ID: 1190735784

View in Genome Browser
Species Human (GRCh38)
Location X:53255402-53255424
Sequence ACATATAGGAAAAAACTGGA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 471
Summary {0: 1, 1: 0, 2: 2, 3: 47, 4: 421}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1190735784_1190735791 30 Left 1190735784 X:53255402-53255424 CCTTCCAGTTTTTTCCTATATGT 0: 1
1: 0
2: 2
3: 47
4: 421
Right 1190735791 X:53255455-53255477 TAGCCAAACAATCTATTGTATGG 0: 1
1: 0
2: 1
3: 14
4: 118

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1190735784 Original CRISPR ACATATAGGAAAAAACTGGA AGG (reversed) Intronic
902595480 1:17506715-17506737 ATTTATAGCACAAAACTGGAAGG - Intergenic
903083198 1:20829745-20829767 ACAATGGGGAAAAAACTGGATGG + Intronic
903090474 1:20910855-20910877 ATATTTATGTAAAAACTGGAAGG + Intronic
903170964 1:21553330-21553352 ACATATGTGAAAAAACTGGCTGG - Intronic
904758587 1:32784379-32784401 ATATATAGGAATAAAATGGGGGG - Intronic
905534344 1:38708388-38708410 ACATATAGGTTAAAAGTGCAAGG + Intergenic
906037776 1:42763262-42763284 ACATTTAGGGAAAAGGTGGATGG + Intronic
906090500 1:43175483-43175505 AAATAAAATAAAAAACTGGAAGG - Intronic
906161730 1:43654647-43654669 ACATATAAGAAAATACGGAAAGG - Intronic
908279972 1:62522688-62522710 ACATATATAAAAAAACTGACAGG + Intronic
908577321 1:65474664-65474686 AAATAGAGGAAGAAAGTGGATGG + Intronic
908988913 1:70060592-70060614 AAATATTGGAAAAAAATAGATGG + Intronic
909342201 1:74544825-74544847 ACAGATGGGAAAAAACAGGGAGG + Intergenic
909387222 1:75071800-75071822 AAATATAGGATAAAAGTGTAGGG + Intergenic
909891988 1:81018789-81018811 AAAAAGAGGAAAAAACAGGAGGG + Intergenic
910052599 1:82993478-82993500 ACACAGAAGAAAACACTGGAAGG + Intergenic
910813686 1:91265205-91265227 CCATACAGGTAAAAACTAGAGGG + Intronic
911245783 1:95515517-95515539 ACATTAAGTAAAAAACTGTAAGG - Intergenic
913181050 1:116321853-116321875 ACATCTAGGCAAAGACTGGCTGG + Intergenic
913965769 1:143376469-143376491 ACAGATGGAAAAAACCTGGAAGG - Intergenic
914060143 1:144202077-144202099 ACAGATGGAAAAAACCTGGAAGG - Intergenic
914119007 1:144764292-144764314 ACAGATGGAAAAAACCTGGAAGG + Intergenic
915502692 1:156330240-156330262 ACTTTTAGGGAAAACCTGGAAGG - Intronic
915955660 1:160218080-160218102 TCATAAAGGCAAAAGCTGGAGGG - Intronic
916301528 1:163280823-163280845 ACAAAAAGAACAAAACTGGAAGG + Intronic
916581946 1:166116760-166116782 ACTTATGGGAAAACACTGGCTGG + Intronic
916710725 1:167404820-167404842 AGAAAAAGGATAAAACTGGATGG - Intronic
916810573 1:168302010-168302032 ACCTAAAGGAAAAAACTGAGGGG - Intronic
917678226 1:177340375-177340397 AGAGATAGTAAAACACTGGATGG + Intergenic
918012577 1:180601883-180601905 GCAAAGAGGAAAAAAATGGATGG - Intergenic
918986943 1:191643293-191643315 ACATATTGGAAAAAACACAAAGG - Intergenic
919322787 1:196064508-196064530 ATGTATAGGAGAAAGCTGGAGGG - Intergenic
920867380 1:209764320-209764342 AGATATAGGAAAATACAAGAAGG + Intronic
921500615 1:215898101-215898123 ATACATAGCAAAGAACTGGAAGG - Intronic
922224962 1:223638075-223638097 AAATATTTGAAAAAAATGGATGG + Intronic
922277977 1:224096849-224096871 TATTATAGGATAAAACTGGATGG - Intergenic
924079449 1:240378644-240378666 ACATAAAGGAAAAGATTGAAAGG - Intronic
924203851 1:241690174-241690196 ACATAAAGAAAAAAACTGGCTGG + Intronic
1064501984 10:15983494-15983516 ACATATAGGCAAGGACTAGAAGG - Intergenic
1064677486 10:17775908-17775930 ACATTTACTAAAAAACTAGAAGG - Intronic
1064791491 10:18961398-18961420 AAAAAAAGAAAAAAACTGGAAGG - Intergenic
1064874606 10:19978957-19978979 ACATATAAGAAAATACTTGTAGG - Intronic
1067229337 10:44395848-44395870 AAAAAAAGGAAGAAACTGGATGG + Intergenic
1069364323 10:67681208-67681230 ACATCTAGGAAAATCCTGAAAGG + Intronic
1069696261 10:70387707-70387729 AGATATAGCAAAAATCAGGAAGG - Intergenic
1070072911 10:73107034-73107056 AAATATTGGAAAATATTGGAAGG - Intergenic
1071605897 10:86988922-86988944 GCATAGAGAAATAAACTGGAAGG - Intergenic
1071977858 10:90973301-90973323 GCATATGGTAAAAACCTGGAGGG + Intergenic
1073370193 10:102981376-102981398 TAATATAGGAAAAAAGAGGAAGG - Intronic
1073532972 10:104249663-104249685 ACATTTAGGAGATAACTGGCAGG + Intronic
1073849495 10:107598316-107598338 ACATATAGCAGAAAATTAGAAGG - Intergenic
