ID: 1190732449

View in Genome Browser
Species Human (GRCh38)
Location X:53234614-53234636
Sequence GGCCATGTGGAGCAAACTGA GGG
Strand +
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 204
Summary {0: 1, 1: 0, 2: 4, 3: 34, 4: 165}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1190732449 Original CRISPR GGCCATGTGGAGCAAACTGA GGG Exonic
900197047 1:1381734-1381756 CACCATCTGGAGGAAACTGATGG - Intergenic
903069479 1:20719939-20719961 GGCCATGTTTAGCACACTGAAGG - Intronic
903666414 1:25010278-25010300 GGCAAGGTGGTGCAAACTGTTGG - Intergenic
905200751 1:36314935-36314957 ATCCATGTGGACCAAGCTGAGGG + Intronic
908257644 1:62316153-62316175 GGCCATGTGGGCCAGACTGGGGG - Intronic
910270088 1:85385519-85385541 GGCCTTGTGGTCCAAACTTATGG - Intronic
916809018 1:168289245-168289267 GGCCAAGTGTAGAAAACAGAAGG - Intronic
919145635 1:193630884-193630906 GGCCATGTGGATCCAATTAATGG - Intergenic
919651186 1:200150102-200150124 AGCCAAGTGGAGCAATTTGAAGG + Intronic
920432938 1:205930209-205930231 AGCCATGTAGAGCACAGTGAAGG - Intronic
1064240875 10:13627161-13627183 GGACGTGTGGGGCAACCTGAAGG - Intronic
1064752877 10:18549469-18549491 GGCCCTATGGAGCAAGCTAAAGG - Intronic
1066398387 10:35049735-35049757 GGATATGTGGAGGAAATTGATGG - Exonic
1076228585 10:128801193-128801215 AGCCAAGTGGGGCAAACTGGTGG - Intergenic
1076378780 10:130011111-130011133 GGCCTTGTGGAGCCAACTGTGGG - Intergenic
1079028715 11:16969048-16969070 GGCCATGCAAAGGAAACTGAAGG + Intronic
1081303965 11:41488605-41488627 GACAATGTGGAAGAAACTGAAGG - Intergenic
1081983731 11:47286644-47286666 AGCCATGAGGAGCAACATGAGGG - Intronic
1082614853 11:55347336-55347358 GGCAATGTGGATGAAACTGGAGG - Intergenic
1086854436 11:91849452-91849474 AGCCATGGGGAGCTCACTGAAGG - Intergenic
1088151439 11:106750096-106750118 GGCCTTCTGCAGCAGACTGAAGG - Intronic
1089629089 11:119772691-119772713 GGCCATGGGGAGTAGACAGAGGG + Intergenic
1092987641 12:13861855-13861877 GGCCATGTGGAGCAGTTTGAAGG - Intronic
1093934389 12:24985237-24985259 GGCCATATGGATCAAATTGTTGG - Intergenic
1095817439 12:46440148-46440170 AGCCATGTGGAGCACAGTCATGG + Intergenic
1097295235 12:57955857-57955879 GAACATGTGGAGAAAACGGATGG + Intronic
1098324000 12:69281139-69281161 GGTTATGTGGGGCCAACTGAGGG + Intergenic
1103041996 12:117703426-117703448 GGCCAGGGGGAGGCAACTGAGGG - Intronic
1103489971 12:121309816-121309838 GGCCATGTGGAGAAGACTTAAGG + Exonic
1109846716 13:68002309-68002331 GGCCATGTATAACAAAGTGATGG - Intergenic
1110369882 13:74727929-74727951 GGACAGATGGAGCAACCTGAAGG - Intergenic
1111455731 13:88481465-88481487 GACCATGTGGTGCAAACCTAGGG - Intergenic
1112145273 13:96692964-96692986 GGCCATTTGTAGCTAACTGTTGG + Intronic
1113320422 13:109227462-109227484 GCCCGTGTGGAGAGAACTGAGGG - Intergenic
1113637299 13:111928502-111928524 GGCATTGTGCAGCAAACAGAAGG + Intergenic
1113911078 13:113841586-113841608 GGGCATATGGAGGAAACTGTGGG - Intronic
1113911101 13:113841686-113841708 GGGCATATGGAGGAAACTGTGGG - Intronic
