic
1192198828 X:69050604-69050626 GGTGGGAAAAGTCACTGGAAAGG - Intergenic
1192282445 X:69700575-69700597 GGCGGAGTAGGTGACTGGCAAGG + Intronic
1192534682 X:71917292-71917314 GAGGGAGGAAGGGAATGGAAGGG - Intergenic
1192627535 X:72745811-72745833 GTTGGAGGAAGCGACTTGGAAGG + Intergenic
1192654173 X:72975002-72975024 GTTGGAGGAAGCGACTTGGAAGG - Intergenic
1192774959 X:74234104-74234126 GGTGGAGGAAATTACTGTACAGG + Intergenic
1193567964 X:83102572-83102594 GGTGGAATTAGTGACTGGTAGGG + Intergenic
1195049585 X:101084955-101084977 GATGGGGGTAGTAACTGGAAGGG - Intronic
1196101463 X:111851627-111851649 GGTGGTGGAAGTGATGAGAAAGG + Intronic
1196759646 X:119189981-119190003 GTTGGAAGAAGTGCCTGGGAAGG - Intergenic
1197654006 X:129096493-129096515 GGTGGTGGCATTGACTGAAAAGG - Intergenic
1197750750 X:129961949-129961971 GGTGGAGAGCGTGACTGGTATGG + Intergenic
1197882517 X:131181870-131181892 GATGGAGGGACTGACTGCAAAGG - Intergenic
1198051274 X:132955731-132955753 GGTGGGGGAAGTGAGTGCTATGG - Intronic
1198208579 X:134493900-134493922 GGGTGAGGAAGTGATAGGAAGGG + Intronic
1198962938 X:142201997-142202019 GGTGAGGGAAGAGCCTGGAATGG - Intergenic
1199416581 X:147590358-147590380 TGTGGAGGTAGTGAATAGAATGG + Intergenic
1199675324 X:150183987-150184009 GATGGAGGCAGAGATTGGAATGG + Intergenic
1200138894 X:153887618-153887640 AGTGGAGGCAGCAACTGGAAAGG - Intronic
1200166622 X:154040007-154040029 GGTGGAGGAAGTCACTGAGGAGG + Intronic
1200273775 X:154712586-154712608 GGTGGACCAAATGACTGGAGGGG + Exonic
1201116051 Y:10836171-10836193 TGGGAAGGAAGTGAATGGAAAGG - Intergenic
1201117297 Y:10844522-10844544 TGTAGAGGAATGGACTGGAATGG - Intergenic
1201124244 Y:10899248-10899270 GGGGGTGGAATTGAATGGAAGGG - Intergenic
1201140777 Y:11026279-11026301 GGTAGAGGAAGGGAGTCGAATGG - Intergenic
1201213481 Y:11701865-11701887 GGTAGTGGAATTGAGTGGAATGG + Intergenic
1201268048 Y:12227945-12227967 GATGGAGGCAGAGACTGGAGTGG + Intergenic
1201583672 Y:15537063-15537085 GGTGGAATAAGCAACTGGAAAGG + Intergenic