1073855469 10:107668224-107668246 ATATATAGAAAAAAAATAGATGG - Intergenic
1073917607 10:108424860-108424882 ACATATAAGAATAAACTCAAAGG - Intergenic
1074350386 10:112731201-112731223 ACATTTTGGGAAAAACTGAAGGG + Intronic
1075846000 10:125545343-125545365 AGATATGGGAGAAAACAGGACGG + Intergenic
1077759747 11:5080762-5080784 ACACACAAGAAAAAAATGGAAGG + Intergenic
1078970151 11:16400343-16400365 ACATTTAAGCAAAAACTTGAAGG + Intronic
1079048912 11:17135658-17135680 ACATATATGAAATTACTTGAAGG - Intronic
1080044059 11:27789848-27789870 CCATAAAGGAAAAAACTTGACGG + Intergenic
1081394555 11:42570224-42570246 TCATAGAGGAAAAAAAAGGAAGG + Intergenic
1081879695 11:46438130-46438152 ACATATTGGAAAAAAATGATGGG + Intronic
1082305229 11:50564305-50564327 ACATACAGAAAAAAAATAGAAGG - Intergenic
1082855345 11:57801251-57801273 ACACACAGGAAACAACTGGTAGG - Intronic
1083319489 11:61836970-61836992 ATGTATAGAAAAAAGCTGGAAGG + Intronic
1085473688 11:76774370-76774392 ACAAAGAGGAAAAAAATGGAAGG - Intergenic
1086607821 11:88717741-88717763 ACATTTAGGAAAATACTTCAAGG + Intronic
1086771004 11:90767562-90767584 ACACATAGGAAAAAAGAGAAAGG + Intergenic
1086842585 11:91705904-91705926 ACCTATATGAAAAGACTGGTGGG - Intergenic
1087530330 11:99373257-99373279 AAATAGAGTACAAAACTGGATGG + Intronic
1088935803 11:114399529-114399551 ACATATCTGAAAAAAGTGAAGGG + Intronic
1089100255 11:115957095-115957117 ACATAAAAGCAAAAAATGGATGG + Intergenic
1089845184 11:121452640-121452662 AGGGAGAGGAAAAAACTGGAGGG - Intronic
1090284529 11:125488315-125488337 ACATACAGGAAAAAACATTAGGG + Intronic
1091242161 11:134060516-134060538 ACATATAGACAAAAAGAGGAAGG - Intergenic
1091687012 12:2570100-2570122 ACATATGGGAAACACCTGGAAGG + Intronic
1092388346 12:8053046-8053068 AGAACTAGGAAAAAACAGGAAGG - Exonic
1092451589 12:8607398-8607420 ACACTTAGGTAAAGACTGGAGGG - Intronic
1092511237 12:9159021-9159043 ACACAGGGGAAAAAAGTGGAAGG - Intronic
1092669128 12:10842558-10842580 AAATATATGAAAGAACTGAATGG - Intronic
1093079444 12:14792535-14792557 ATATATAAGAAAAATCTGGCTGG + Intronic
1093262314 12:16954024-16954046 ACATAAGAGAAAAACCTGGATGG + Intergenic
1093751796 12:22808151-22808173 ACATCTAAGAGACAACTGGATGG - Intergenic
1093905540 12:24687716-24687738 ACATATCTGAGAAAACTGCATGG + Intergenic
1094306862 12:29029711-29029733 AAGTATAAGAATAAACTGGATGG - Intergenic
1094408024 12:30139333-30139355 ACATAAAGGGAAAATCTTGAAGG + Intergenic
1095498603 12:42811986-42812008 ACATCTAGGAACAATCTGAAGGG - Intergenic
1095576101 12:43741184-43741206 ACATTTAAGCAAAAGCTGGATGG - Intronic
1096055471 12:48647457-48647479 ACATACAGGAAGAAAATGGGTGG + Intergenic
1096299644 12:50415586-50415608 ACATATAACAAAAAATTGGAAGG - Intronic
1097236676 12:57545305-57545327 ACATATAGGAAACATATAGAAGG - Intronic
1097551241 12:61073600-61073622 AAATAAAAGAAAACACTGGAAGG + Intergenic
1098550594 12:71757049-71757071 GCATAAAGGAAAACACTAGATGG - Intronic
1099321852 12:81161309-81161331 AGATATAGGAGAAAACTCGGTGG + Intronic
1100064741 12:90628496-90628518 ACATTTAAGTAAAAACAGGAAGG - Intergenic
1100337440 12:93644658-93644680 TCTTATAGGAAATATCTGGATGG - Intergenic
1100701232 12:97150628-97150650 ACACATGGGAGAAAACTTGAAGG - Intergenic
1101572893 12:105971361-105971383 AAATATAGGAGAATAATGGAAGG + Intergenic
1101658433 12:106745076-106745098 ACATATAGGAAGAATTTGGGCGG + Intronic
1103237659 12:119386758-119386780 AAATGTAGGAGACAACTGGAAGG + Intronic
1104431571 12:128720671-128720693 ACTTAAAAGAAAAAACTGGCCGG + Intergenic
1104544390 12:129698506-129698528 ACATAAAGGAAAAAAGGGGAGGG + Intronic
1105690559 13:22834304-22834326 TCATAGGGGAAAAAACTGTAAGG + Intergenic
1106839068 13:33666909-33666931 ACATATATTTAAAAAGTGGATGG + Intergenic
1106957226 13:34953683-34953705 ATATATGAGAAAAAAATGGATGG + Intronic
1107148834 13:37089132-37089154 ACAGAGGGGACAAAACTGGAAGG - Intergenic
1107739827 13:43437943-43437965 AAATAGAGGAAAAAATTGGTGGG + Intronic
1107747790 13:43530332-43530354 ACAAGTAGGAAATAATTGGATGG - Intronic
1108787775 13:53926695-53926717 ACGTATAGGAAATAATTGTAGGG + Intergenic
1109041533 13:57344846-57344868 ATATATAAGAATAAACTGGAGGG - Intergenic
1109517834 13:63467303-63467325 ACATATAGGATGAAAATGAAGGG + Intergenic
1109555674 13:63972473-63972495 ATAAACAGGAAAAAATTGGATGG - Intergenic