1113911110 13:113841725-113841747 GGGCATATGGAGGAAACTGTGGG - Intronic
1113911140 13:113841848-113841870 GGGCATATGGAGGAAACTGTGGG - Intronic
1114656185 14:24316848-24316870 GGAGAGGTGGAGCAAAGTGAGGG + Exonic
1117778237 14:59204362-59204384 GGCCATGTGGAACAGAATGTGGG - Intronic
1119696795 14:76719730-76719752 AGCCATGTGGACAAGACTGAGGG + Intergenic
1119772046 14:77226191-77226213 GGACAGGTGGAGCACACTGAGGG - Intronic
1202832164 14_GL000009v2_random:46843-46865 GGCCACGTGGATCAGTCTGACGG - Intergenic
1126154834 15:45556203-45556225 GGCCATGTGTATCAAAGTCAGGG - Intergenic
1126774962 15:52092646-52092668 GGCCACGTGTAGCCAACTGAAGG - Intergenic
1126780861 15:52137837-52137859 GGCCCTGTGGAGCAGCCAGAAGG - Intronic
1128113394 15:65090427-65090449 GGCCCAGTGGAGCAGGCTGAAGG - Intergenic
1128869723 15:71144878-71144900 GTCCATGTGGACCAAAGTGTAGG + Intronic
1129149323 15:73677784-73677806 GGCCAAGTGGAGAACACTGTGGG + Intergenic
1131086549 15:89580264-89580286 TGCCTTGTGGATCAAAGTGAGGG + Intronic
1133180293 16:4049182-4049204 GGCCGTTTGGAGCAGACTCAGGG - Intronic
1134325936 16:13207670-13207692 GCCAATGAGGAGCAGACTGAGGG + Intronic
1137407093 16:48197791-48197813 GGCCATGGGGTGTAGACTGATGG - Intronic
1137705390 16:50532136-50532158 GTCCATCTGGAGCAAACTCATGG + Intergenic
1138579088 16:57927958-57927980 GGCTAGGTGTAGCAAACTGAGGG - Intronic
1140667233 16:77238840-77238862 GGCCAGGTGGAGAAGAATGAAGG - Intergenic
1144346769 17:14356518-14356540 AACCATATAGAGCAAACTGAAGG + Intergenic
1144775485 17:17782767-17782789 GGCGGTGTGGAGAAACCTGACGG - Intronic
1148639029 17:49171041-49171063 GGCCATGATGCCCAAACTGAAGG - Intergenic
1149408090 17:56375341-56375363 GGACAGGTAGAGCAAACTAAGGG + Intronic
1150432206 17:65127427-65127449 GGACACTTGGAGCAAACAGAGGG + Intergenic
1150640783 17:66948119-66948141 AGCCATGTGGATCAAAATAAAGG - Intergenic
1151991354 17:77576891-77576913 GTCCATGTGAAGGAAACTGTGGG - Intergenic
1152650674 17:81491188-81491210 GTCCACTTGGAGCAGACTGAGGG - Intergenic
1159718187 18:71851137-71851159 GCCCATGTGGAGCACAGTGTGGG - Intergenic
1161207107 19:3047022-3047044 GGGCGTGGGGAGAAAACTGAGGG - Intronic
1164159770 19:22618550-22618572 AGCCATGTGGACCAAAATGCAGG - Intergenic
1164343526 19:24436276-24436298 GGACATTTGGAGCACATTGAGGG + Intergenic
1167090546 19:47341008-47341030 GGCCAGGTGGAGCAACCAGGTGG - Exonic
1168381251 19:55925615-55925637 GGTGATGTGCAGCAAATTGAGGG - Intronic
1202640522 1_KI270706v1_random:80928-80950 GGCCAAGTGGATCAGTCTGACGG + Intergenic
927188514 2:20499830-20499852 GGCCTGGTAGACCAAACTGAGGG + Intergenic
927395075 2:22640433-22640455 TGACATGTGGAGCAAGCTGGTGG + Intergenic
929956217 2:46460582-46460604 GGCCATGTGGTAGAAACTGGAGG + Intronic
933204987 2:79496949-79496971 GGCCATATATAGAAAACTGATGG + Intronic
934496084 2:94800891-94800913 GGCCATGTGGATCAGTCTGAGGG + Intergenic
935847483 2:107182407-107182429 GTCCATTTGAAGGAAACTGAAGG - Intergenic