1109845165 13:67979211-67979233 AAGTATAGGAAAAATCTGAAAGG - Intergenic
1109959722 13:69614862-69614884 AAATGTAGTAAAAAACTGAAGGG + Intergenic
1110209581 13:72955834-72955856 ACAGATTGGAAAAATATGGAAGG - Intronic
1110431546 13:75429747-75429769 AAAAAGAGGAGAAAACTGGAGGG + Intronic
1110801671 13:79704083-79704105 ACAAAAAGGTAAAATCTGGAAGG + Intergenic
1111297219 13:86295941-86295963 AAATATAGGAAAATTCAGGAAGG + Intergenic
1111450705 13:88411239-88411261 ACATAAAGTAAAACACAGGAAGG - Intergenic
1111743613 13:92236524-92236546 ACATATATGAAAAAAAGTGAGGG - Intronic
1112732507 13:102381113-102381135 ACTTAAAGTAAAAAACAGGATGG + Intronic
1113101447 13:106724142-106724164 ACATATAGGAAGAAGCAGCAGGG + Intergenic
1114594137 14:23897370-23897392 ATATATAGAAAAAGTCTGGAAGG + Intergenic
1114788455 14:25628173-25628195 ACATTCAGGAAAACAGTGGAGGG + Intergenic
1115006772 14:28495119-28495141 AAATATAGGAGAAAATTTGAGGG + Intergenic
1117078094 14:52124446-52124468 ATATCTAGAAAAAAACTGGAAGG + Intergenic
1117586544 14:57213218-57213240 ACATATAAAAAAAAAATGGCTGG + Intronic
1118827334 14:69396082-69396104 ACATGTAGCAGAAAATTGGATGG - Intronic
1120256937 14:82132502-82132524 ACACATCAGAAAAAACAGGAGGG - Intergenic
1124124362 15:26924964-26924986 AAATGTAGGAAAAATCTGAATGG - Intronic
1124246566 15:28076150-28076172 ACATATAGGAAAGACCAGAAGGG + Intronic
1124573829 15:30890163-30890185 ATATATAGAAACATACTGGAAGG - Intergenic
1124799173 15:32812984-32813006 ACATTTGGGGAAAAAATGGATGG + Intronic
1124884122 15:33668479-33668501 AAATAGAGGAAAAACATGGATGG + Intronic
1125185203 15:36922120-36922142 GCACATAGAAAAGAACTGGAAGG + Intronic
1125750880 15:42027439-42027461 ACATCTGGGAAAAAGCTGGAGGG - Intronic
1126014661 15:44338913-44338935 ACATGAAGGAAAAAAATGAAGGG - Intronic
1126055260 15:44724104-44724126 ACCTATAGGAAAAAAATTGAAGG + Intergenic
1126341619 15:47646708-47646730 AACTTTAGGAAAAAAGTGGAAGG + Intronic
1126498081 15:49314727-49314749 ACACACAGGAAAATATTGGATGG + Intronic
1127660324 15:61094655-61094677 ACAGATAGGAAAGATCAGGAAGG + Intronic
1128651026 15:69413886-69413908 ACATATAGGACAGAGCTGGAGGG + Intergenic
1128796100 15:70467820-70467842 ACATAGAGGAAGAAAGTGGGTGG + Intergenic
1130707765 15:86249289-86249311 TCAGATAGAGAAAAACTGGAGGG - Intronic
1131034503 15:89212654-89212676 ACATGTATGAAAAGATTGGAAGG + Intronic
1131901729 15:97095085-97095107 AAATATAGGAAATATATGGAGGG + Intergenic
1132401443 15:101509621-101509643 ACACAGAGAAAAAAAATGGAAGG - Intronic
1133781102 16:8940117-8940139 AAATACAGGAAAAACCTGGATGG - Intronic
1134539106 16:15049949-15049971 CCATAGAGAAAAATACTGGAAGG + Intronic
1135017468 16:18935845-18935867 AGATATAGGAAAAGGCTGGAAGG + Intergenic
1135507883 16:23054778-23054800 TCACATAGGAAATAACTGGTAGG - Intergenic
1136015322 16:27395713-27395735 CCATATATGAAAAACCTGGCTGG + Intergenic
1136742381 16:32548350-32548372 ACATCCAGACAAAAACTGGAAGG + Intergenic
1137298908 16:47127020-47127042 AGATATAGAAAAACACTGGAAGG + Intronic
1137731260 16:50692419-50692441 ACATAAACGGAAAAACTGAAAGG + Intergenic
1137860833 16:51845234-51845256 GCGTATAGGAAAAAATTAGAAGG + Intergenic
1138362970 16:56448445-56448467 AGAAATAGAAAATAACTGGAGGG - Intronic
1139565765 16:67775013-67775035 TCATATATGAAAAACCTGGCTGG + Intronic
1140278009 16:73528129-73528151 ACATATGGGAAACATCTGCAAGG + Intergenic
1140753936 16:78050405-78050427 AAATATCTGAAAAAACTGAAAGG - Intronic
1203027218 16_KI270728v1_random:526878-526900 ACATCCAGACAAAAACTGGAAGG - Intergenic
1203044503 16_KI270728v1_random:807553-807575 ACATCCAGACAAAAACTGGAAGG + Intergenic
1142844031 17:2658142-2658164 ACACTTAGAAAAAAACTGCATGG - Intronic
1144419144 17:15080113-15080135 ACATCACAGAAAAAACTGGAAGG - Intergenic
1146108517 17:30065003-30065025 ACAGATAAGCAAAAACTTGAGGG + Intronic
1147022389 17:37547090-37547112 ACAGATTAGAAAACACTGGAAGG - Intronic
1147380858 17:40055272-40055294 ATTTACAGGAAAAAAATGGAAGG - Intronic
1147811516 17:43173277-43173299 AAATAAAATAAAAAACTGGACGG - Intronic
1148005700 17:44427571-44427593 ACAAATAATAAAAAACTGGGTGG + Intronic
1148945305 17:51257837-51257859 ACATAAAGTTAGAAACTGGATGG + Intronic
1149978006 17:61286053-61286075 TCATAAAGGAAACAACTGGTGGG + Intronic
1150563481 17:66316222-66316244 ACAGATAGGAAAAATATGTAGGG + Intronic
1150674678 17:67234750-67234772 ACATAAAGGAATATAATGGAAGG - Intronic
1151997773 17:77621178-77621200 AGACATAGAAAAAATCTGGATGG + Intergenic
1152046492 17:77939761-77939783 ACATCTAGAAAAAGACTGGAAGG - Intergenic
1153574014 18:6502790-6502812 ATGTATAGCAAAAAATTGGAAGG + Intergenic
1155167987 18:23246685-23246707 ACAAAAACGAAAAAACTGGCCGG - Intronic
1156190589 18:34715588-34715610 ACATGAAAGAAAATACTGGATGG + Intronic
1156616012 18:38785031-38785053 ACATATTGGAAACACCTAGAGGG - Intergenic
1156855219 18:41774076-41774098 ACAGATGGGGAAAAACTGGTAGG - Intergenic
1156881955 18:42091518-42091540 ATATGGAGGAAAGAACTGGAAGG + Intergenic
1156936183 18:42710920-42710942 ACATATAGCACAAAACTATAAGG + Intergenic
1157687430 18:49653635-49653657 ACAAAAAGGAAAAAACAAGAAGG + Intergenic
1159227671 18:65561002-65561024 ACATAGAGGAAAAAGCTCCATGG + Intergenic
1159249092 18:65850411-65850433 AAAGAAAGGAAAAAACTGAATGG + Intronic
1159808111 18:72980337-72980359 ACTTACAGGAAAAAAGTGGAAGG - Intergenic
1163197763 19:15735663-15735685 ACAAAAAGGAAAAGAATGGAGGG - Intergenic
1166239555 19:41480631-41480653 AGTTATATGAAGAAACTGGAGGG - Intergenic
1166500146 19:43334312-43334334 ACATACATGAAAAAATAGGATGG - Intergenic
1166916005 19:46196494-46196516 ACATTTAGAAAAAGACTGGGTGG - Intergenic
1202699547 1_KI270712v1_random:153962-153984 ACAGATGGAAAAAACCTGGAAGG - Intergenic
925624115 2:5825300-5825322 ACAAATAGCAAAAATCTGTAAGG + Intergenic
927377391 2:22434039-22434061 AAATAGAGGAAAAAACTGAGAGG - Intergenic
927827949 2:26322589-26322611 ATATCTAGAAAAAGACTGGAGGG + Intronic
927829108 2:26333078-26333100 AGATTTAGGGAAAACCTGGAAGG - Intronic
928147063 2:28788401-28788423 ACATATAGGAAATATGTGCATGG - Intronic
928408083 2:31030533-31030555 ACATAAAGCAAAAAAGTGGGTGG + Intronic
929349202 2:40928062-40928084 ACATATATGGAAACACTGGAGGG - Intergenic
929352631 2:40976933-40976955 ATTTATAATAAAAAACTGGAGGG + Intergenic
929426076 2:41846040-41846062 AGATGTAAGAAAAAACTGGGAGG + Intergenic
929774743 2:44922048-44922070 ACAAACAGGAAGAAACTGGCAGG + Intergenic
930242177 2:48947287-48947309 GAATAGAGGAAAAAACTGAAAGG + Intergenic
930593675 2:53358799-53358821 GCATATAGGAAAAAAAGGGAGGG + Intergenic
931779515 2:65567195-65567217 ACAGATGGAAAGAAACTGGAAGG - Intergenic
932287322 2:70547186-70547208 ACAAATAGGAAAAATCTATATGG + Intronic
932638197 2:73411848-73411870 ACAGGTAGGAGAAGACTGGAAGG - Intronic
932888158 2:75565867-75565889 ATAGATAGGAAATAACTGTAGGG - Intronic
934170496 2:89537450-89537472 ACAGACAGAAAAAACCTGGAAGG - Intergenic
934280798 2:91611770-91611792 ACAGACAGAAAAAACCTGGAAGG - Intergenic
935245567 2:101216244-101216266 ACATACGGGAAAAATCTGGGAGG + Intronic
936412703 2:112275023-112275045 AAATACAAGAAAAAACTGCATGG + Intergenic
937201062 2:120204804-120204826 AAATGTAAGAAAAAAATGGATGG - Intergenic
937208850 2:120254105-120254127 GCATATTGGGAAAAACAGGAGGG + Intronic
938294060 2:130166360-130166382 GCTTATAGGGAAGAACTGGAAGG - Intronic
940489361 2:154338351-154338373 ACATATTGGAAAAAAAAGTAGGG - Intronic
940661572 2:156551814-156551836 GTATATAGAAAAAGACTGGAAGG + Intronic
941089860 2:161161552-161161574 ACATACAGGAAAGATGTGGAAGG - Intronic
941662703 2:168211604-168211626 AAATATAAGAATAAATTGGAAGG - Intronic
941862446 2:170297740-170297762 ACATTTAGTAAAACACTGAAAGG + Intronic
942471262 2:176263007-176263029 ATGTATATAAAAAAACTGGATGG - Intergenic
943242398 2:185401909-185401931 ACATCTAGGAAATCACTGGATGG + Intergenic
943804464 2:192105723-192105745 ACATATATGCAGAAAATGGAAGG + Intronic
943813030 2:192213185-192213207 ACATTTAGGAGAAAATTGGAGGG - Intergenic
944584090 2:201158304-201158326 AAATAAAGGAAAGAGCTGGAAGG + Intronic
944832064 2:203542751-203542773 ACATATGGGAAAAACCTAGAAGG + Intergenic
945304678 2:208247797-208247819 GCATAAAAGAAAAAACTGGCTGG - Intronic
945424799 2:209687686-209687708 ACACACAGGAAGAAACTGCAGGG - Intronic
945709283 2:213276225-213276247 ATACATAGGAGAAAACTGAATGG - Intergenic
946755041 2:222935942-222935964 ACATAAAGTAAAAAGGTGGAGGG - Intronic
1168907107 20:1414857-1414879 ACAAAGAGGAATAAAGTGGAAGG + Intergenic
1168966329 20:1900624-1900646 ACAGAGAGAAAAAAACTGGCCGG + Intronic