937656525 2:124383058-124383080 GGACACCTGGAGGAAACTGAAGG - Intronic
937725903 2:125166238-125166260 GGCCAGGAGGAGCCAAATGAAGG + Intergenic
939873863 2:147554644-147554666 GGCAACATGGAGCAAACTGAGGG + Intergenic
948751305 2:240134963-240134985 GGCGATGTGGAGCCACCGGAGGG - Intronic
949073527 2:242040867-242040889 AGGCATGTGGAGGAAAGTGAGGG + Intergenic
1168938271 20:1686644-1686666 GGCCATGTGGAGAGAACATATGG - Intergenic
1169030402 20:2402387-2402409 GGCCAAGGGGAGCAAAGAGATGG - Intronic
1169574906 20:6949084-6949106 GGCCATATGTAGCTTACTGATGG + Intergenic
1171887398 20:30667650-30667672 GGCCACGTGGATCAGTCTGAGGG + Intergenic
1172427833 20:34867783-34867805 TGCCATGTGGAGCAATGGGAAGG - Intronic
1172770182 20:37377643-37377665 GGCCATGTGGACCCAGGTGATGG + Intronic
1173727991 20:45310161-45310183 GGCCATTTGACGGAAACTGAAGG + Intronic
1175256655 20:57652079-57652101 AGCCATCTGGAGCAAAGAGAAGG - Exonic
1175408295 20:58749523-58749545 GGCCATCTGGAGCAAGGCGAAGG + Intergenic
1180086138 21:45508809-45508831 GGCCCTGTGGAGCAGACAGTGGG + Intronic
1180361422 22:11900953-11900975 GGCCAAGTGGATCAGTCTGACGG - Intergenic
1182694709 22:32189863-32189885 GGCCATGTCTACCAAACTGTTGG - Intergenic
1184499186 22:44861663-44861685 GGCCATGTGGACCAACGTGAGGG - Intronic
949777904 3:7652627-7652649 AGCCATGGGGTGCAAACTGCAGG - Intronic
950440252 3:13006334-13006356 GGGCACGTGGAGGGAACTGAAGG + Intronic
950440268 3:13006392-13006414 GGCCATGTGGAGGGAACTAAGGG + Intronic
950557142 3:13702685-13702707 GGTTATGTGGAGGGAACTGAGGG + Intergenic
950557274 3:13703311-13703333 GGCCACGTGGAGGAAACTGAGGG + Intergenic
950557363 3:13703669-13703691 GGGGATGTGGAGGAAATTGAGGG + Intergenic
950557454 3:13704114-13704136 GGCCATGTGGAGGGAACTGATGG + Intergenic
950557477 3:13704231-13704253 GGCCAAGTTGAGGCAACTGAGGG + Intergenic
950557676 3:13705180-13705202 GGGCATGTGGAGGGAACTGAAGG + Intergenic
950557866 3:13706126-13706148 GGGCATGTGGAGTAAACTGAGGG + Intergenic
950558035 3:13706884-13706906 GGCCACATGGAGAGAACTGAGGG + Intergenic
950558080 3:13707063-13707085 GACCATGTGGAGGGAACTGAGGG + Intergenic
950558385 3:13708435-13708457 AACCACGTGGAGAAAACTGAGGG + Intergenic
950558719 3:13709933-13709955 GGGCATGTGGTGATAACTGAGGG + Intergenic
950558750 3:13710053-13710075 GGGCATGTGGAGGGAACTGAGGG + Intergenic
950558839 3:13710465-13710487 GGCCACGTGGAGGGAACTGAGGG + Intergenic
950559056 3:13711504-13711526 GGCCACATGGAGGAAAGTGAGGG + Intergenic
950559115 3:13711804-13711826 GAGCATGTGGAGGGAACTGAGGG + Intergenic
950559128 3:13711865-13711887 GAGCATGTGGAGGGAACTGAGGG + Intergenic
950559210 3:13712277-13712299 AGCCACGTGAAGAAAACTGATGG + Intergenic
950559230 3:13712355-13712377 AGGCATGTGGAGAAAACTGCAGG + Intergenic
950559296 3:13712696-13712718 GGTCATGTGGAGGAAACTGAGGG + Intergenic
950559345 3:13712923-13712945 GGGCACGTGGTGGAAACTGAGGG + Intergenic
950559360 3:13712980-13713002 GGCTAAGTGGAGGAAACTGAGGG + Intergenic