1169307933 20:4509279-4509301 ACATATAGAAAAATCCTGGAAGG + Intergenic
1169534460 20:6523205-6523227 ACAGATAGAAGAAAACTGGCTGG - Intergenic
1170336923 20:15280762-15280784 ATATTTAGGAAAAATCTGAATGG - Intronic
1170439543 20:16365165-16365187 AAATATGAGAAAATACTGGATGG + Intronic
1171324134 20:24276117-24276139 ACTTATAGTAAAAAACTGATGGG - Intergenic
1172262809 20:33583005-33583027 ATGTATAAGAAAAAACTAGAAGG - Intronic
1172282377 20:33717191-33717213 AAATAAAATAAAAAACTGGAAGG + Intronic
1172722089 20:37006898-37006920 ACATATGGGTAAGAACTTGATGG - Intronic
1174040033 20:47692960-47692982 GCATCAAGGAAAAATCTGGAAGG + Intronic
1174062690 20:47843892-47843914 ACAGAGAGGAAAAAAAAGGAAGG + Intergenic
1174355236 20:49993383-49993405 ACATCAGGAAAAAAACTGGAGGG - Intergenic
1174931919 20:54825798-54825820 ACATTTAGGAAACAACAGGTAGG - Intergenic
1175354209 20:58349847-58349869 ACACATATGAAGAAACAGGAAGG + Intronic
1175750067 20:61490112-61490134 AAATATAGGAAAAAAATTGTTGG - Intronic
1177869956 21:26559243-26559265 GCATAGAGCAGAAAACTGGATGG - Intronic
1178307522 21:31502956-31502978 AAATAGAGGAAAAAAAAGGATGG + Intronic
1178755195 21:35342811-35342833 CCATTTCTGAAAAAACTGGAAGG + Intronic
1179362269 21:40721887-40721909 ACATAAAGAAAAAAACTTAAAGG + Intronic
1179831182 21:43997558-43997580 ACATATAGGCTAAAAGTGAAGGG - Intergenic
1181535588 22:23541296-23541318 ACAAAAAGGAAAGAACAGGAGGG + Intergenic
1182986834 22:34727028-34727050 ACATATAGGTTAAAAGTGAAAGG + Intergenic
1183330322 22:37216699-37216721 TCATACAGGAAAAAGCTGAAGGG - Intergenic
1184565374 22:45288751-45288773 ACATGGAGGAAAGAAATGGAGGG + Intronic
949623411 3:5842240-5842262 GCATATAAGAAAAAACTGTGAGG + Intergenic
949798296 3:7875415-7875437 ATATTCAGGAAAAAAATGGAGGG + Intergenic
950117847 3:10462990-10463012 ACATATATGCAAAAGTTGGAAGG - Intronic
953176276 3:40555762-40555784 AATTATAGGACAAAACTGAAAGG - Intronic
954520970 3:51226022-51226044 ACATGTAGGATAGAACTAGAGGG - Intronic
954607150 3:51920933-51920955 ACATTTGGGAACAACCTGGATGG - Intergenic
954734921 3:52699131-52699153 ATGTGTAGGAAAAAACTGGAAGG + Intronic
956314959 3:67924805-67924827 AGATATAGAAATAAACTTGATGG + Intergenic
956374220 3:68596906-68596928 CCCTATAGGAAAGACCTGGAAGG + Intergenic
958443693 3:94188616-94188638 ACATATAAAAAAAAACTTGATGG - Intergenic
959627250 3:108466492-108466514 ACATCTGGGAAAAACCAGGAGGG + Intronic
959931646 3:111990379-111990401 ACATATAGACAAATATTGGAAGG + Intronic
959973174 3:112429430-112429452 ACATATAAGAAAGAACAGCAAGG - Intergenic
960430969 3:117568159-117568181 AAATAAAAGAAAAAAATGGAGGG + Intergenic
960830280 3:121839425-121839447 ACACAAAGGGAAATACTGGAAGG - Intronic
962225918 3:133608378-133608400 ACAAATAGAATAAAACTGAAAGG + Intronic
963795810 3:149629831-149629853 ACATATAGGGAAAAACTTGAAGG + Intronic
964225281 3:154391799-154391821 ACATATAGGCCAAAAGTGTAGGG + Intronic
964730132 3:159856316-159856338 ACATAAAGGAACAAACTACATGG + Intronic
965071868 3:163924885-163924907 ACATACAGAATAAAACAGGAGGG + Intergenic
965579753 3:170254760-170254782 ACAAAAAGAACAAAACTGGAGGG - Intronic
965669617 3:171133647-171133669 AAATATAGGAGAGACCTGGAAGG - Intronic
965743642 3:171902539-171902561 ATATATACAAAAAAACTAGAAGG - Intronic
966161940 3:176977880-176977902 ACAAATAGGATAAAGGTGGAGGG - Intergenic
967929999 3:194684177-194684199 CCAAATAGGAAAAGACTGAAGGG - Intergenic
971062212 4:22985090-22985112 ATATATAGGAAATAAATGGCTGG + Intergenic
972772227 4:42208226-42208248 ACATTTAGGCTAAAACTGGAGGG - Intergenic
973698484 4:53514049-53514071 AGATGCAGGAACAAACTGGATGG - Intronic
973974047 4:56244400-56244422 ACATTTAGGAAAGAACATGATGG + Intronic
974217170 4:58864408-58864430 AAATAAAGAAAAAAGCTGGAAGG + Intergenic
975032151 4:69634319-69634341 ACATATAAGAAGGAATTGGAAGG + Intronic
975124307 4:70764887-70764909 AAATATAGCACAAAATTGGACGG + Intronic
975289789 4:72664250-72664272 ACACAAAGGAAAATACTGCATGG + Intergenic
975727506 4:77306293-77306315 ACATGTAGGAACTTACTGGAAGG + Intronic
978012634 4:103706608-103706630 ACATATAATAAAAAACTGGGGGG + Intronic
978668051 4:111210557-111210579 ACATATAAGAAAATTCTGGCTGG + Intergenic
978843981 4:113250064-113250086 AAATATAGACAAAAACTTGAAGG - Intronic
979021580 4:115506292-115506314 ACACATAGGTAAAAATTAGAAGG + Intergenic
979488995 4:121302971-121302993 ACATTGAAGAAAAAAATGGAGGG + Intergenic
979593254 4:122504933-122504955 AAACAAAGGAAAAAAGTGGAAGG - Intergenic
980437497 4:132797276-132797298 ATATTTTAGAAAAAACTGGAAGG - Intergenic
980665712 4:135931200-135931222 ACATTTAAGAAAATACTTGAAGG - Intergenic
980907752 4:138964649-138964671 ATATATAGAAAAAGTCTGGAGGG - Intergenic
981765519 4:148244375-148244397 GCATATTGGAGAAAAGTGGAGGG - Intronic
981992259 4:150935636-150935658 AAATATATGAAAAAAGTGAAGGG + Intronic
982317660 4:154047925-154047947 AAATAGGGGAAAACACTGGAAGG - Intergenic
982885074 4:160768811-160768833 ACATATTTTAAATAACTGGAAGG - Intergenic
982922458 4:161292740-161292762 ACAGAAAGGGAAAAACTGGCAGG - Intergenic
982922854 4:161297744-161297766 ACAGAAAGGGAAAAACTGGCAGG + Intergenic
983288563 4:165770986-165771008 ATATATAGGAAAAGGGTGGATGG + Intergenic
983611573 4:169651693-169651715 ATATTTAGGAAAAAAATGGATGG - Intronic
983815317 4:172119342-172119364 ACACATTTGAAAAAACTGAATGG + Intronic
983891012 4:173030304-173030326 ACATACAGCTAAAAACAGGATGG - Intronic
984754069 4:183308849-183308871 ATATTTGGGAAAAAAATGGATGG - Intronic
984863710 4:184262667-184262689 ATATATAGAAAAAAGCTGGAGGG + Intergenic
985765074 5:1773451-1773473 ACAAATAGATAAATACTGGAAGG + Intergenic
987683274 5:21164842-21164864 AGAAATAGGAAAACACTGGGAGG + Intergenic
987790157 5:22555136-22555158 ACATTTAAGACTAAACTGGATGG - Intronic
988396505 5:30702598-30702620 ACATTTAAGCAAAAACTTGAAGG + Intergenic
988729682 5:33959175-33959197 ACATAGAGGAAAAAATGGAAAGG - Intronic
990641671 5:57792353-57792375 ACAAAAGGAAAAAAACTGGAAGG - Intergenic
991253212 5:64586389-64586411 AGGCAGAGGAAAAAACTGGAAGG - Intronic
991279479 5:64895351-64895373 TCATATAAGAAAAAATTTGAGGG + Intronic
991398048 5:66225194-66225216 ACATTTAGGCAAAGACTTGAAGG + Intergenic
991572887 5:68074237-68074259 ACATACAGGAGATAATTGGAGGG + Intergenic
992613262 5:78525955-78525977 TCAGATAGGAAGAAGCTGGAAGG - Intronic
993082039 5:83313467-83313489 GCAAATAGGTAAAAACTGGGGGG - Intronic
993312383 5:86350798-86350820 AGGTATAGGACAAAACTAGAGGG + Intergenic
993511474 5:88776609-88776631 ATAGATAGAAAAATACTGGAAGG + Intronic
994192790 5:96886982-96887004 ACATATAGAAAATATTTGGAAGG - Intronic
995260421 5:110097674-110097696 ATATAAAGAAAAAAACTTGAAGG - Intergenic
995324841 5:110878497-110878519 ACATAAAGGACAAAACTAGAGGG - Intergenic
995580408 5:113594443-113594465 ACATACTGAAAAAAAATGGAAGG - Exonic
996108331 5:119533796-119533818 ACATGCAGGAAGAAAATGGAAGG + Intronic
996203780 5:120705345-120705367 ATATATAGAAAAAAATTTGAGGG - Intergenic
999836615 5:155380225-155380247 ACATAGAGGAAAACTCTGAAAGG + Intergenic
1000189150 5:158892059-158892081 GCATATAGGAATAAAATGAAGGG - Intronic
1000299465 5:159942770-159942792 ATACATAGAAAAAAACTGGAAGG + Intronic
1000428121 5:161116538-161116560 CTATTTAGGAAAGAACTGGAGGG - Intergenic
1001427580 5:171633712-171633734 ACACAGAGGAAAGATCTGGAAGG + Intergenic
1001887206 5:175303652-175303674 ACATTTAGGCAACAACTTGAAGG + Intergenic
1002551779 5:179999395-179999417 ACATATAGGCTAAAAATGAAGGG - Intronic
1003272198 6:4617097-4617119 TCAAATAGGGAGAAACTGGAAGG + Intergenic
1005765231 6:29004904-29004926 ACCTATAAGAAAACACTTGAAGG - Intronic
1007113490 6:39327191-39327213 ACATATAGGTACCACCTGGAAGG + Intergenic
1008039803 6:46785234-46785256 ATAAATAATAAAAAACTGGAAGG + Intergenic
1008176886 6:48279159-48279181 AAAGAGAGGATAAAACTGGATGG - Intergenic
1008845543 6:55958647-55958669 ACATATAGGTAAAAAATGTATGG - Intergenic
1010063407 6:71651316-71651338 ACTTAAAGTAAAAAACTGAAAGG - Intergenic
1010087943 6:71943043-71943065 ACATATTCAAATAAACTGGACGG - Intronic
1010246368 6:73663228-73663250 ACCTAAAAGAAAAAACTGGCCGG + Intergenic
1010505766 6:76656971-76656993 ACATATATGAAAGAAATTGAAGG + Intergenic
1010609972 6:77942625-77942647 ACATTTAAGGAAGAACTGGAGGG + Intergenic
1010836234 6:80590205-80590227 AAATAAAGGAGGAAACTGGAGGG + Intergenic
1010887926 6:81266809-81266831 ACAAATAGGCTAAAAATGGAGGG + Intergenic
1011734988 6:90301584-90301606 ATGCATAGGAAAAATCTGGAAGG + Intergenic
1011996338 6:93593632-93593654 AAAGATAGGCACAAACTGGAGGG + Intergenic
1012177866 6:96111159-96111181 ATATAGAGGAAGAAACTGAAGGG + Intronic