950559402 3:13713161-13713183 AACCATGTGGAGAAAACTGATGG + Intergenic
950559432 3:13713282-13713304 GGTTATGTGGAGGGAACTGAGGG + Intergenic
950559561 3:13713866-13713888 GGGCATATGGAGGGAACTGAGGG + Intergenic
950559825 3:13714965-13714987 GGCTATGTGGAGGGAACTGATGG + Intergenic
950559986 3:13715665-13715687 GGCCATGTGGTGGGAACTGAGGG + Intergenic
950745279 3:15083001-15083023 GGCAATGTGGTGGGAACTGATGG - Intronic
953540719 3:43815391-43815413 GACCTTGGGGAGCAACCTGAAGG - Intergenic
955073333 3:55589897-55589919 GGCCCTGTGCAGCACACTGAAGG + Intronic
955404915 3:58619945-58619967 GGACATGTGGGGGAAACTGAGGG + Intronic
955492458 3:59496883-59496905 GACCAAGTTCAGCAAACTGAAGG - Intergenic
955928753 3:64034124-64034146 GCCCAGGTGGAGAAAACTGGTGG + Intergenic
958944299 3:100347041-100347063 GGCCATGTGGAGCTGACATATGG + Intronic
959218804 3:103487870-103487892 GGCAATGTGGATCAACCTGGAGG - Intergenic
966885107 3:184373163-184373185 TGCCCTGTGGAGGAAGCTGAGGG + Exonic
966905992 3:184526048-184526070 GGCCAGGTGGAGCAAGAGGAGGG + Intronic
1202738034 3_GL000221v1_random:26474-26496 GGCCACGTGGATCAGTCTGATGG - Intergenic
969145865 4:5123616-5123638 GGCCACGTGGAGGACACAGAGGG - Intronic
969853516 4:9980709-9980731 GTACATGGGGAGCACACTGAGGG + Exonic
973384034 4:49491440-49491462 GGCCACGTGGATCAGTCTGACGG + Intergenic
974058547 4:57009004-57009026 GGCAATGTGGAGAAAAGAGAAGG + Intronic
975781553 4:77845993-77846015 GGACATGTGGGGCAGTCTGAAGG + Intergenic
976414507 4:84757016-84757038 GGCCATGAGGAGAAAATAGAGGG + Exonic
984661230 4:182378018-182378040 GGTCATGTGGAGGATACGGAGGG + Intronic
984825133 4:183917294-183917316 GGCCCGAAGGAGCAAACTGAAGG + Intronic
1202767887 4_GL000008v2_random:166771-166793 GGCCACGTGGATCAGTCTGACGG + Intergenic
986739939 5:10697077-10697099 GGCAATGTGGAACATACTGGGGG + Intronic
989913810 5:49695241-49695263 GGACATTTGGAGCACATTGAGGG + Intergenic
989914737 5:49709729-49709751 GGACATTTGGAGCACATTGAGGG + Intergenic
990628672 5:57642626-57642648 GGCCATGTGCAGCATACAGAAGG - Intergenic
990987659 5:61655701-61655723 GGCCAAGGGGAGGAAACTGAGGG + Intronic
991618888 5:68524914-68524936 GAACATGTGGAGCATAATGAAGG - Intergenic
992276250 5:75122797-75122819 GGCCATATGCAACAAACTTATGG + Intronic
996990818 5:129628485-129628507 AGACAAGTGGAGCAAAATGAAGG + Intronic
998990512 5:147810327-147810349 GGCCATGTGGAGAAAAATCAAGG - Intergenic
1002536079 5:179876294-179876316 GGCAATTTGTAGGAAACTGATGG + Intronic
1202774374 5_GL000208v1_random:52655-52677 GGACATTTGGAGCACTCTGAGGG - Intergenic
1003399288 6:5778718-5778740 GGCCATGTGGCCCCAACTGTTGG + Intergenic
1005173553 6:23016725-23016747 GGAAATGTGCATCAAACTGACGG - Intergenic
1006105449 6:31713685-31713707 GGGCATGTGGAGGAACCTGAGGG - Intronic
1006841666 6:37032304-37032326 GGCCTGGTGGAGCACACGGAGGG - Intergenic
1007269662 6:40626902-40626924 AGCCATCTGGAGAAGACTGATGG - Intergenic
1011606084 6:89107221-89107243 GGCCATATCGACCAAACTCACGG + Exonic