1012715654 6:102666000-102666022 GCATAAAGAACAAAACTGGAGGG + Intergenic
1012890895 6:104896109-104896131 ACATATGGGAAGAAATTGGAGGG - Intergenic
1013885813 6:114964748-114964770 ACACATAAGAATAAACTGGCTGG - Intergenic
1013950350 6:115772921-115772943 ACATATAGGTAAAAACATGAAGG - Intergenic
1015908390 6:138141697-138141719 ATACATAGGAAAAATCTGGAAGG - Intergenic
1016168814 6:140982414-140982436 ACATATGGGAAAAAAGGGTATGG - Intergenic
1016762321 6:147751171-147751193 ACATTTAAGAAAAAACCTGAAGG - Intergenic
1016893332 6:149028470-149028492 AGAAAGAGGAAAAAATTGGAAGG + Intronic
1017385947 6:153883791-153883813 AAATATAGAAAAAAACTAAATGG + Intergenic
1018758997 6:166873919-166873941 ACAGATAAGAAAAACCTGGCTGG - Intronic
1019866810 7:3719583-3719605 ACATTTAGGACAAAAGTGGGTGG + Intronic
1021465913 7:20943490-20943512 ACAAAAAGGAAAAAAGTGAATGG + Intergenic
1021529548 7:21629012-21629034 ACATATATCAAAAAAGTAGAAGG - Intronic
1022321838 7:29295212-29295234 AAATATTTGAAAAAAATGGATGG - Intronic
1022569531 7:31438107-31438129 ACATATAGGAAAAAAAGGACAGG - Intergenic
1022584970 7:31599992-31600014 AAATATAGAAAATAACTGGCTGG - Intronic
1023579530 7:41666670-41666692 GGATATGGGAAAAAACTGGAGGG - Intergenic
1024102853 7:46050592-46050614 ATAAATAGGAAAAAATTGCAGGG - Intergenic
1024173300 7:46811856-46811878 TAATAGAGGAAAAAACTGAATGG - Intergenic
1024876508 7:54030308-54030330 ACAAAGAAGAAAAAAATGGAAGG + Intergenic
1025169364 7:56742399-56742421 ACATTTGGGTAAAGACTGGAAGG - Intergenic
1025702536 7:63833289-63833311 ACATTTGGGTAAAGACTGGAAGG + Intergenic
1026171752 7:67960070-67960092 ACATTTGGGTAAAGACTGGAAGG + Intergenic
1026952287 7:74355611-74355633 AAAGAAAGAAAAAAACTGGATGG + Intronic
1027574355 7:79913505-79913527 ACACATAGGAAGAAAATGTAAGG + Intergenic
1027651309 7:80872310-80872332 AAAAATAGAAAAAAACTGGCTGG - Intronic
1027818454 7:83010677-83010699 TCAGATAGGGATAAACTGGAGGG - Intronic
1028145757 7:87318541-87318563 CCAGCAAGGAAAAAACTGGATGG - Intergenic
1028230021 7:88295904-88295926 ACTTAGAGGAAAAAATTGTAAGG - Intronic
1028463804 7:91126223-91126245 ACAGGCAGGAAAAATCTGGAAGG + Intronic
1028504584 7:91557179-91557201 ACTTACAGGAAAAAAGTGGCCGG - Intergenic
1028804834 7:95012967-95012989 ACATATACAAAAAAAATGGAAGG - Intronic
1029462251 7:100702288-100702310 AGATTTAGGAAAAAACTTCATGG - Intergenic
1031323303 7:120360792-120360814 AGATATAAGAAAACAATGGATGG + Intronic
1031378707 7:121059559-121059581 AAATGTAAGAAAACACTGGAGGG - Intronic
1031384781 7:121135557-121135579 TTATAGAGGAAAAAACTGGTGGG - Intronic
1031699809 7:124910089-124910111 ACACATATAAAAAACCTGGAAGG + Intronic
1031756157 7:125645468-125645490 ATATATAACAAAAATCTGGAAGG - Intergenic
1032933375 7:136699664-136699686 GCAGATAAGAAAAAACAGGAGGG - Intergenic
1033412790 7:141134797-141134819 ACATATAGACTAAAAGTGGAGGG + Intronic
1033972205 7:147055910-147055932 ACATCTGGGAAAAGCCTGGAGGG - Intronic
1034996439 7:155580203-155580225 ACAGAGAGGAAGAGACTGGAAGG + Intergenic
1035958415 8:4109229-4109251 ACATTCAGAAAAAAAATGGATGG - Intronic
1036027115 8:4921770-4921792 ACATATAAGAAAAAAATGGCTGG - Intronic
1036917609 8:12819932-12819954 ACATGTTGGTCAAAACTGGAGGG - Intergenic
1037283924 8:17275447-17275469 ACATTGAGGTAGAAACTGGATGG + Intronic
1037676044 8:21051457-21051479 ATAAATAGGAAGAAGCTGGAAGG + Intergenic
1040425935 8:47286387-47286409 ACATAAAGGGAAAAACAGCATGG + Intronic
1040452323 8:47560486-47560508 ACTTATAAGCAGAAACTGGAAGG - Intronic
1040663367 8:49600776-49600798 ACATGTAAGAAAAAAATGGGAGG + Intergenic
1041346223 8:56901444-56901466 ACAAATGGGAAGAAACTGGCTGG + Intergenic
1042405993 8:68406149-68406171 ACAGAGAGGAAACAAATGGAAGG + Intronic
1042462224 8:69082950-69082972 ACATTGAGGAAAAAAATGGACGG - Intergenic
1042577557 8:70237411-70237433 AAAAAAAGGAAAATACTGGATGG - Intronic
1042807043 8:72782282-72782304 AGATATAGGGAAAAATTGTAGGG + Intronic
1043238762 8:77903637-77903659 ACATAGAGGAAAAAAGGGGATGG - Intergenic
1043706764 8:83359675-83359697 ACAGATAGGTAAAAAATGAAAGG - Intergenic
1044570738 8:93715487-93715509 ATGCATAGGAAAAATCTGGAAGG - Intronic
1045328639 8:101136374-101136396 CAAAATAGTAAAAAACTGGAGGG + Intergenic
1045349712 8:101327955-101327977 AGACATAGAAAAAAACTGCAAGG + Intergenic
1045396557 8:101766434-101766456 ATATATAAGAAAAATCTGGAAGG - Intronic
1045873945 8:106957257-106957279 ATTTATAAGAAAAAACTGGCTGG - Intergenic
1046466248 8:114607786-114607808 ACATGTAGCAAAAAGCTGGCAGG - Intergenic
1046620703 8:116526613-116526635 ACAAATAGGAAAAGAATGGCAGG - Intergenic
1046988937 8:120427433-120427455 ACATATATGAAAAAAATCAATGG + Intronic
1047719706 8:127628302-127628324 AGATCTAGGTAAAAACTGGCTGG + Intergenic
1047872434 8:129099059-129099081 AGATAAAGGCAAAAACTTGATGG - Intergenic
1047930318 8:129722060-129722082 CCATAAAGGAACATACTGGAGGG - Intergenic
1048186378 8:132245298-132245320 ACAAATAGGAAGAAACTGCAGGG - Intronic
1048746350 8:137618421-137618443 AGACATAGGAAAAAAATGAATGG + Intergenic
1049311148 8:141934603-141934625 GCATCTAGGACAAAACTGGAGGG + Intergenic
1049627087 8:143629333-143629355 AAGTATAGGCTAAAACTGGAGGG - Intergenic
1050035594 9:1432718-1432740 ATATATATGAAAAAAGTGGCTGG + Intergenic
1050427860 9:5530355-5530377 AGACAAAGGAGAAAACTGGAAGG - Intronic
1050454334 9:5818551-5818573 ACAAAAAGTAAAAAACTGGCTGG + Intronic
1051426537 9:16937772-16937794 ACATTTAAGAAAGAACTGGCCGG + Intergenic
1052326232 9:27219200-27219222 GCATATTTTAAAAAACTGGAAGG + Intronic
1052463347 9:28795819-28795841 ACATATCAGAAGGAACTGGAAGG + Intergenic
1052505225 9:29344808-29344830 ACATATTGGAAAAATCTCAAAGG - Intergenic
1052720998 9:32170833-32170855 ACATATAAAAACATACTGGAAGG - Intergenic
1055129562 9:72759312-72759334 TCCTATAGGAAAAATCTGCAAGG + Intronic
1055263065 9:74461667-74461689 AAATATAGGACAAAAATTGAAGG + Intergenic
1056315601 9:85386644-85386666 ACATATACTAAAAAGCTTGAAGG + Intergenic
1056708627 9:88972071-88972093 AAAAAAAGAAAAAAACTGGATGG - Intergenic
1058895195 9:109394841-109394863 ACAAAGAGGAAGAAACTGGCCGG + Intronic
1059208821 9:112491920-112491942 AAATATAAGAAAAAACTGAAGGG - Intronic
1059390645 9:113997758-113997780 TCATAGAGGAAAAAAGTGGCTGG + Intronic
1060099824 9:120829895-120829917 AGATATAGGAAGACACTGAAGGG + Intronic
1060118201 9:120962751-120962773 ACACAAAGGAAATCACTGGAGGG + Exonic
1060136855 9:121165434-121165456 ACCCCTAGGAAAAATCTGGAAGG - Intronic
1060146049 9:121253311-121253333 ACAGATAGGGACAATCTGGATGG - Intronic
1060581798 9:124754590-124754612 ACAAAAAGGAAAAAAATGGTGGG + Intronic
1061699211 9:132402814-132402836 CCATATAGGAATAAAATGGAAGG - Exonic
1062665872 9:137671420-137671442 ACATATAGTAAAAACCTGAAGGG + Intronic
1062701117 9:137904047-137904069 AGAGAAAGGAAAAAACTGGCAGG - Intronic
1186501237 X:10052400-10052422 ACACTTAAGAAAGAACTGGAAGG - Intronic
1186745857 X:12567825-12567847 GCATATAGGAAAAAAGTTCAGGG - Intronic
1186928912 X:14365885-14365907 ACACAAAGGTAAAAACTGAAAGG + Intergenic
1188282009 X:28281679-28281701 ACATAGAAGAAAAAAATTGAAGG - Intergenic
1188700286 X:33251342-33251364 ACAAAGAGGAGGAAACTGGATGG - Intronic
1188992524 X:36839747-36839769 ACAAAAAGGTAAAAAGTGGAAGG + Intergenic
1189376942 X:40473885-40473907 GCATATAGGTTAAAACAGGATGG + Intergenic
1189590180 X:42502572-42502594 ACATATAGAAAAGAAATGTAGGG - Intergenic
1190539736 X:51464702-51464724 AACAATAGAAAAAAACTGGATGG - Intergenic
1190735784 X:53255402-53255424 ACATATAGGAAAAAACTGGAAGG - Intronic
1191001393 X:55663241-55663263 AGATAAAGGAAAAAAGGGGAGGG + Intergenic
1194521904 X:94930272-94930294 ACAAATTGGAAAAATCTAGAAGG - Intergenic
1194530977 X:95047958-95047980 ACATAGAAAAAAAAACAGGAAGG + Intergenic
1194895410 X:99433489-99433511 ACATAGAGGAAAAAAGTTGGTGG - Intergenic
1195056480 X:101150816-101150838 AAAGAAAGGAAAACACTGGATGG - Intronic
1195488017 X:105432496-105432518 ACAGATAGGAAAAATGTGGCTGG + Intronic
1195963851 X:110412831-110412853 ACATACAGGAAAAGACTGGAAGG + Intronic
1196919887 X:120574715-120574737 ACAAATAGGATAAAATTGGCTGG - Intronic
1197292437 X:124675411-124675433 ACACATAGCATAAATCTGGATGG - Intronic
1198239325 X:134767669-134767691 AACTATAGGCAAAAACTGAATGG + Intergenic
1198953163 X:142096344-142096366 ATATATAGGAAAAAATGGCATGG - Intergenic
1198994998 X:142564220-142564242 GCATAAAGAACAAAACTGGAGGG - Intergenic
1199026125 X:142940775-142940797 ACATAATGGAAAAAAATGAAAGG + Intergenic
1200286063 X:154823419-154823441 ATATATAGAAAAAAATTGAAGGG + Exonic
1201483844 Y:14471062-14471084 ATATACAGGAAAAAAGTGGATGG - Intergenic