1014254321 6:119146300-119146322 GAACATGTGGAGCACACTGCGGG - Intronic
1015049833 6:128826895-128826917 AGACATGTGGAGGATACTGAAGG + Intergenic
1015779801 6:136853102-136853124 AGCCATATGTAGAAAACTGATGG + Intronic
1016981083 6:149854786-149854808 GCCCCTGTGGAGGAAAGTGATGG - Intronic
1022520471 7:31003555-31003577 GGTCATCTGGAGCATCCTGAGGG + Intergenic
1028338805 7:89692616-89692638 GGCTAGGTGGAGGAAAATGAAGG - Intergenic
1029279953 7:99429145-99429167 GCCCATGAGCAGGAAACTGAAGG + Exonic
1030240358 7:107316482-107316504 AGACATGTGGAGAATACTGAAGG + Intronic
1030470945 7:109961756-109961778 AGCCATGTGGAGAAATCTGTAGG + Intergenic
1033473360 7:141668200-141668222 GGCATGGTGGAGCAAACTGGAGG + Intronic
1038744229 8:30242668-30242690 AGCCATGTGAACCACACTGAAGG + Intergenic
1039138330 8:34353740-34353762 GAGCATGTCGAGCACACTGAAGG + Intergenic
1042485024 8:69338849-69338871 AGGCATGTGGAGGAAAGTGAGGG + Intergenic
1043517176 8:81005575-81005597 GGCAATATGGAGAAAACTGGAGG + Intronic
1043704030 8:83326629-83326651 AGCCATATGCAGAAAACTGAAGG + Intergenic
1045240465 8:100396184-100396206 GGCTCTGTGGAGGAAGCTGATGG + Intronic
1045657313 8:104400140-104400162 GGCCATGGGGAGCTCACAGATGG - Intronic
1046840657 8:118852874-118852896 TGCCAAGTAGAGGAAACTGATGG + Intergenic
1046903348 8:119545735-119545757 GGCCATGGTGTGCAAACAGAAGG - Intergenic
1047392159 8:124461131-124461153 TGCCATGTGGAGGAATTTGAGGG + Intronic
1052204770 9:25826710-25826732 AGCCATGTTGAGGAAACTCAAGG - Intergenic
1052722696 9:32191440-32191462 GGACATCAGGAGCAATCTGAAGG - Intergenic
1052801627 9:32973444-32973466 GGCCCACTGGAGCAAACTGCTGG - Exonic
1053661058 9:40279490-40279512 GGCCATGTGGATCAGTCTGAGGG - Intronic
1053911436 9:42908827-42908849 GGCCATGTGGATCAGTCTGAGGG - Intergenic
1054373178 9:64425705-64425727 GGCCATGTGGATCAGTCTGAGGG - Intergenic
1054523552 9:66096794-66096816 GGCCATGTGGATCAGTCTGAGGG + Intergenic
1054680809 9:67915483-67915505 GGCCATGTGGATCAGTCTGAGGG - Intergenic
1056144935 9:83720152-83720174 GCCCATGTGGACCAAAATGGGGG - Intergenic
1059058864 9:111014231-111014253 GGCCTTGTGGGGAAAACTTAAGG + Intronic
1060482699 9:124026514-124026536 GGGCATGTGGAGCAAGGTGTGGG + Intronic
1203692297 Un_GL000214v1:55693-55715 GGCCACGTGGATCAGTCTGACGG + Intergenic
1203418137 Un_KI270366v1:3417-3439 GGACATTTGGAGCACTCTGAGGG - Intergenic
1203706763 Un_KI270742v1:56918-56940 GGCCATGTGGATCAGTCTGATGG - Intergenic
1203643998 Un_KI270751v1:48498-48520 GGCCACGTGGATCAGTCTGACGG - Intergenic
1186780216 X:12904507-12904529 GGTTGTGTGGAGAAAACTGAAGG + Intergenic
1187182424 X:16955604-16955626 GGCCATGTGGAGGGAACTGCAGG - Intronic
1187186700 X:16993544-16993566 GACTATGTGGAGGAAAATGAAGG + Intronic
1187359372 X:18610366-18610388 GTCCATCTGGAACAAACTGTGGG - Intronic
1190732449 X:53234614-53234636 GGCCATGTGGAGCAAACTGAGGG + Exonic
1193870361 X:86789693-86789715 GGCCATGTGCATAACACTGAAGG + Intronic
1199693966 X:150330420-150330442 GGCCAAGTGGAACAGACTGAAGG + Intergenic